Published July 7, 2020
| Version v1
Dataset
Open
Table 1 in Integrative redescription of Hypsibius pallidoides Pilato et al., 2011 (Eutardigrada: Hypsibioidea) with the erection of a new genus and discussion on the phylogeny of Hypsibiidae
Authors/Creators
- 1. Department of Invertebrate Zoology, Faculty of Biology, Saint-Petersburg State University, Universitetskaya nab. 7 / 9, Saint Petersburg, Russia. & The Laboratory of the Marine Research, Zoological Institute 199034, Universitetskaja nab.
Description
Table 1. Primers used for amplification of the four DNA fragments sequenced in the study.
| DNA fragment | Primer name | Primer direction | Primer sequence (5’–3’) | Primer source |
|---|---|---|---|---|
| 18S rRNA | SSU_F_04 | forward | GCTTGTCTCAAAGATTAAGCC | Kiehl et al. 2007 |
| SSU_R_26 | reverse | CGAAAGCATTTGCCAAGAATG | Kiehl et al. 2007 | |
| 18Sfw | forward | CTTGTCTCAAAGATTAAGCCATGCA | Dabert et al. 2014 | |
| rev960 | reverse | GACGGTCCAAGAATTTCAC | Dabert et al. 2014 | |
| fw390 | forward | AATCAGGGTTCGATTCCGGAGA | Dabert et al. 2014 | |
| rew18S | reverse | TGATCCTTCCGCAGGTTCACCT | Dabert et al. 2014 | |
| 5F | forward | GCGAAAGCATTTGCCAAGAA | Giribet et al. 1996 | |
| 9R | reverse | GATCCTTCCGCAGGTTCACCTAC | Giribet et al. 1996 | |
| fw1230 | forward | TGAAACTTAAAGGAATTGACG | Dabert et al. 2014 | |
| rev1460 | reverse | CATCACAGACCTGTTATTGC | Dabert et al. 2014 | |
| 28S rRNA | 28SF0001 | forward | ACCCVCYNAATTTAAGCATAT | Dabert et al. 2014 |
| 28SR1800 | reverse | GTTCACATGGAACCCTTCT | Dabert et al. 2014 | |
| COI | LCO1490 | forward | GGTCAACAAATCATAAAGATATTGG | Folmer et al. 1994 |
| HCO2198 | reverse | TAAACTTCAGGGTGACCAAAAAATCA | Folmer et al. 1994 | |
| ITS-2 | ITS2_Eutar_Ff | forward | CGTAACGTGAATTGCAGGAC | Stec et al. 2018 |
| ITS2_Eutar_Rr | reverse | TGATATGCTTAAGTTCAGCGG | Stec et al. 2018 |
Notes
Published as part of Tumanov, Denis V., 2020, Integrative redescription of Hypsibius pallidoides Pilato et al., 2011 (Eutardigrada: Hypsibioidea) with the erection of a new genus and discussion on the phylogeny of Hypsibiidae, pp. 5 in European Journal of Taxonomy 681 on page 5, DOI: 10.5852/ejt.2020.681, http://zenodo.org/record/3939312
Files
Files
(2.7 kB)
| Name | Size | |
|---|---|---|
|
md5:30690424dc64598f4efa39db2d96a20c
|
2.7 kB | Download |
System files
(13.4 kB)
| Name | Size | |
|---|---|---|
|
md5:3b0a0d9e8d6e9fba4af5b73ef7468787
|
13.4 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.5852/ejt.2020.681 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FFAEFFA4FFB1FFBBFFECFFF6FF85FFDA (LSID)
- Journal article: http://publication.plazi.org/id/FFAEFFA4FFB1FFBBFFECFFF6FF85FFDA (URL)
- Journal article: http://zenodo.org/record/3939312 (URL)
- Journal article: http://zoobank.org/F2261F19-6C71-4A60-A3C3-44031BFC99FC (URL)
References
- Kiehl E., Dastych H., D'Haese J. & Greveh H. 2007. The 18 S rDNA sequences support polyphyly of the Hypsibiidae (Eutardigrada). Journal of Limnology 66 (Suppl. 1): 21 - 25. https: // doi. org / 10.4081 / jlimnol. 2007. s 1.21
- Dabert M., Dastych H., Hohberg K. & Dabert J. 2014. Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18 S and 28 S rRNA sequence data from its type species A. confusus. Molecular Phylogenetics and Evolution 70: 70 - 75. https: // doi. org / 10.1016 / j. ympev. 2013.09.012
- Folmer O., Black M., Hoeh W., Lutz R. & Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 (5): 294 - 299.
- Stec D., Morek W., Gasiorek P. & Michalczyk L. 2018. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16 (4): 357 - 376. https: // doi. org / 10.1080 / 14772000.2018.1424267