Telegonus (Rhabdoides) perumazon Grishin 2025, new species
Authors/Creators
Description
Telegonus (Rhabdoides) perumazon Grishin, new species
http://zoobank.org/ 528BEF25-DCF4-41D3-B4B9-4195F6AC1E24 (Figs. 61 part, 73, 74a–b, 89 part)
Definition and diagnosis. Genomic analysis reveals that a mostly brown specimen from southeastern Peru with prominent blue wing bases above and a large white ventral forewing tornal area is (unexpectedly) sister to a more yellow-toned and darker on ventral forewing species that Steinhauser identified as “ Astraptes weymeri ” (actually a new species described below), but is genetically differentiated from it at the species level (Fig. 61); e.g., their COI barcodes differ by 3.8% (25 bp). Therefore, the Peruvian specimen represents a new species. This new species keys to “ Astraptes chiriquensis oenander ” C.14.30(d) in Evans (1952). Evans misidentified Eudamus oenander Hewitson, 1876, and Evans’s “ oenander ” corresponds in part to the species we identify as Telegonus creteus (Cramer, 1780) (type locality in Suriname). The new species differs from its relatives by a combination of the following characters: wings are rounder than in some other species. i.e., the hindwing is not lobed and has a convex outer margin; both sides of the forewing and the ventral hindwing have well-developed dark bands that strongly stand out from the paler ground color; basal third to half of wings and body above are with blue (rather than green) scales, ventral forewing has a very broad and rather round pale tornal spot that is merged with the inner margin but does not enter the discal cell, which is brown; the costal margin of the ventral forewing is brown, not paler than the ground color and bluish only at the base; the ventral hindwing is not paler by the margin and richly overscaled with yellowish scales (except the dark brown bands). Due to unexplored individual variation of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2752.2.4: A177T, aly 2752.2.4:T153C, aly 1349.6.4:G40C, aly18312.2.2:A531G, aly18312.2.2:C647G, aly250.4.1: C153C (not T), aly250.4.1:A189A (not C), aly506.7.6:G198G (not A), aly506.7.6:C166C (not A), aly839.26. 4:T811T (not C). The COI barcode does not distinguish this species, likely due to introgression. Although it is closest to T. weymeri in the nuclear genome, this new species possesses a mitochondrial genome nearly identical to Telegonus erana (Evans, 1952), stat. nov. and some specimens of Telegonus grullus (Mabille, 1888), stat. rest. (see below for the justification of the species status) (Fig. 61c). Therefore, COI barcodes cannot be relied upon for identification purposes.
Barcode sequence of the holotype. Sample NVG-14111C12, GenBank PV550020, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATAATAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATAAAAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCATTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 73 (genitalia Fig. 74a, b), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU:MD 491m | Amazonia Lodge 2568 | 16.V.2012 Kinyon], [DNA sample ID: | NVG-14111C12 | c/o Nick V. Grishin], [DNA sample ID: | NVG-23119E10 | c/o Nick V. Grishin], [genitalia: | NVG240817-49 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | perumazon Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.
Type locality. Peru: Madre de Dios, Amazonia Lodge, elevation 491 m.
Etymology. The name signifies the distribution of this species in the Amazonian region of Peru: Peru + [A] mazon, and is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype collected in southeastern Peru.
Notes
Files
Files
(5.0 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:702c21bfef6f9759d2403e3bf3bed177
|
5.0 kB | Download |
System files
(24.1 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:6554d249a5d660569a479a95a85dfd5c
|
24.1 kB | Download |
Linked records
Additional details
Identifiers
Biodiversity
- Collection code
- USNM
- Event date
- 2012-05-16
- Verbatim event date
- 2012-05-16
- Scientific name authorship
- Grishin
- Kingdom
- Animalia
- Phylum
- Arthropoda
- Order
- Lepidoptera
- Family
- Hesperiidae
- Genus
- Telegonus
- Species
- perumazon
- Taxon rank
- species
- Type status
- holotype
- Taxonomic concept label
- Telegonus (Rhabdoides) perumazon Grishin, 2025
References
- Hewitson, W. C. 1876. Description of twenty new species of Hesperidae. Annals and Magazine of natural History (4) 18 (107): 347-355.
- Mabille, P. 1888. Description de lepidopteres (hesperides) nouveaux. Le Naturaliste (2) 2 (31): 146-148.