Ancylogastra amphiaula (Meyrick, 1934), comb. n.

(Figs 1, 9, 10, 25, 26)

Cypholomia amphiaula Meyrick, 1934: 529, 530.

Holotype male with labels: 1) Holotype; 2) Elisabethville [Democratic Republic of the Congo, Lubumbashi] 15.XII.1933, Ch. Seydel [legit], 3) GS 4179 Błeszyński; 4) Cypholomia amphiaula Meyrick type; 5) Cypholomia amphiaula S. Błesz [yński] det. Deposited in RMCA. Examined.

Diagnosis. Ancylogastra amphiaula (Fig. 1) is similar to A. magnifica Bassi sp. n. (Fig. 2) and A. endroedyi Bassi sp. n. (Fig. 5), but it can be easily distinguished in the more rounded termen of the forewing and in the subdorsal dark stripe that does not reach the subterminal area. The male genitalia (Fig. 9) are characterized by the extremely long phallus and vinculum produced and strongly bifid apically. In the female genitalia, A. amphiaula (Fig. 25) is similar to A. magnifica Bassi sp. n. (Fig. 27) and A. endroedyi Bassi sp. n. (Fig. 28), both described below, but differs in having a stout bifid sterigma, a larger ductus bursae and larger and more strongly sclerotised lateral extension of the ductus bursae. COI barcode sequence of a male from Malawi BC 92323 ZSM, BIN ADF318 (611 bp):

TTGAGCAGGAATAGTAGGAACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAAATCCTGGTTCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCTCACGCTTTTATTATAATTTTTTTTATGGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTG ATATGGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTTCCACCTTCATTAACTCTTTTAATTTCTAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCCCTTTCATCTAACATTGCTCATGGAGGGGGTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATCTCTTCA ATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATGGTTTATCATTCGATCAAATACCTTTATTTGTTTGATCTGTTGGTATTACAGCTTTATTACTTCTTCTTTCACTTCCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGG AGGGGGAGACC.

Redescription (Fig. 1). Wingspan 28–32 mm, males slightly smaller than females. Labial palpi four and a half times eye diameter, bronze brown with upper and inner side white. Maxillary palpi subtriangular, bronze brown tipped white. Antenna bipectinate in male, with rami one and a half as long as flagellomere, brown with costa dark brown whitening apically; in female simple, brown. Frons rounded, moderately produced, white. Ocelli and chaetosemata normally developed. Vertex white with median line pale brown. Tegulae white with inner side black. Thorax white. Forewing subrectangular, rounded apex and termen oblique; ground colour dorsally white with scattered black and brown scales; medial stripe blackish brown, slightly enlarging distally and reaching subterminal area; subdorsal stripe narrow, blackish brown, ending postmedially with a distinct dot; subterminal area white with seven black spots and subterminal fascia silvery white; fringes silvery white with both short and long scales tipped grey; underside pale bronze brown. Hindwing dorsally white with light yellow brown suffusion; terminal line narrow, yellowish brown; fringes white; underside white, strongly suffused with brown dorsally. Foreleg bronze brown; mid and hindleg bronze brown with inner side white. Abdomen with first tergite white, second to fourth bronze brown bordered with white, then white bordered pale golden yellow; sternites bronze brown; anal tuft golden yellow. Sclerotisations of male abdominal segment VIII as in Fig. 10.

Male genitalia (Fig. 9). Uncus and gnathos equal in length, slender, both slightly curved distally. Tegumen long and narrow. Vinculum stout, strongly produced dorsally and bifid apically. Pseudosaccus drop-shaped, moderate. Juxta large, v-shaped. Valva elongated, ventrobasally reinforced with rounded cucullus; costal arm as long as the valva, stout, subapically enlarged, distally upcurved with rounded apex. Phallus longer than valva + vinculum, broad, straight; vesica with one slender cornutus as long as phallus shaft.

Female genitalia (Figs 25, 26). Papillae anales slightly concave medially, with rounded extremities. Apophyses posteriores basally subtriangular, then narrow and slightly curved apically. Abdominal segment VIII rather large and sclerotised, except ventrally. Apophyses anteriores slightly longer than apophyses posteriores, narrow, slightly curved. Sterigma with lamella antevaginalis produced, strongly bifid. Ostium bursae membranous. Ductus bursae shorter than corpus bursae, with a hourglass-shaped sclerotisation basally, then swollen, wrinkled and densely spiny; lateral extension longer than ductus bursae, with shaft large, spiny basally, strongly wrinkled distally and with distal sac membranous. Corpus bursae suboval, wrinkled and scobinate.

Distribution. Widespread throughout Central Africa: Angola (NHMUK), Burundi (RMCA), Democratic Republic of the Congo (MHNG, RMCA), Kenya (NHMUK, National Museums of Kenya, Nairobi), Malawi (RCGB), Tanzania (NMHO), Uganda (NHMUK) and Zambia (NHMUK).