rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
Authors/Creators
- 1. NOAA PMEL
- 2. Vermont Biomedical Research Network
- 3. Landmark College
- 4. Universidad Autónoma de Madrid
Description
rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.
Primer Name: rbcl (Plant RBCL7/8)
Gene: rbcl
Length of Target: 180
get_seeds_local() minimum length: 170
get_seeds_local() maximum length: 250
blast_seeds() minimum length: 140
blast_seeds() maximum length: 150
max_to_blast: 100
Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA
Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC
Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003
We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.
Files
rbcL.zip
Files
(18.9 MB)
| Name | Size | Download all |
|---|---|---|
|
md5:a65ff6d732c63d2399be0d45b28f6b31
|
18.9 MB | Preview Download |