Zenodo

Browse

Open repository for EU-funded research outputs from Horizon Europe, Euratom, and earlier Framework Programmes.

October 15, 2024 (v0.11.0)

Software

Open

MC/DC: Monte Carlo Dynamic Code

Center for Exascale Monte Carlo Neutron Transport (CEMeNT) Variansyah, Ilham Morgan, Joanna Piper

MC/DC is a performant, scalable, and machine-portable Python-based Monte Carlo neutron transport software currently developed in the Center for Exascale Monte Carlo Neutron Transport (CEMeNT).

Uploaded on October 15, 2024

Part of Center for Exascale Monte Carlo Neutron Transport (CEMeNT)

3 more versions exist for this record

197

20
October 8, 2024 (v1)

Dataset

Open

TABLE 2 in New records of Gemeneta opilionoides (Orthoptera, Catantopinae) in the world's second largest rainforest

Oumarou-Ngoute, Charly

TABLE 2. Plant species composition in the Gemeneta opilionoides habitat at Ngutadjap in Cameroon. 5: coverage>75% of the referenced surface; 4: coverage between 50–75% of the referenced surface; 3: coverage between 50–25% of the referenced surface; 2: coverage between 25–5% of the referenced surface; 1: coverage <5% of the referenced surface;...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5519(2), 274, 2024.

16

0
October 8, 2024 (v1)

Dataset

Open

TABLE 1 in New records of Gemeneta opilionoides (Orthoptera, Catantopinae) in the world's second largest rainforest

Oumarou-Ngoute, Charly

TABLE 1. Distribution data of Gemeneta opilionoides. MNCN = Museo Nacional de Ciencias Naturales, Madrid, España; ZMUC = Zoological Museum, University of Copenhagen, Denmark; ONC = Personal Collection of C. Oumarou-Ngoute in Cameroon. CountriesLocalitiesGeographic coordinates and date of recordSpecimens...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5519(2), 272, 2024.

18

0
September 30, 2024 (v1)

Dataset

Open

TABLE 1 in Two new species of mites in the family Pachylaelapidae from Türkiye (Acari: Mesostigmata)

Özbek, Hasan Hüseyin Halliday, Bruce

TABLE 1. Pachylaelapid mites in Türkiye (Acari: Gamasida: Pachylaelapidae). SpeciesReferencesOlopachys (Olopachylaella) transversalis Özbek & Halliday, 2015Özbek & Halliday (2015a)O. (Olopachys) caucasicus Koroleva, 1976Present studyO. (Olopachys) crescentus Özbek, 2016Özbek (2016)O. (Olopachys) digitus Özbek, 2016Özbek (2016)O. (Olopachys)...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5514(4), 334, 2024.

19

0
September 30, 2024 (v1)

Dataset

Open

TABLE 4 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi

Bahder, Brian W. Randretsiferana, Safidinirina Armande Randretsiferana, Andrianatenaina

TABLE 4. Host plants association for Afotropical Oecleini. Cixiidae speciesDistribution Plant speciesPlant orderPlant familyAuthorEumyndus jeanjacquei sp. nov.Madagascar Vonitra fibrosa (C.H. Wright) Becc.ArecalesArecaceaePresent paperEumyndus metcalfi Synave, 1956Madagascar Pandanus sp.Pandanales R. Br. ex Bercht. & J. Presl,Pandanaceae R....

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5514(4), 350, 2024.

23

1
September 30, 2024 (v1)

Dataset

Open

TABLE 3 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi

Bahder, Brian W. Randretsiferana, Safidinirina Armande Randretsiferana, Andrianatenaina

TABLE 3. Biometric data for Eumyndus jeanjacquei sp. nov. (in mm) Male (n= 11)Female (n =9)CharacterRangeAverage±SERangeAverage±SEBody length, with wings4.0–4.24.1±0.14.2–4.44.3±0.1Body length, no wings3.5–3.63.6±0.13.6–3.73.7±0.1Forewing length3.5–3.53.5±0.03.7–3.73.7±0.0Vertex length0.4–0.50.4±0.10.5–0.50.5±0.0Vertex width, basal...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5514(4), 342, 2024.

17

0
September 30, 2024 (v1)

Dataset

Open

TABLE 2 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi

Bahder, Brian W. Randretsiferana, Safidinirina Armande Randretsiferana, Andrianatenaina

TABLE 2. Cixiid taxa used in the molecular analyses to place Eumyndus jeanjacquei sp. nov. and their corresponding GenBank accession numbers for the loci analyzed. LocusSpeciesCOI18S28SEumyndus jeanjacquei sp. nov.PP700697PP702191PP702194Eumyndus metcalfiPP700698PP702192PP702196Haplaxius radicisPP379550PP379293PP379286Haplaxius...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5514(4), 341, 2024.

18

0
September 30, 2024 (v1)

Dataset

Open

TABLE 1 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi

Bahder, Brian W. Randretsiferana, Safidinirina Armande Randretsiferana, Andrianatenaina

TABLE 1. Primers used to amplify loci used for assessment of Eumyndus jeanjacquei sp. nov. and corresponding annealing temperatures and extension times. Gene Primer NameSequence (5’→3’)Annealing ExtensionReferenceCOI LCO1490 HCO2198GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA40˚C1 min. 30 sec. Folmer et al. 199418S 18SFI...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5514(4), 341, 2024.

18

0
October 8, 2024 (v1)

Dataset

Open

TABLE 4 in Abrolophus from Australasia, and the mysterious Mypongia (Trombidiformes: Parasitengona: Erythraeidae)

Seeman, Owen D. Beard, Jennifer J. Fan, Qing-Hai

TABLE 4. Standard measurements for male and nymphal Abrolophus ripicola syntypes, other material of A. ripicola, and the holotype male of A. zelandicus. Prodorsal shield poorly defined, length measured to anterior margin of base of ASens, prodorsal shield width not provided. x = not measurable or missing; * = recorded but distorted structure on...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5519(2), 165-166, 2024.

18

0
October 8, 2024 (v1)

Dataset

Open

TABLE 3 in Abrolophus from Australasia, and the mysterious Mypongia (Trombidiformes: Parasitengona: Erythraeidae)

Seeman, Owen D. Beard, Jennifer J. Fan, Qing-Hai

TABLE 3. Standard measurements for female Abrolophus ripicola syntypes and other material. Prodorsal shield poorly defined anteriorly, length measured to anterior margin of base of ASens, prodorsal shield width not provided. x = not measurable; * =distorted; bold font indicates differences of interest between syntypes and intercepted...

Uploaded on October 15, 2024

Part of Biodiversity Literature Repository

Published in Zootaxa, 5519(2), 161-163, 2024.

19

0

Safe — your research is stored safely for the future in CERN’s Data Centre for as long as CERN exists.
Trusted — built and operated by CERN and OpenAIRE to ensure that everyone can join in Open Science.
Citeable — every upload is assigned a Digital Object Identifier (DOI), to make them citable and trackable.
No waiting time — Uploads are made available online as soon as you hit publish, and your DOI is registered within seconds.
Open or closed — Share e.g. anonymized clinical trial data with only medical professionals via our restricted access mode.
Versioning — Easily update your dataset with our versioning feature.
GitHub integration — Easily preserve your GitHub repository in Zenodo.
Usage statistics — All uploads display standards compliant usage statistics

Featured communities

Recent uploads