Published December 30, 2025 | Version v1
Taxonomic treatment Open

Neoempheria undefined-D

  • 1. Departamento de Biologia, FFCLRP, Universidade de São Paulo, Av. Bandeirantes 3900, Ribeirão Preto, SP 14040 - 901, Brazil
  • 2. Departamento de Ecologia, Instituto de Ciências Biológicas, Universidade Federal de Goiás, Av. Esperança s / n, Campus Samambaia, Goiânia, GO 74690 - 900, Brazil
  • 3. Lee Kong Chian Natural History Museum, National University of Singapore, 2 Conservatory Drive, Singapore 117377
  • 4. Center for Integrative Biodiversity Discovery, Leibniz Institute for Evolution and Biodiversity Science, Museum für Naturkunde Berlin, Invalidenstr. 43, 10115 Berlin, Germany
  • 5. Centre for Wildlife Forensics, National Parks Board Singapore, 1 Cluny Road, Singapore 259569

Description

Neoempheria sp. D

(Fig. 72A–D)

https://singapore.biodiversity.online/species/A-Arth-Hexa-Diptera-000780

Neoempheria _spD_ ZRCBDP 0049022_hapZRCBDP0049022_SMH_unnamed_type [1: A, 16: C, 49: C, 55: A, 56: C, 109: C, 137: C, 139: A, 173: C] AttatcttcaactatCg ctcacacaggggcttctgttgatttagcaatCttttcACttcatttagcaggtatttc ctcaattttaggagctgtaaattttattactacCattattaatatacgagccccagga attCaAtttgatcgaatacctttatttgtttgatcagttCtaattacagctgttttacta ttactttctttaccagttttagctggggctattacaatattattaacagatcgtaatttaa atactagtttttttgaccctgcaggaggaggagatcctatcctttaccaacatttattt

Description

Female (Fig. 72A). Wing length, 3.61; width, 1.31. Head. Light brown, ochre-yellow posteriorly to vertex, cream-yellow on ventral half of occiput. Antennal scape and pedicel ochre, with a light brown longitudinal band, flagellum dark brown. Face and clypeus light brown. Maxillary palpus brown, distal palpomere lighter, labella whitish. Post-ocellar setae present, no setae on frons beyond line of ocelli. Scape 1.5× pedicel length, flagellomere 1 1.3× flagellomere 2 length, flagellomere 4 1.0× longer than wide. Palpomere 4 1.2× palpomere 3 length, palpomere 5 1.9× palpomere 4 length. Thorax. Scutum with ochre-yellow background, five brown longitudinal stripes, an additional slender brown mark laterally above anepisternum. Pleural sclerites whitish with orangish tinge except for a brown mark on antepronotum anteriorly, brown cervical sclerite, a slender ochre-brown mark dorsoposteriorly on laterotergite, and a brown mark across dorsal half of mediotergite. Scutum with a prescutellar bristle medially on dorsocentral line and two prescutellar bristles on lateroposterior corner; scutellum with one pair of bristles, no additional small setae. Antepronotum with two bristles and some additional smaller setae, proepisternum bare. Halter light brown. Legs. Coxae whitish with an orangish tinge, femora ochre-yellow with some elongate light brown marks, tibiae light greyish-brown with brown tips, tarsi brown [fore tibiae and tarsi missing]. Hind tibia inner spur 3.5× longer than tibia width at apex. Wing (Fig. 72B, C). Membrane with a slender dark brown band across wing at level of sc-r, a brown mark over R 4 and a brown band across distal third of wing beginning at level of base of medial fork. C extending beyond tip of R 5 for a fifth of distance to M 1; Sc reaching C almost at level of mid of cell r1; sc-r well sclerotized, at level of origin of Rs; R 4 present, anterior end slightly inclined towards base of wing, cell r1 long, anterior margin of cell r1 3.4× longer than length of R 4; first sector of Rs 1.1× r-m length. False medial vein present, weakly sclerotized. M 1+2 4.1× r-m length; bM 7.6× length of first sector of Rs. First sector of CuA 1.1× longer than second sector. M 4 not depressed on distal half. Cubital pseudovein sclerotized almost to posterior margin; CuP sclerotized to level of basal third of second sector of CuA. Anal fold faint. Wing margin gently emarginated at tip of CuA. No ventral macrotrichia on veins, dorsal macrotrichia on entire length of bR, R 1 and second sector of Rs, distal 2/3 of M 1, distal third of M 2, distal half of M 4, distal third of first sector of CuA, and entire second sector of CuA; Sc, sc-r, first sector of Rs, R 4, r-m, bM, and CuP entirely devoid of macrotrichia. Abdomen. Tergites 1–6 ochre-yellow with dark brown medial marks, brown mark of tergite 5 extending laterally, tergites 3–5 with a light brown mark along lateral margin; tergite 7 ochre-yellow anteriorly with a diffuse light brown mark along posterior half; no lateral projections on tergite 7. Sternites 1–2 whitish, sternites 3–6 cream-yellow, sternite 7 ochre-yellow. Terminalia (Fig. 72D). Dark ochre-yellow, tip of sternite 8 lobes light brown, cerci dark brown. Sternite 8 anterior plate weakly sclerotized, wide, lateroanterior corners extending anteriorly to articulate with tergite 8, medio-posteriorly a wide medial subquadrate plate with a medial incision separating a pair of short elongate lateroposterior projections. Sternite 9 with a pair of slender lateral arms. Tergite 8 large, wide, with microtrichia and no setae, lateroanterior corners extending ventrally to meet sternite 8. Tergite 9+10 slender, with a sequence of short protuberance along posterior margin bearing an elongate seta at tip. Sternite 10 extending to level of tip of cercomere 1, with a medial transparent elongate window. Cercomere 1 1.6× longer than cercomere 2, both laterally compressed, densely covered with microtrichia and short setae.

Male. Unknown.

Material examined

Two females: ZRCBDP 0049022, Nee Soon (NS2), 07.jan.15, MIP leg. (website photo specimen, slide-mounted); ZRCBDP 0049255, Nee Soon (NS1), 10.dec.14, MIP leg.

Notes

Published as part of Amorim, Dalton De Souza, Oliveira, Sarah Siqueira, Balbi, Maria Isabel P. A., Ang, Yuchen, Torres, Ambrosio, Yeo, Darren, Srivathsan, Amrita & Meier, Rudolf, 2025, An integrative taxonomic treatment of the Mycetophilidae of Singapore reveals 115 new species from just 730 km 2 (Diptera: Bibionomorpha), pp. 1-318 in Integrative Systematics: Stuttgart Contributions to Natural History 8 on pages 140-142, DOI: 10.18476/2025.752376, http://zenodo.org/record/18413846

Files

Files (5.3 kB)

Name Size Download all
md5:8ced2b0ca5d7b3e77ece6f4a9d9f5a66
5.3 kB Download

System files (18.5 kB)

Name Size Download all
md5:1bfa9f1c2e09eadb4ec03422ec255939
18.5 kB Download

Linked records

Additional details

Biodiversity

Collection code
ZRCBDP
Material sample ID
ZRCBDP0049022 , ZRCBDP0049255
Kingdom
Animalia
Phylum
Arthropoda
Order
Diptera
Family
Mycetophilidae
Genus
Neoempheria
Species
undefined-D
Taxon rank
species