Supplementary Figure 1. Surface expression of c-Met and PD-L1 was detected

Supplementary Figure 1. Surface expression of c-Met and PD-L1 was detected. The expression of c-Met or PD-L1 on various HCC cell lines, human LO2 hepatocytes and the human carcinoma cell line A431 were detected by flow cytometry (A) and western blot analysis (B). The gene sequence of siRNAs targeting human c-Met are as follows: Si c-Met-1: AAACTAGAGTTCTCCTTGGAA and Si c-Met-2: AATTAGTTCGCTACGATGCAA.