Eurythenes obesus Chevreux 1905

Eurythenes obesus (Chevreux, 1905)

(Fig. 46)

Katius obesus Chevreux, 1905: 1, figs. 1–3.— Schellenberg, 1926: 217, fig. 26d.— K.H. Barnard, 1932: 36, fig. 21, pl. 1 fig. 1.— Chevreux, 1935: 63 –65, pl. 10 fig. 4, 6, pl. 11 fig. 10.— Shoemaker, 1956: 177.

Eurythenes gryllus.— Stephensen, 1933: 12, in part, fig. 6 only.

Eurythenes obesus.— Barnard, 1961: 38, fig. 8.— Bellan-Santini & Ledoyer, 1974: 680, pl. 25.— Stoddart & Lowry, 2004: 445, figs. 12–15 (ubi syn.).— Senna & Serejo, 2008: 374, figs. 1–2.— Senna, 2009: 88, fig. 3.

Material examined. Tjalfe sta. 15, off SE Greenland, 58°08'N 39°24'W, 500 m wire, ring trawl, 26.05.1908: 2 specimens, TSZCr. 2722.—Station ANO 315-D704 [or DT04???] (the coordinates could not be traced), no date: 2 specimens, with a label concerning colour notes: small one, gray and pale pink; large one, bright red, leg. J.B., TSZCr 19070. —RV Polarstern, expedition PS79, ANT-XXVIII/3, Southern Ocean, mid of Atlantic sector, sta. 141-7, 51°15.95’S 12°37.70’W, 4109.5 m, Agassiz Trawl, 18.ii.2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122852, Eob-C103, ANT283-103 (COI).—ANT-XXVIII/3, NW of South Georgia, sta. 172-3, 49°12.81’S 38°12.97’W, 0 m, Rectangular Midwater Trawl, 01.iii.2012: 1 specimen, leg. C. Havermans, RBINS, INV. 122853, Eob-C112, ANT283-112 (COI).

Voucher DNA sequences.

Eob-C103, COI:

TGAGCTAGCGTTGTAGGCACATCCCTAAGCCTAGTTATTCGATCTGAGCTCAGTGGGCCAGGAAATCT AATTGGAGATGACCAAATCTATAACGTAATAGTAACTGCTCACGCCTTCGTAATAATCTTCTTTATAGTT ATACCTATTATAATCGGAGGATTTGGCAATTGACTGGTCCCCCTTATACTAGGGAGCCCTGACATAGCTT TCCCACGGATAAATAACATAAGATTCTGACTACTGCCCCCCTCACTAACCTTGTTACTGATAAGGGGAT TAGTAGAGAGAGGCGTAGGAACAGGCTGGACCGTTTACCCCCCCCTAGCCGCAGCCGCAGCTCATAG CGGAGGATCTGTTGACCTAGCTATCTTCTCCCTTCATCTAGCGGGAGCCTCTTCTATTTTAGGGGCTATC AACTTTATCTCTACCGTAATTAACATGCGAGCCCCTGGGATATATATAGACCGCGTCCCTTTATTTGTCT GGTCGGTCTTCATCACAGCCATTCTTCTACTCTTATCCCTACCAGTATTAGCGGGTGCAATTACAATACT CTTAACAGACCGAAATCTAAATACCTCCTTTTTCGACCCTGGCGGGGGAGGTGACCCCATTCTTTACC AGCACCTATTT

Type specimens and localities. Types not examined. Chevreux’s holotype specimen of E. obesus was a 12 mm male sampled south of the Azores, in the eastern North Atlantic Ocean: Prince of Monaco sta. 1849, 36°17'N 28°53'W, 0–3000m over 3400m, filet Richard à grande ouverture, 8.9.1904, 08:25–11:55hrs. This specimen has been lost and Stoddart & Lowry (2004) have designated a neotype: female 48 mm, with setose oostegites and hatchlings (BMNH 2003.1059), RRS Discovery, stn 9541#30, NE of Cape Verde Islands, eastern North Atlantic Ocean, 20°1.8’N 21°19.8’W to 20°1.3’N 21°20.0’W, 995–1500 m over bottom depth 3800–3850 m, rectangular midwater trawl RMT 8, 22.4.1977, 19:21–23:21hrs.

Description. See e.g. Stoddart & Lowry (2004).

Diagnostic characters. E. obesus is characterized by the extremely long dactylus of its pereopods 3–7. The eye of E. obesus is narrowly linear instead of being broad and nearly L-shaped' as in the Eurythenes of the gryllus - complex.

Colour pattern. Specimen of ANT-XXVIII/3, sta. 172-3: pale orange; merus, carpus, propodus and dactylus of pereopods 6–7 pale pink; eye whitish (see figure 46). The label of the two specimens of Station ANO 315-D704 indicates: small one, gray and pale pink; large one, bright red. So, it seems that E. obesus exhibits colour variation similar to E. gryllus and E. andhakarae sp. nov.

Size. Up to 80 mm (Stoddart & Lowry 2004).

Distribution and depth range. Cosmopolitan, exceptionally near the surface (present material), normally between 128 m and 1600 m, most commonly below 1000 m (Stoddart & Lowry 2004; Senna & Serejo 2008). One of the specimens recorded here was found in a trawl used at 4110 m, but it is likely that it was caught in the water column when the net was hauled up.

Biology. It suffices to repeat herein the account of Stoddart & Lowry (2004). “Very little is known of the life habits of E. obesus. It has never been taken in baited traps; has frequently been taken in midwater trawls; and has once been recorded as burrowing into a salp (Stephensen 1915), once as having coelenterate remains in the stomach (Hopkins 1985), once with possibly siliceous sponge spicules in the stomach (Brusca 1967), and once as attacking fish taken in midwater trawls (Thurston & Bett 1995).”

Remarks. In the absence of relevant studies, it is not known whether E. obesus is genetically homogeneous or not across its nearly cosmopolitan range of distribution.