Published November 3, 2023
| Version v1
Dataset
Open
TABLE 1 in Balclutha jafara (Hemiptera: Cicadellidae): integrative identification of a species introduced in the Western Hemisphere, and notes on other Balclutha
Authors/Creators
- 1. United States Department of Agriculture, APHIS-PPQ-NIS, MRC- 168, National Museum of Natural History, Smithsonian Institution, P. O. Box 37012, Washington, DC 20013 - 7012
- 2. Florida Department of Agriculture and Consumer Services, Division of Plant Industry, The Doyle Conner Building, 1911 SW 34 th St, Gainesville, FL 32608 & Susan. Halbert @ FDACS. gov; https: // orcid. org / 0000 - 0003 - 4341 - 5196
- 3. Florida Department of Agriculture and Consumer Services, Division of Plant Industry, The Doyle Conner Building, 1911 SW 34 th St, Gainesville, FL 32608 & Matthew. Moore @ FDACS. gov; https: // orcid. org / 0000 - 0002 - 6313 - 3690
- 4. United States Department of Agriculture, APHIS-PPQ-NIS, 10300 Baltimore Ave., BARC-W, Bldg. 004, Rm. 112, Beltsville, MD 20705
- 5. University of Florida / Institute of Food and Agricultural Sciences, Everglades Research and Education Center, 3200 East Palm Beach Road, Belle Glade, FL 33430
Description
TABLE 1. Oligonucleotide primers used for DNA and sequencing.
| Primer Name and Sequence | Reference |
|---|---|
| LCO1490: GGTCAACAAATCATAAAGATATTGG | Folmer et al. (1994) |
| HCO2198: TAAACTTCAGGGTGACCAAAAAATCA | Folmer et al. (1994) |
| BalcluthaF1: GTTATACCAATCATAATTG | This study |
| BalcluthaF2: GGTTACTACCTCCATCAATTTC | This study |
| BalcluthaF3: GTAAACTTTATTACCACCG | This study |
| BalcluthaF4: CTTCTGACTGATCGAAATATC | This study |
| BalcluthaR1: GAAAGCTATGTCCGGAGCTCC | This study |
| BalcluthaR2: GCATGTGCAATATTACTTG | This study |
| BalcluthaR3: CTGACCAAACAAATAAAGGTG | This study |
Notes
Published as part of Zahniser, James N., Halbert, Susan E., Moore, Matthew R., Mottern, Jason L. & Beuzelin, Julien M., 2023, Balclutha jafara (Hemiptera: Cicadellidae): integrative identification of a species introduced in the Western Hemisphere, and notes on other Balclutha, pp. 529 in Zootaxa 5361 (4) on page 529, DOI: 10.11646/zootaxa.5361.4.4, http://zenodo.org/record/10151778
Files
Files
(1.3 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:67f191d07988a1a004a3016b984da0b2
|
1.3 kB | Download |
System files
(6.7 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:708c091408092bf6732d03e0009022fe
|
6.7 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.11646/zootaxa.5361.4.4 (DOI)
- Journal article: urn:lsid:plazi.org:pub:DE36FF84BE5EAC3DFFABFFB9FE4E094C (LSID)
- Journal article: http://publication.plazi.org/id/DE36FF84BE5EAC3DFFABFFB9FE4E094C (URL)
- Journal article: http://zenodo.org/record/10151778 (URL)
- Journal article: http://zoobank.org/8ADF8361-2620-480C-A2AE-62C484616888 (URL)
References
- Folmer, O., Black, M., Hoeh, W., Lutz, T. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial Cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294 - 299.