Published January 25, 2023 | Version v1
Dataset Open

Table A 2 in A consolidated phylogeny of snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Colombia, Ecuador, and Panama

  • 1. Biodiversity Field Lab (BioFL), Khamai Foundation, Quito, Ecuador & Tropical Herping S. A., Quito, Ecuador
  • 2. Universidad Autonoma de Chiriqui (UNACHI), Vicerrectoria de investigacion y Postgrado, David, Chiriqui, Panama & Museo Herpetologico de Chiriqui (MHCH), David, Chiriqui, Panama & Fundacion Los Naturalistas, Boquete, Chiriqui, Panama & Sistema Nacional de Investigacion (SNI), SENACYT, Panama

Description

Table A2. List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

LocusPrimerSequence (5 ’-3’)ReferencePCR profile:
12SH1557modGTACRCTTACCWTGTTACGACTTZaher et al. 200993 °C (1 min), 54 °C (1 min), 72 °C (2-5 min) [x25-40]
L1091modCAAACTAGGATTAGATACCCTACTAT
16S16Sar-LCGCCTGTTTATCAAAAACATPalumbi et al. (1991)94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min) [x30]
16Sbr-H-RCCGGTCTGAACTCAGATCACGT
COIRepCOI-FTNTTMTCAACNAACCACAAAGAMurphy et al. (2013)94 °C (3 min), 48.5 °C (30 sec), 72 °C (1 min) [x40]
RepCOI-RACTTCTGGRTGKCCAAARAATCA
CytbL14910GACCTGTGATMTGAAAACCAYCGTTGTBurbrink et al. (2000)94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30-36]
H16064CTTTGGTTTACAAGAACAATGCTTTA
ND4ND4CACCTATGACTACCAAAAGCTCATGTAGAAGCArévalo et al. (1994)94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25-30]
LeuCATTACTTTTACTTGGATTTGCACCA

Notes

Published as part of Arteaga, Alejandro & Batista, Abel, 2023, A consolidated phylogeny of snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Colombia, Ecuador, and Panama, pp. 1 in ZooKeys 1143 on page 1, DOI: 10.3897/zookeys.1143.93601

Files

Files (3.0 kB)

Name Size Download all
md5:ec9e28b194a01fd16e199cf79a4786fd
3.0 kB Download

System files (9.9 kB)

Name Size Download all
md5:b02f3a328ad73007e7cde0aa7bcf5134
9.9 kB Download

Additional details

References

  • Zaher, H, Grazziotin, FG, Cadle, JE, Murphy, RW, Moura-Leite, JC, Bonatto, SL, 2009. Molecular phylogeny of advanced snakes (Serpentes, Caenophidia) with an emphasis on South American xenodontines: A revised classification and descriptions of new taxa. Papeis Avulsos de Zoologia 49 (11): 115 - 153, DOI: https://doi.org/10.1590/S0031-10492009001100001
  • Palumbi, SR, Martin, A, Romano, S, McMillan, WO, Stice, L, Grabowski, G, 1991. The Simple Fool's Guide to PCR, version 2.0. University of Hawaii, Honolulu
  • Murphy, RW, Crawford, AJ, Bauer, AM, Che, J, Donnellan, SC, Fritz, U, Haddad, CFB, Nagy, ZT, Poyarkov, NA, Vences, M, Wang, W, Zhang, Y, 2013. Cold Code: The global initiative to DNA barcode amphibians and non-avian reptiles. Molecular Ecology Resources 13 (2): 161 - 167, DOI: https://doi.org/10.1111/1755-0998.12050
  • Burbrink, FT, Lawson, R, Slowinski, JB, 2000. Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elaphe obsoleta): A critique of the subspecies concept. Evolution; International Journal of Organic Evolution 54: 2107 - 2188, DOI: https://doi.org/10.1111/j.0014-3820.2000.tb01253.x
  • Arevalo, E, Davis, SK, Sites, JW, 1994. Mitochondrial DNA-sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43 (3): 387 - 418, DOI: https://doi.org/10.1093/sysbio/43.3.387