Published May 9, 2023 | Version 2
Dataset Open

rCRUX Generated Cephalpod 18S Reference Database

Authors/Creators

  • 1. NOAA PMEL
  • 2. Vermont Biomedical Research Network
  • 3. Landmark College
  • 4. Universidad Autónoma de Madrid

Description

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  Ceph18S
Gene:   18S
Length of Target:    150–190
get_seeds_local() minimum length:    105
get_seeds_local() maximum length:    235
blast_seeds() minimum length:    65
blast_seeds() maximum length:    195
max_to_blast:  100
Forward Sequence (5'-3'):   CGCGGCGCTACATATTAGAC
Reverse Sequence (5'-3'):    GCACTTAACCGACCGTCGAC
Reference:    D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021) https://doi.org/10.1098/rsos.201388

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.  

Files

Files (31.7 MB)

Name Size Download all
md5:a3c025f0b0b625208af5a946e56b5a8e
31.7 MB Download