Data from: Microprism-based two-photon imaging of the mouse inferior colliculus reveals novel organizational principles of the auditory midbrain
Authors/Creators
- 1. University of Illinois Urbana-Champaign
- 2. University of Illinois at Springfield
Description
To navigate real-world listening conditions, the auditory system relies on the integration of multiple sources of information. However, to avoid inappropriate cross-talk between inputs, highly connected neural systems need to strike a balance between integration and segregation. Here, we develop a novel approach to examine how repeated neurochemical modules in the mouse inferior colliculus lateral cortex (LC) allow controlled integration of its multimodal inputs. The LC had been impossible to study via imaging because it is buried in a sulcus. Therefore, we coupled two-photon microscopy with the use of a microprism to reveal the first-ever sagittal views of the LC to examine neuronal responses with respect to its neurochemical motifs under anesthetized and awake conditions. This approach revealed marked differences in the acoustic response properties of LC and neighboring nonlemniscal portions of the inferior colliculus. In addition, we observed that the module and matrix cellular motifs of the LC displayed distinct somatosensory and auditory responses. Specifically, neurons in modules demonstrated primarily offset responses to acoustic stimuli with enhancement in responses to bimodal stimuli, whereas matrix neurons showed onset responses to acoustic stimuli and suppressed responses to bimodal stimulation. Thus, this new approach revealed that the repeated structural motifs of the LC permit functional integration of multimodal inputs while retaining distinct response properties.
Notes
Methods
Animal subjects:
Male mice of 8-12 weeks of age were used. Males were used as our preliminary data suggest male/female differences in DC organization (Ibrahim, Shinagawa, Xiao, Asilador, & Llano, 2022) and will be published separately. GAD67-GFP (GAD1GFP) knock-in mice (developed and shared with permission from Dr. Yuchio Yanagawa at Gunma University and obtained from Dr. Douglas Oliver at the University of Connecticut), where GFP is exclusively expressed in GABAergic cells (Tamamaki et al., 2003), were used to visualize the GABAergic cells and LC modules. To simultaneously monitor calcium signals and visualize the GFP+ cells, Tg(Thy1-jRGECO1a)GP8.20Dkim/J mice (Jackson Laboratory, Stock# 030525) were crossed with GAD67-GFP knock-in mice to generate GAD67-GFPxThy1-jRGECO1a hybrid mice. The mice were housed and bred at the animal research facility of The Beckman Institute for Advanced Science and Technology. The animal care facilities are approved by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). To phenotype the GFP-positive animals, a single-photon fluorescence microscope was used for the transcranial examination of the pups at postnatal day 4 using excitation: 472/30 nm and emission 520/35 nm filters along with dichroic 505 nm long pass at low power magnification (2.5x/0.08, Olympus objective, MPlanFL N, Japan). The positive pups exhibited a green fluorescence in the cerebellum, the cerebral cortex, and the olfactory bulb and were only kept with their parents until weaning. The genotyping for jRGECO1a was done using a probe composed of a forward primer: GCCGCCGAGGTCAAGA & a reverse primer: TCCAACTTGATGTCGACGATGTAG) by Transnetyx™ (Transnetyx, USA). Samples of the mice's tail snips around one month of age were used for genotyping. All applicable guidelines for the care and use of animals were followed. All procedures were approved by the Institutional Animal Care and Use Committee (IACUC).
Surgery
The general procedures of craniotomy were previously described (Goldey et al., 2014), with modifications to place craniotomy over the IC. Before surgery, mice were anesthetized with a mixture of ketamine, xylazine, and acepromazine (100 mg/kg, 3 mg/kg, and 3mg/kg, respectively) delivered intraperitoneally. The anesthesia was maintained during the surgery and imaging using only ketamine (100 mg/kg). To prevent neural edema during or after the craniotomy, an intramuscular injection of dexamethasone sodium (4.8 mg/kg) was given just before the surgery using an insulin syringe. After placing the animal in the stereotaxic apparatus (David Kopf Instruments, USA), both eyes were protected by applying Optixcare lubricant eye gel (Aventix Animal Health, Canada). The hair on the scalp was then removed by massaging the scalp with a depilatory cream (Nair) using a cotton-tipped applicator and leaving the cream on the scalp for 4-5 minutes. The cream was then removed by a thin plastic sheet (flexible ruler) to leave a hair-free area on the scalp. The remaining tiny hairs were then removed by alcohol swab and the area was then sterilized by applying 10% Povidone Iodine (Dynarex, USA) using a sterile cotton-tipped applicator. The medial incision was made with a scalpel blade #10, and 0.2 ml of 0.5% lidocaine was injected intradermally into the scalp. The skin extending from the medial line to the temporalis muscle was completely removed using a pair of microscissors to produce a wide skinless area above the skull. Number 5/45 forceps were used to remove any remaining periosteum. The remaining dried or firmly attached pieces of periosteum were removed with a scalpel blade #10. The skull was cleaned with sterile saline and dried with gently pressurized air. Using the stereotaxic apparatus, a wide area of ~3 x 4 mm above the left IC was made. A micro drill bit (size #80, Grainger, USA) was used to drill through the skull starting from the rostrolateral (Figure 1A, yellow circle) region to lambda (Figure 1A, black circle) following the border in a clockwise direction (Figure 1A, dotted black rectangle). To prevent overheating of the superficial brain tissues and to mitigate the occasional spurts of skull bleeding during the drilling, ice-cold sterile saline was used to intermittently irrigate the surface. A stream of pressurized air was also applied during the drilling procedures to prevent overheating and remove the debris produced by the drilling. Caution was taken not to pierce the dura when performing the craniotomy while crossing the sagittal or the lambdoid sutures to avoid damaging the underlying sinuses. After drilling, the skull was irrigated in sterile saline and the bone flap (the undrilled bone over the craniotomy area) was gently examined for complete separation from the rest of the skull (Figure 1B). Using a pair of no. 5/45 forceps, the bone flap was gently removed. To control the bleeding if it occurred, a piece of sterile hemostatic gel (Adsorbable Gelatin Sponge USP, Haemosponge, GBI, India) which was pre-soaked in ice-cold saline, was applied to the bleeding spot. Once the bleeding ceased, the brain was kept covered in sterile saline. In some surgeries, the dura was peeled off from the surface of the IC while removing the bone flap. In the surgeries where the dura remained intact, a Bonn microprobe (F.S.T, Germany, Item # 10032-13) was used to pierce the dura in an area that is not above the IC and devoid of cortical vasculature (e.g., a part of exposed cerebellum). After piercing, the dura was carefully and gently lifted, and a pair of no. 5/45 forceps were used to grab the dura to gently tear it to the extent of the transverse sinus to avoid bleeding of the major venous structures.
Using the stereotaxic apparatus, a 30 degree diamond knife (F.S.T, Germany, Item # 10100-30) was placed in its vertical position. From the medial line, the knife was placed at the lateral horizon of the IC. The knife was then inserted 1.5 mm ventrally. Caution was taken to avoid hitting any major blood vessels to avoid bleeding. From its position, the knife was retracted 0.3-0.5 mm medially to create an initial pocket for the insertion of the microprism (Figures 1C-E). The microprism (1.5 mm-silver coated, Tower Optical Corporation) was then inserted, so one of its sides was parallel to the lateral surface of the diamond blade, the other side was facing up, and its hypotenuse was facing ventrally (Figures 1F and G). The wooden piece of a cotton swab was carefully driven down to push the microprism until its top surface was at the same level as the IC dorsal surface. Keeping the microprism in its place with the wooden end of a swab, the diamond knife was carefully retracted upward leaving the microprism behind (Figure 1H). If the retraction of the diamond knife pulled the prism up, the wooden piece would be used to push it down simultaneously with the knife movement. To control the bleeding, a piece of sterile hemostatic gel was used as before. The tip of the diamond knife was used to secure the microprism in its position for at least 10 minutes (Figure J). During that time, the solution of the 1% agarose was prepared for use. A pair of forceps were then used to gently place a sterile 5 mm cover glass #1 (Thomas Scientific, USA) over the skull covering the opened area above the IC. The cover glass was secured by a wooden trimmed piece of sterile cotton swab by gently pressing the cover glass from the top. Since the surface of the IC was located below the surfaces of both the cerebellum and cerebral cortex, the cover glass usually traps about a 0.7-1.0 mm thick sheet of sterile saline. The movement of the liquid medium caused by heart pulsation was found to be a source of motion artifact during imaging, so the gap between the surface of the IC and the cover glass was filled with 1% agarose gel that was made in saline at a temperature range of 33- 35 °C (Figure 1K). The extra agarose gel pieces were cut off and removed by the scalpel blade, and the wet skull was then dried out using pressurized air. A titanium headpost as described before (Goldey et al., 2014) was glued carefully on the top of the skull to be at the same level as the cover glass. Following the manufacturer's instructions, the C&B Metabond (Parkell, Japan) was used to secure the headpost in its place. Excluding the steps of the microprism insertion, the same procedures were followed for DC imaging from the surface (Figure 1L). For awake preparations, the same procedures were followed under isoflurane anesthesia starting with 4% of isoflurane as an induction dose with 1-2% isoflurane during the surgery. The animal was transferred under the microscope objective and left to recover from isoflurane anesthesia for 1 hour before imaging. To ensure the animal's recovery, the animal was visually inspected for its breathing rate (Ewald, Werb, & Egeblad, 2011) and ongoing limb movements.
Acoustic stimulation:
Using a custom-made MATLAB (The MathWorks, Natick, MA, USA) code, either 500 ms pure tone or AM-noise was generated. Thirty-five (5x7) pure tones with a series of sound pressure levels (40, 50, 60, 70, 80 dB SPL) and a series of carrier frequencies (5000-40000 Hz with a half-octave gap) were presented with a cosine window. Forty-five (5x9) 100% AM white noise bursts with a series of sound pressure levels (40, 50, 60, 70, 80 dB SPL) and modulation frequencies (0, 2, 4, 8, 16, 32, 64, 128, 256 Hz) were generated. The stimuli of either pure tone or AM-noise combinations were played in random sequence to the mice with a 600 ms interstimulus interval (ISI) by a TDT RP2.1 processor (Tucker-Davis Technologies, US) and delivered by a TDT ES1 speaker (Tucker-Davis Technologies, US). In other sets of experiments, 500 ms of unmodulated broadband noise was presented 5 times with ISI of 600 ms at 80 dB SPL to examine the acoustic activity between modules and matrix compared to somatosensory stimulation.
The output of the TDT ES1 speaker was calibrated using a PCB 377A06 microphone, which feeds a SigCal tool to generate a calibration file for all tested frequencies (5–40 kHz). To enable the custom-made MATLAB code to read this calibration file, the values were first processed by MATLAB signal processing toolbox (sptool) to generate a 256-tap FIR filter to apply the calibration using the following parameters [arbitrary magnitudes, least square, order: 256, sampling rate: 97,656.25, frequency vector (5–40 kHz), amplitude vector (40–80 dB SPL), and weight vector ones (1128)].
Somatosensory stimulation:
The somatosensory stimulation was done by deflecting the right whiskers of the animals at an average excursion of 1.2 mm with a 50 Hz rate over 500 ms to match the acoustic stimulus. A total of five stimuli were presented with 600 ms ISI. The whisker deflection was performed using a Brüel & Kjær vibrator (V203 10/32 UNF- CE, United Kingdom) that was driven by a wave generator (4063, BK precision, USA) after amplifying the signals with an SLA1 100 W power amplifier (ART, USA).
Two-Photon imaging:
Immediately after surgery, the anesthetized animal was taken and secured under the microscope objective by clamping the arms of the head post to two perpendicular metal posts mounted on the microscope stage. A custom-built 2P microscope was used. The optical and the controlling components were supplied from Bruker, Olympus, and Thorlabs. The imaging of the DC was made using a 20x water-immersion objective (LUMPlanFI/IR, 20X, NA: 0.95, WD: 2 mm; Olympus Corporation, Tokyo, Japan), while the lateral surface of the IC was imaged by the long working distance 16x water-immersion objective (N16XLWD-PF - CFI LWD Plan Fluorite Objective, 16X, NA: 0.8, WD: 3.0 mm; Nikon, Tokyo, Japan) to be able to reach the focal point of the microprism at its hypotenuse. For imaging both the GFP or jRGECO1a signals, the excitation light was generated by InSight X3 laser (Spectra-Physics Lasers, Mountain View, CA, USA) tuned to a wavelength of 920 or 1040 nm, respectively. A layer of a 1:1 mixture of wavelength multipurpose ultrasound gel (National Therapy, Canada) with double-deionized water was used to immerse the objective. This gel was able to trap the water and reduce its evaporation during imaging. The emitted signals were detected by a photomultiplier tube (Hamamatsu H7422PA-4, Japan) following a t565lp dichroic and a Chroma barrier et525/70m filter for GFP and et595/50m filter for jRGECO1a signals. Images (512x512 pixels) were collected at a frame rate of 29.9 Hz in the resonant galvo mode. Data were collected from the dorsal surface of the IC by scanning the surface of the IC based on the GFP and jRGECO1a signals through the medial and lateral horizons of the IC. Generally, the scanning was started by moving the 20x objective to the most ventromedial position, where there is no ability to see any cells (Figure 2B, medial horizon). Then, the objective was driven to slowly move dorsolaterally to get cells in focus (Figure 1M), where the average depth of the first field of view was 169 m. The lateral movement of the objective was intended to be aligned and parallel to the curvature of the DC surface indicated by getting the superficial cells in focus to avoid any possibility of imaging the upper layers of the central nucleus of the IC, so the average depth of the most superficial point of the imaging was 92 m. The scanning was ended by moving the objective to the most ventrolateral position of the IC, where there is no ability to see GFP laterally (Figure 2B, lateral horizon), where the last field of view was collected at an average depth of 225 m. Generally, each field of view was selected based on the expression of GFP signals as an indicator for the cells in focus and being acoustically active by using a search stimulus that was 500 ms broadband noise with zero modulation at 80 dB SPL. The z-axis of the objective was determined relative to the pia surface. The relative position of each region was tracked through the micromanipulator (MP-285, Sutter Instruments) that controlled the microscope objective. The positions of imaged areas were further aligned across animals to a common coordinate using the midline, lateral extremes, and the vasculature landmarks taken via imaging of the GFP signals of the cranial window with low magnification (4x Olympus objective, 4x4 binning, 50 ms frame time) using a Lumen 200 bulb (Prior Scientific Inc, USA) and CoolSNAP MYO camera (Photometrics, USA, excitation: 488 nm and emission: 515–550 nm). Imaging of the lateral surface of the IC via microprism was done similarly. In both cases, the frame timing of the scanner and the sound stimuli were both digitized and time-locked using a Digidata 1440A (Molecular Devices, Sunnyvale, CA, USA) with Clampex v. 10.3 (Molecular Devices, Sunnyvale, CA, USA).
Laser lesion:
The laser lesion was produced using a 720 or 820 nm laser beam at 74-80 mW power at the level of the objective for 100 to 250 seconds depending on the size of the lesioned area, the speed of laser scanning (frame rate), and the depth of the lesion (z-axis length). In brief, the area of interest and the dimension of the laser lesion were initially determined using 920 nm as indicated by the GFP signals through scanning one of the GABAergic modules. The depth of the GABAergic modules was then determined by counting the optical slices starting from their superficial surface. The tunable laser was then switched from 920 nm to the shorter wavelength (720 or 820 nm) to scan the same area and depth at a rate (1-2 frames/ second).
Data processing:
Data collection: The data were collected as separate movies (512x512 pixels) for each pure tone or AM-noise runs in a resonant galvo mode. Depending on the amplitude and frequency combinations for each type of acoustic stimulus, 40- or 52-second periods were assigned as a movie's length for pure tone (35 stimulus combinations), or AM-noise (45 stimulus combinations), respectively. Using ImageJ software, the z-projection was used to compute one single image representing either the sum, the standard deviation, or the median of all the image sequences in the movie. Based on these single images, the region of interest (ROI) was manually drawn around each detectable cell body. Figures 3A and B represent the sum of the image sequences of the movie collected from the dorsal surface, or the lateral surface of the IC via microprism, respectively. For the subsequent processing steps, Python open-source libraries were used (listed below).
Motion Correction and Filtering: The imread function from the OpenCV library was used in grayscale mode to import images into a numpy array from a single folder containing TIFF images. The array was then exported as a single TIFF stack into a temporary folder using the mimwrite function from the imageio library, and the process was repeated for each folder. The NoRMCorre algorithm (Pnevmatikakis & Giovannucci, 2017) embedded in the CaImAn library (Giovannucci et al., 2019) was used to apply motion correction to each of the TIFF files. The data were then imported into a numpy array, rounded, and converted to 16-bit integers. The images were filtered using a 2D Gaussian filter with a sigma value of 1 (surface View) / 2 (prism View) in each direction, then a 1D Gaussian temporal filter with a sigma value of 2 was applied using the ndimage.gaussian_filter and ndimage.gaussian_filter1d function from the scipy library, respectively.
Data Extraction: The ROI sets, which were manually created using ImageJ, were imported using the read_roi_zip function from the read_roi library. The sets were then used to create two masks; one mask was used as a replica of the ROIs and the second mask was made around the original ROI (roughly four times larger in area). The smaller mask was applied to find the average pixel value within each ROI, while the larger mask was applied to find the average pixel value of the neuropil. The neuropil correction was applied using the following equation (Akerboom et al., 2012; Kerlin, Andermann, Berezovskii, & Reid, 2010);
Corrected value=Date value-(0.4 X Neuropil value). To identify the calcium signals, df/f was calculated by using the following equation.
Δf/f=((Date value-Background value))/(Background value ) where the background value is the slope estimating the background levels with fluorescence bleaching factored in. The data were then reorganized so that all segments with the same stimulus frequency and stimulus amplitude were grouped. The area under the curve (AUC) of the calcium signals of the excitatory responses only was then used as a metric to determine the magnitude of the response and for subsequent analysis (Berens et al., 2018; Overk, Rockenstein, Florio, Cheng, & Masliah, 2015).
Cell Flagging: The correlation coefficient between each of the trials was calculated using the stats. Pearson function from the scipy library. The average correlation coefficient was calculated for each stimulus frequency and stimulus amplitude. Similar to previous work (A. B. Wong & Borst, 2019), if the average correlation coefficient was above the threshold of 0.6, the cell was flagged as being responsive to that stimulus combination of frequency and amplitude, and the best tone and modulation frequencies were calculated for every cell (Barnstedt et al., 2015). Knowing BTF and the best modulation frequency (BMF) for each neuron enabled us to calculate the SMI and TMI at each sound level following these equations;
SMI
=(Response to BTF-Response to unmodulated noise)/(Response to BTF+Response to unmodulated noise)
The SMI has values ranging from (-1 to 1). While neurons with values closer to 1 are more responsive to pure tone, neurons with values closer to -1 are more responsive to noise with no modulation.
TMI
=(Response to BMF-Response to unmodulated noise)/(Response of BMF+Response to unmodulated noise)
Similarly, the TMI has values ranging from (-1 to 1). While neurons with values closer to 1 are more responsive to AM-noise, neurons with values closer to -1 are more responsive to noise with no modulation.
For the comparison between somatosensory and auditory responses, the threshold of 0.4 was used as a cutoff threshold to determine the responsive cells to each stimulation. The average response of each somatosensory, acoustic (500 ms of unmodulated noise), or simultaneous somatosensory and acoustic (bimodal) stimulation was then calculated for each responsive cell. The correlation method was validated as a tool to determine the responsive cells to somatosensory stimulation by generating an ROC curve comparing the automated method to a blinded human interpretation. The AUC of the ROC curve was 0.88. This high AUC value indicates that the correlation method can rank the random responsive cells better than the random nonresponsive cells. At the correlation coefficient (0.4), which was the cutoff value to determine the responsive cells for somatosensory stimulation, the specificity was 87% and the sensitivity 72%, the positive predictive value was 73%, and the negative predictive value was 86%. Additionally, all the false-responsive cells were excluded from the analysis. To examine the effect of somatosensory stimulation on auditory responses, the response index (RI) was calculated for the auditory-responsive cells using the following equation;
RI =(Auditory response to bimodal stimulation)/(Auditory response to auditory stimulation only) Reurons with RI values > 1 have enhanced or higher responses induced by simultaneous auditory and somatosensory stimulation, while neurons with RI values < 1 have downregulated or suppressed auditory responses induced by auditory and simultaneous somatosensory stimulation.
Map Generation: The average radius for all ROIs was calculated to ensure that all cells on the tonotopic map had uniform radii. A color key was also generated for every corresponding map. A blank canvas was generated using the Image module from the pillow library, and a circle was created for each cell and filled with a corresponding color to its value.
Receptive field sum (RFS) analysis: The binary RFS was calculated for every cell by determining whether the cell was responsive to a particular combination of frequency and amplitude (Bowen et al., 2020). A value of 1 was given to the responsive cell, if it responds to a single frequency/amplitude combination. In contrast, a value of 1 was added to the tally for each responsive combination if the cell was broadly responsive. Accordingly, the higher and lower values of RFS indicate a broad and narrow RF, respectively. To examine the differences between the RFS of the cells at different areas under different preparations, the cumulative distribution function was used.
Assessment of tonotopic organization.
The tonotopy was assessed by examining the best fit of linear or nonlinear quadratic polynomial regressions between the BTFs of cells and their locations along different anatomical axes. For the LC(microprism), the regression fit was examined along the main four axes such as dorsal to ventral, rostral to caudal, dorsocaudal to ventrorostral, and dorsorostral to ventrocoudal. Based on the previous reports showing the tonotopic organization over the DC (Barnstedt et al., 2015; A. B. Wong & Borst, 2019), the tonotopy was examined along the rostromedial to caudolateral axis. The x2 and y2 coordinates of each cell were determined. At the starting point of each axis, the x1 and y1 coordinates were assigned values as (0, 0). Then the distance (d) between each cell and the starting point at each axis was calculated based on the following equation;
d=√((x2-x1)^2+(y2-y1)^2 )
For each 50 um (bin size), the geometric average of the BTFs of all cells as well as their distances from the starting point at each axis were computed. The linear or quadratic polynomial regressions were then examined between the geometric averages of BTFs and the geometric averages of distances of cells for each animal.
Detecting the spontaneous activity from the nonresponsive cells:
Movies have been recorded from the nonresponsive cells of the LC(microprism) when no stimulation was presented. The time trace of jRGECO1a signals was extracted from each cell. A polynomial fitting of the time trace was used to correct for photobleaching and to adjust for the baseline for the whole trace. The sliding average of the baseline was then calculated for 1 second (~29 frames), and the z score was calculated for the subsequent frames. The spontaneous activity was detected when the z-score was > 3.0.
Statistics:
All statistical analyses and graphs were made using Origin Pro software. The normality of the distributions of the data was examined using a Kolmogorov-Smirnov test. The Mann-Whitney test as well as two-sample or paired t-test were used to examine the difference in data distribution or the difference between samples of non-normal and normal distribution, respectively. Either one-way or two-way ANOVA as well as Fisher as a post hoc test were used for the mean comparison between different groups of normal distribution. The Chi-square () test or Kruskal-Wallis ANOVA tests were used to compare the samples based on cell numbers of their cellular population. The cumulative frequency function was computed to calculate the fraction of cells tuned at each frequency based on their best frequency. Differences were deemed significant when p-value <0.05. The upper and lower borders of each box plot are at the 25th and 75th percentile, with whiskers at 95% spread.
Histology:
After the 2P imaging, the mouse was transcardially perfused with 4% paraformaldehyde (PFA) solution in PBS solution. The isolated brain was then placed overnight in PFA for a complete fixation. The brain was then moved from the PFA to a graded sucrose solution (10, 20, and 30%) until it sunk. 50 m coronal sections were taken at the level of the IC using a Leica cryostat. The sections were then mounted on a slide, coverslipped, and imaged using a confocal microscope for imaging the GFP signals as an indicator for the GABAergic cells in the GAD67-GFP knock-in mouse (excitation: 488 nm and emissions: 515–550 nm).
For the examination of jrgeco1a expression in the IC, the mouse was transcardially perfused with saline with a high concentration of potassium and a high ratio of calcium to magnesium [(in mM) 3.5 KCl, 25 glucose, 125 NaCl, 1.2 KH2PO4, 2 CaCl2, 0.5 MgSO4] under ketamine anesthesia. The brain was then fixed by a subsequent perfusion of 4% PFA. Selected 40 m coronal sections at the level of the IC were immunostained for NeuN using (NeuN (D4G40) XP® Rabbit mAB, Cell Signaling, Cat# 62994, 1:100) primary antibody and (goat anti-rabbit IgG conjugated to Alexa 405, 1:200) secondary antibody following the immunostaining procedures that were previously described (Issa, Sekaran, & Llano, 2023; Vaithiyalingam Chandra Sekaran et al., 2021). Confocal images were obtained using a Confocal Zeiss LSM 710 Microscope using 10 and 40x objectives and tile scan functions. For NeuN, Alexa 405 signals were obtained by a 405 nm laser and emission at 415-466 nm. The GFP signals were obtained by a 488 nm laser and emission at 501-551 nm. The jRGECO1a signals were obtained by 561 nm laser and emission at 600-700 nm. All cells with somas expressing a red fluorescence of jrgeco1a were quantified in 2P-imaged areas of the DC and LC. The density of the cells expressing jrgeco1a was then calculated based on the cells expressing NeuN.
Artwork:
The cartoon of the mouse brain in Figures 1 C, F, and I was obtained from Brain Explorer 3D viewer Allen Mouse Brain (https://connectivity.brain-map.org/3d-viewer?v=1) and modified to be suitable for illustration. All figures were designed and made using Adobe Illustrator (Adobe, San Jose, CA). To keep working within the Adobe environment to avoid losing the resolution of the figures, Adobe Photoshop (Adobe, San Jose, CA) was used to crop the borders of some images to save space. The color pallets were chosen to avoid the combination of the green and red colors for all maps, so they will be suitable for color-blind readers. To induce the same effect in the microscope images combining the red (jRGECO1a) and green (GFP) fluorescence, we kept the green signals of the GFP unchanged, but we substituted the red fluorescence of jRGECO1a with magenta as a pseudocolor.
Files
Llano-Lab-Analysis-Program-main.zip
Files
(74.4 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:6d5694df042959941e4ac93bbe78963f
|
74.4 kB | Preview Download |
Additional details
Related works
- Is cited by
- 10.7554/eLife.93063.3 (DOI)
- Is source of
- 10.5061/dryad.v41ns1s70 (DOI)