There is a newer version of the record available.

Published February 11, 2025 | Version 3.0

A collection of high-quality human assemblies

Description

A collection of high-quality human assemblies, including:

  • T2T-CHM13 v2.0 analysis set with HG002 chrY and rCRS chrM
  • GRCh38 no-alt analysis set with rCRS chrM
  • CN1 v1.0.1
  • YAO v1.1
  • KSA001 v1.1.0
  • 232 HPRC r2/v0.6 samples (464 assemblies; HG00272 has a ~50Mb inversion misassembly)

Use AGC to extract indivual genomes and use ropebwt3 to query the FM-index:

agc listset human472.agc   # list genomes
agc getset human472.agc 200149_HG02523.pat > HG02523.pat.fa # extract one genome
gzip -d human472.fmr.gz     # decompress the incremental index
ropebwt3 build -i human472.fmr -do human472.fmd  # convert to a faster query format
gzip -d human472.fmd.ssa.gz  # decompress suffix array samples
echo CCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAG | ropebwt3 sw -eN200 -Lm10 human472.fmd -

Note: The HPRC assemblies are already available from GenBank. This repository only provides a convenient way to download them. However, these assemblies are not formally published. You may use them for algorithm development or performance evaluation. If you want to use the genomes for biological discovery, please contact HPRC.

Files

Files (21.0 GB)

Name Size
md5:5fb1a31b71f16a27407342d3c8aa1d4c
3.4 GB Download
md5:e0bf7080d2b4e4a8112c1ab4fb5055b7
286.7 kB Download
md5:9451418190e7b3fdde63aef2589ac457
9.1 GB Download
md5:5304b0bce6ae545ffd4aee7fefdb6ea0
8.5 GB Download
md5:847b2184e84f948f865ac01f884780d5
23.0 kB Download

Additional details

Related works

Continues
Publication: 10.1093/bioinformatics/btae717 (DOI)
Dataset: 10.5281/zenodo.11533210 (DOI)