rCRUX Generated ITS2 Plants Reference Database
Authors/Creators
- 1. NOAA PMEL
- 2. Vermont Biomedical Research Network
- 3. Landmark College
- 4. Universidad Autónoma de Madrid
Description
rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.
Primer Name: ITS2 Plants
Gene: ITS2
Length of Target: 450-550
get_seeds_local() minimum length: 315
get_seeds_local() maximum length: 600
blast_seeds() minimum length: 270
blast_seeds() maximum length: 560
max_to_blast: 100
Forward Sequence (5'-3'): ATGCGATACTTGGTGTGAAT
Reverse Sequence (5'-3'): GACGCTTCTCCAGACTACAAT
Reference: Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. https://doi.org/10.1371/journal.pone.0067818
We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.
Files
Files
(60.3 MB)
| Name | Size | Download all |
|---|---|---|
|
md5:83c4e5f617756928079eb0104f19701b
|
60.3 MB | Download |