Eurythenes obesus Chevreux 1905
Description
Eurythenes obesus (Chevreux, 1905)
(Fig. 46)
Katius obesus Chevreux, 1905: 1, figs. 1–3.— Schellenberg, 1926: 217, fig. 26d.— K.H. Barnard, 1932: 36, fig. 21, pl. 1 fig. 1.— Chevreux, 1935: 63 –65, pl. 10 fig. 4, 6, pl. 11 fig. 10.— Shoemaker, 1956: 177.
Eurythenes gryllus.— Stephensen, 1933: 12, in part, fig. 6 only.
Eurythenes obesus.— Barnard, 1961: 38, fig. 8.— Bellan-Santini & Ledoyer, 1974: 680, pl. 25.— Stoddart & Lowry, 2004: 445, figs. 12–15 (ubi syn.).— Senna & Serejo, 2008: 374, figs. 1–2.— Senna, 2009: 88, fig. 3.
Material examined. Tjalfe sta. 15, off SE Greenland, 58°08'N 39°24'W, 500 m wire, ring trawl, 26.05.1908: 2 specimens, TSZCr. 2722.—Station ANO 315-D704 [or DT04???] (the coordinates could not be traced), no date: 2 specimens, with a label concerning colour notes: small one, gray and pale pink; large one, bright red, leg. J.B., TSZCr 19070. —RV Polarstern, expedition PS79, ANT-XXVIII/3, Southern Ocean, mid of Atlantic sector, sta. 141-7, 51°15.95’S 12°37.70’W, 4109.5 m, Agassiz Trawl, 18.ii.2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122852, Eob-C103, ANT283-103 (COI).—ANT-XXVIII/3, NW of South Georgia, sta. 172-3, 49°12.81’S 38°12.97’W, 0 m, Rectangular Midwater Trawl, 01.iii.2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122853, Eob-C112, ANT283-112 (COI).
Voucher DNA sequences.
Eob-C103, COI:
TGAGCTAGCGTTGTAGGCACATCCCTAAGCCTAGTTATTCGATCTGAGCTCAGTGGGCCAGGAAATCT AATTGGAGATGACCAAATCTATAACGTAATAGTAACTGCTCACGCCTTCGTAATAATCTTCTTTATAGTT ATACCTATTATAATCGGAGGATTTGGCAATTGACTGGTCCCCCTTATACTAGGGAGCCCTGACATAGCTT TCCCACGGATAAATAACATAAGATTCTGACTACTGCCCCCCTCACTAACCTTGTTACTGATAAGGGGAT TAGTAGAGAGAGGCGTAGGAACAGGCTGGACCGTTTACCCCCCCCTAGCCGCAGCCGCAGCTCATAG CGGAGGATCTGTTGACCTAGCTATCTTCTCCCTTCATCTAGCGGGAGCCTCTTCTATTTTAGGGGCTATC AACTTTATCTCTACCGTAATTAACATGCGAGCCCCTGGGATATATATAGACCGCGTCCCTTTATTTGTCT GGTCGGTCTTCATCACAGCCATTCTTCTACTCTTATCCCTACCAGTATTAGCGGGTGCAATTACAATACT CTTAACAGACCGAAATCTAAATACCTCCTTTTTCGACCCTGGCGGGGGAGGTGACCCCATTCTTTACC AGCACCTATTT
Type specimens and localities. Types not examined. Chevreux’s holotype specimen of E. obesus was a 12 mm male sampled south of the Azores, in the eastern North Atlantic Ocean: Prince of Monaco sta. 1849, 36°17'N 28°53'W, 0–3000m over 3400m, filet Richard à grande ouverture, 8.9.1904, 08:25–11:55hrs. This specimen has been lost and Stoddart & Lowry (2004) have designated a neotype: female 48 mm, with setose oostegites and hatchlings (BMNH 2003.1059), RRS Discovery, stn 9541#30, NE of Cape Verde Islands, eastern North Atlantic Ocean, 20°1.8’N 21°19.8’W to 20°1.3’N 21°20.0’W, 995–1500 m over bottom depth 3800–3850 m, rectangular midwater trawl RMT 8, 22.4.1977, 19:21–23:21hrs.
Description. See e.g. Stoddart & Lowry (2004).
Diagnostic characters. E. obesus is characterized by the extremely long dactylus of its pereopods 3–7. The eye of E. obesus is narrowly linear instead of being broad and nearly L-shaped' as in the Eurythenes of the gryllus - complex.
Colour pattern. Specimen of ANT-XXVIII/3, sta. 172-3: pale orange; merus, carpus, propodus and dactylus of pereopods 6–7 pale pink; eye whitish (see figure 46). The label of the two specimens of Station ANO 315-D704 indicates: small one, gray and pale pink; large one, bright red. So, it seems that E. obesus exhibits colour variation similar to E. gryllus and E. andhakarae sp. nov.
Size. Up to 80 mm (Stoddart & Lowry 2004).
Distribution and depth range. Cosmopolitan, exceptionally near the surface (present material), normally between 128 m and 1600 m, most commonly below 1000 m (Stoddart & Lowry 2004; Senna & Serejo 2008). One of the specimens recorded here was found in a trawl used at 4110 m, but it is likely that it was caught in the water column when the net was hauled up.
Biology. It suffices to repeat herein the account of Stoddart & Lowry (2004). “Very little is known of the life habits of E. obesus. It has never been taken in baited traps; has frequently been taken in midwater trawls; and has once been recorded as burrowing into a salp (Stephensen 1915), once as having coelenterate remains in the stomach (Hopkins 1985), once with possibly siliceous sponge spicules in the stomach (Brusca 1967), and once as attacking fish taken in midwater trawls (Thurston & Bett 1995).”
Remarks. In the absence of relevant studies, it is not known whether E. obesus is genetically homogeneous or not across its nearly cosmopolitan range of distribution.
Notes
Files
Files
(5.3 kB)
Name | Size | Download all |
---|---|---|
md5:2bb89201951a83a4a245bf84a5f9b3c8
|
5.3 kB | Download |
System files
(28.4 kB)
Name | Size | Download all |
---|---|---|
md5:31ec28330efa3bf544144509eece8e12
|
28.4 kB | Download |
Linked records
Additional details
Identifiers
Biodiversity
- Family
- Lysianassidae
- Genus
- Eurythenes
- Kingdom
- Animalia
- Order
- Amphipoda
- Phylum
- Arthropoda
- Scientific name authorship
- Chevreux
- Species
- obesus
- Taxon rank
- species
- Taxonomic concept label
- Eurythenes obesus Chevreux, 1905 sec. D'Acoz & Havermans, 2015
References
- Chevreux, E. (1905) Description d'un amphipode (Katius obesus, nov. gen. et sp.), suivie d'une liste des amphipodes de la tribu des Gammarina ramenes par le filet a grande ouverture pendant la derniere campagne de la Princesse-Alice en 1904. Bulletin du Musee oceanographique de Monaco, 35, 1 - 7.
- Schellenberg, A. (1926) Amphipoda 3: Die Gammariden der Deutschen Tiefsee-Expedition. Wissenschaftliche Ergebnisse der Deutschen Tiefsee-Expedition auf dem Dampfer Valdivia 1898 - 1899, 23 (5), 193 - 243, pl. 5.
- Barnard, K. H. (1932) Amphipoda. Discovery Reports, 5, 1 - 326.
- Chevreux, E. (1935) Amphipodes provenant des campagnes du Prince Albert Ier de Monaco. Resultats des Campagnes scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco, 90, 1 - 214, pls. 1 - 16.
- Shoemaker, C. R. (1956) Notes on the amphipods Eurythenes gryllus (Lichtenstein) and Katius obesus Chevreux. Proceedings of the Biological Society of Washington, 69, 177 - 178.
- Stephensen, K. (1933) The Godthaab expedition 1928. Meddelelser om Gronland, 79 (7), 1 - 88.
- Barnard, J. L. (1961) Gammaridean Amphipoda from depths of 4000 to 6000 meters. Galathea Report, 5, 23 - 128.
- Bellan-Santini, D. & Ledoyer, M. (1974) Gammariens (Crustacea - Amphipoda) des iles Kerguelen & Crozet. Tethys, 5 (4), 635 - 708.
- Stoddart, H. E. & Lowry, J. K. (2004) The deep-sea lysianassoid genus Eurythenes (Crustacea, Amphipoda, Eurytheneidae n. fam.). Zoosystema, 26 (3), 425 - 468.
- Senna, A. R. & Serejo, C. S. (2008) First record of Eurythenes obesus (Chevreux, 1905) (Amphipoda, Lysianassoidea, Eurytheneidae) in Brazilian waters. Arquivos do Museu Nacional, Rio de Janeiro, 66 (2), 373 - 379.
- Senna, A. R. (2009) The giant deep-sea amphipods (Lysianassoidea: Eurytheneidae) from Brazilian waters. Nauplius, 17 (2), 86 - 96.
- Stephensen, K. (1915) Isopoda, Tanaidacea, Cumacea, Amphipoda (excl. Hyperiidea). Report on the Danish Oceanographical Expeditions 1908 - 10 to the Mediterranean and Adjacent Seas, Biology (D 1), 2, 1 - 53.
- Hopkins, T. L. (1985) Food web of an Antarctic midwater ecosystem. Marine Biology, 89, 197 - 212. http: // dx. doi. org / 10.1007 / BF 00392890
- Brusca, G. J. (1967) The ecology of pelagic Amphipoda. I. Species accounts, vertical zonation and migration of Amphipoda from the waters off Southern California. Pacific Science, 21 (3), 382 - 393.
- Thurston, M. H. & Bett, B. J. (1995) Hatchling size and aspects of biology in the deep-sea amphipod genus Eurythenes (Crustacea: Amphipoda). Internationale Revue der Gesamten Hydrobiologie, 80 (2), 201 - 216. http: // dx. doi. org / 10.1002 / iroh. 19950800209