Phanus ecutinus Grishin 2025, new species
Authors/Creators
Description
Phanus ecutinus Grishin, new species
http://zoobank.org/ 03E1BABC-DBC8-4A41-8438-2F0AEB2EA823
(Figs. 25 part, 26–27)
Definition and diagnosis. A female from Ecuador identified as Phanus ecitonorum Austin, 1993 (type locality in Brazil: Rondônia) by G. T. Austin after the dissection of genitalia appears as sister in the nuclear genome tree to several closely related species including P. ecitonorum (Fig. 25a), differing from it by 4.3% (28 bp) in the COI barcode, and, therefore, represents a new species. This species keys to P. ecitonorum in the key for females in Austin (1993) but differs from it by a narrower brown crevice in the hyaline spot in the forewing discal cell; smaller than the third, two subapical spots near the costa; and a larger dark brown ground color area between the forewing discal and postdiscal spots (e.g., the basal edge of the spot in the M 3 -CuA 1 cell is more excavate). Female genitalia are heavily sclerotized, with broader (in ventral view) lamella antevaginalis and papillae anales; a concave near its posterior end ventral margin of the side lobe of lamella antevaginalis; a deeply notched in the middle lamella postvaginalis with arcshaped and more evenly curved posterior margin on both sides of the notch, which is U-shaped, rounded anteriad and wider posteriad; and a wider, longer, and stronger sclerotized antrum (Fig. 27). Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1042.6.1: G360A, aly 1651.12.7:C153A, aly 1651.12.7:A168G, aly725.22.2:T45C, aly725.22.2:T54C, aly366.11.3: C489C (not T), aly366.11.3:A499A (not G), aly6841.72.2:T42T (not C), aly1931.14.4:T48T (not C), aly1139.62.12:T492T (not A); and COI barcode: A31C, C43T, T226C, T394C, T514C, T589C. Barcode sequence of the holotype. Sample NVG-24074D06, GenBank PV549987, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAACAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGTGCCCCAGACATAGCTTTCCCTCGAA TAAATAATATAAGTTTTTGACTCCTCCCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCCGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC TCACCAAGGTTCATCTGTCGATTTAGCAATCTTTTCCTTACACTTAGCTGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTACTACAATTATTAATATACGTATTAGAAATTTATCT TTTGATCAAATACCCTTATTCATTTGAGCCGTTGGAATTACTGCTTTATTATTATTACTTTCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTTTAACTGACCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT
Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 26 (genitalia Fig. 27), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ECUADOR | Pichincha Province | Hotel Tinalandia | 12 km E Santa | Domingo de los | Colorados | 750–850 m | 13 May 1988 | leg G&A Austin], [Phanus vitreus | (Stoll) | det GT Austin 199 1], [Genitalia Vial | GTA- 2247], [Phanus ecitonorum | Austin | det. G. T. Austin | 1992], [G T Austin colln | MGCL Acc. | 2004-5], [DNA sample ID: | NVG- 24074D06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Phanus ecutinus | Grishin].
Type locality. Ecuador: Pichincha, Santo Domingo de los Colorados, Tinalandia Lodge.
Etymology. The name is given for the type locality and is a fusion of Ecu [ador] + Tin [alandia] + us. The name is treated as a noun in apposition.
Distribution. Currently known only from the holotype collected west of the Andes in northern Ecuador.
Notes
Files
Files
(4.2 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:f13b870f7c6e79573e8e88179e55d408
|
4.2 kB | Download |
System files
(20.8 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:90122f9c5572c3465326a30ea6ab92ae
|
20.8 kB | Download |
Linked records
Additional details
Identifiers
Biodiversity
- Collection code
- MGCL
- Event date
- 1988-05-13
- Verbatim event date
- 1988-05-13
- Scientific name authorship
- Grishin
- Kingdom
- Animalia
- Phylum
- Arthropoda
- Order
- Lepidoptera
- Family
- Hesperiidae
- Genus
- Phanus
- Species
- ecutinus
- Taxon rank
- species
- Type status
- holotype
- Taxonomic concept label
- Phanus ecutinus Grishin, 2025
References
- Minh, B. Q., M. A. Nguyen, and A. von Haeseler. 2013. Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30 (5): 1188-1195.