Published May 21, 2021
| Version v1
Dataset
Open
Table 1 in Describing the hidden species diversity of Chaetozone (Annelida, Cirratulidae) in the Norwegian Sea using morphological and molecular diagnostics
Creators
- 1. University of the Balearic Island, Department of Biology, Ctra. Valldemossa km 7.5, Balearic Islands, Spain & Norwegian University of Science and Technology, NTNU University Museum, Trondheim, Norway
- 2. Norwegian University of Science and Technology, NTNU University Museum, Trondheim, Norway
Description
Table 1. PCR Primers: The different primer pairs used to amplify the markers used in this study and their respective cycles.
| Region | Name | Length | Source | Sequence 5 ’-3’ | Cycle | |
|---|---|---|---|---|---|---|
| COI | jgLCO1490 | ~650 bp | (Geller et al. 2013) | TITCIACIAAYCAYAARGAYATTGG | 34x | 3 min 96 °C |
| jgHCO2198 | (Geller et al. 2013) | TAIACYTCIGGRTGICCRAARAAYCA | 60 s 95 °C | |||
| 60 s 48 °C | ||||||
| 60 s 72 °C | ||||||
| 6 min 72 °C | ||||||
| CirrCO1F | ~650 bp | (Weidhase et al. 2016) | TTTTTCTACTAACCATAAAGACATTG | 34x | 60 s 96 °C | |
| CirrCO1R | (Weidhase et al. 2016) | CCGAGGAAGTGTTGAGGGA | 60 s 94 °C | |||
| 60 s 53 °C | ||||||
| 60 s 72 °C | ||||||
| 5 min 72 °C | ||||||
| polyLCO | ~650 bp | (Carr et al. 2011) | GAYTATWTTCAACAAATCATAAAG | 5x | 60 s 96 °C | |
| polyHCO | (Carr et al. 2011) | TAMACTTCWGGGTGACCAAARAATCA | 40 s 95 °C | |||
| 40 s 46 °C | ||||||
| 60 s 72 °C | ||||||
| 35x | 40 s 94 °C | |||||
| 40 s 51 °C | ||||||
| 60 s 72 °C | ||||||
| 7 min 72 °C | ||||||
| ZplankF1_t1 | ~650 bp | (Prosser et al. 2013) | tTCTASWAATCATAARGATATTG | 29x | 60 s 95 °C | |
| ZplankR1_t1 | (Prosser et al. 2013) | TTCAGGRTGRCCRAARAATCA | 40 s 94 °C | |||
| 40 s 51 °C | ||||||
| 60 s 72 °C | ||||||
| 5 min 72 °C | ||||||
| 28S | 28SC1 | D1-D2 | (Le et al. 1993) | ACCCGCTGAATTTAAGCAT | 29x | 60 s 96 °C |
| 28SD2 | ~750 bp | (Le et al. 1993) | TCCGTGTTTCAAGACGG | 30 s 95 °C | ||
| 60 s 62 °C | ||||||
| 60 s 72 °C | ||||||
| 7 min 72 °C | ||||||
Notes
Published as part of Grosse, Mael, Capa, Maria & Bakken, Torkild, 2021, Describing the hidden species diversity of Chaetozone (Annelida, Cirratulidae) in the Norwegian Sea using morphological and molecular diagnostics, pp. 139 in ZooKeys 1039 on page 139, DOI: 10.3897/zookeys.1039.61098
Files
Files
(6.5 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:84e8eeaca9fdcbdff7144b72a8a3969f
|
6.5 kB | Download |
System files
(13.1 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:d4939cfac676e32388e5d3aec4ce871d
|
13.1 kB | Download |