Published August 2, 2024
| Version v1
Dataset
Open
TABLE 1 in Tardigrades in the alpine region of Northeast China with an integrative description of Crenubiotus liangshuiensis sp. nov.
Authors/Creators
- 1. College of Wildlife and Protected Area, Northeast Forestry University, Harbin, 150040, Heilongjiang, China.
- 2. Heilongjiang Provincial Natural Resources Rights and Interests Investigation and Monitoring Institute, Harbin, 150080, Heilongjiang, China.
- 3. Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin, 150040, Heilongjiang, China.
- 4. College of Life Sciences, Northeast Forestry University, Harbin, 150040, Heilongjiang, China.
Description
TABLE 1. Primers and references for PCR protocols for amplification of the four DNA fragments sequenced in the study
| DNA marker | Primer name and sequence (5’-3’) | Primer source | PCR programme |
|---|---|---|---|
| 18S rRNA | SSU_F_01 | Medlin et al. (1988) | Guidetti et al. (2013) |
| AACCTGGTTGATCCTGCCAGT | |||
| SSU_R_82 | |||
| TGATCCTTCTGCAGGTTCACC | |||
| SSU_F_04 | Kiehl et al. (2007) | Kiehl et al. (2007) | |
| GCTTGTCTCAAAGATTAAGCC | |||
| SSU26_R | |||
| CATTCTTGGCAAATGCTTTCG | |||
| 28S rRNA | 28SF0001 | Mironov et al. | Mironov et al. (2012) |
| ACCCVCYNAATTTAAGCATAT | (2012) | ||
| 28SR0990 | |||
| CCTTGGTCCGTGTTTCAAGAC | |||
| COI | LCO1490 | Folmer et al. (1994) | Cesari et al. (2009) |
| GGTCAACAAATCATAAAGATATTGG | |||
......continued on the next page
Notes
Published as part of Zhang, Jing-Yu, Sun, Xue-Ling, Wang, Ning, Hao, Li, Ma, Cheng-Xue, Zhao, Na, Li, He- Ping, Zhao, Min & Yang, Sheng-Tao, 2024, Tardigrades in the alpine region of Northeast China with an integrative description of Crenubiotus liangshuiensis sp. nov., pp. 97 in Zootaxa 5492 (1) on page 97, DOI: 10.11646/zootaxa.5492.1.5, http://zenodo.org/record/13212067
Files
Files
(1.8 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:870e1cdc067a018bf115e527efd2117f
|
1.8 kB | Download |
System files
(11.7 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:404effa354eeaa71c067369e1b9f022c
|
11.7 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.11646/zootaxa.5492.1.5 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FFDAFFF4867BFFBAFFEAE50FFFA95857 (LSID)
- Journal article: http://publication.plazi.org/id/FFDAFFF4867BFFBAFFEAE50FFFA95857 (URL)
- Journal article: http://zenodo.org/record/13212067 (URL)
- Journal article: http://zoobank.org/336B4DA3-553E-4EAA-9277-272D386378DB (URL)
References
- Medlin, L., Elwood, H. J., Stickel, S. & Sogin, M. L. (1988) The characterization of enzymatically amplified eukaryotic 16 S-like rRNA-coding regions. Gene, 71, 491 - 499. https: // doi. org / 10.1016 / 0378 - 1119 (88) 90066 - 2
- Guidetti, R., Peluffo, J. R., Rocha, A. M., Cesari, M. & de Peluffo, M. C. M. (2013) The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). Journal of Natural History, 47, 2409 - 2426 https: // doi. org / 10.1080 / 00222933.2013.800610
- Kiehl, E., Dastych, H., D'Haese, J. & Greven, H. (2007) The 18 S rDNA sequences support polyphyly of the Hypsibiidae (Eutardigrada). Journal of Limnology, 66, 21 - 25. https: // doi. org / 10.4081 / JLIMNOL. 2007. S 1.21
- Mironov, S., Dabert, J. & Dabert, M. (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae) - morphological description with DNA barcode data. Zootaxa, 3253 (1), 54 - 61. https: // doi. org / 10.11646 / zootaxa. 3253.1.2
- Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294 - 299.
- Cesari, M., Bertolani, R., Rebecchi, L. & Guidetti, R. (2009) DNA barcoding in Tardigrada: The first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Molecular Ecology Resources, 9, 699 - 706. https: // doi. org / 10.1111 / j. 1755 - 0998.2009.02538. x