Published May 9, 2023 | Version 1

rCRUX Generated rbcl (Plant RBCL7/8) Reference Database

  • 1. NOAA PMEL
  • 2. Vermont Biomedical Research Network
  • 3. Landmark College
  • 4. Universidad Autónoma de Madrid

Description

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.

Primer Name:  rbcl (Plant RBCL7/8)
Gene:   rbcl
Length of Target:    180
get_seeds_local() minimum length:    170
get_seeds_local() maximum length:    250
blast_seeds() minimum length:    140
blast_seeds() maximum length:    150
max_to_blast:  100
Forward Sequence (5'-3'):   CTCCTGAMTAYGAAACCAAAGA
Reverse Sequence (5'-3'):    GTAGCAGCGCCCTTTGTAAC
Reference:   McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003

We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.  

Files

rbcL.zip

Files (18.9 MB)

Name Size Download all
md5:a65ff6d732c63d2399be0d45b28f6b31
18.9 MB Preview Download