Numeric Representation of DNA and RNA

Based on the gray-scale visual representation  it is possible to define a corresponding  numeric representation of the bases either  expressed as percentage values: T=0%, G=25%, A=50%, C=75% , U=100%  or as whole numbers T=0, G=1, A=2, C=3, U=4(DNA 0,1,2, 3 and RNA 1,2,3, 4). Here the  exchange value for the base-pairs is 2 which is also the number that represents Adenine. Thus, instead of  a DNA sequence expressed through alphabet  letters ATAGCATTGATTAGCCCATGGACAGA we could have  its numeric version as 20213200120021333201123212. This numeric representation could be presented in 2D as a Cartesian diagram where  on the x are positions of the bases while on the y are their values.