Published June 17, 2019 | Version 5.0
Other Open

Cnidarian ITS2 classifier compatible with insect R package version >= 1.1.0

Authors/Creators

  • 1. Victoria University of Wellington

Description

The file 'classifier.rds' contains an eDNA classifier for cndarian and demosponge ITS2 sequences generated with the primers SCLER5.8SForw (GARTCTTTGAACGCAAATGGC) and SCLER28SRev (GCTTATTAATATGCTTAAATTCAGCG)
from Brian et al (2019) Elevated Symbiodiniaceae richness at Atauro Island (Timor-Leste): a highly biodiverse reef system. Coral Reefs 38:123-136.

The 'trainingset' attribute contains the training data used to learn the classification tree, 
as a "DNAbin" list object with NCBI taxonomic ID numbers included in the sequence names.
  
Please see https://cran.r-project.org/web/packages/insect/vignettes/insect-vignette.html 
for details and examples on using the package with pre-trained classifiers.

Reference sequences and NCBI taxonomy database were downloaded 20 September 2018.

Compatible with insect R package version >= 1.1.0

Files

Files (6.6 MB)

Name Size Download all
md5:d359ac8b9af7a47e0203520041c62229
6.6 MB Download