Published April 11, 2024
| Version v1
Dataset
Open
TABLE 1 in Morphology and Phylogeny Reveal A New Species Of Papiliomyces (Clavicipiteae, Hypocreales) From Yunnan, China
Authors/Creators
- 1. Yunnan Herbal Laboratory, College of Ecology and Environmental Sciences, Yunnan University, Kunming 650504, Yunnan, China
- 2. Yunnan Herbal Laboratory, College of Ecology and Environmental Sciences, Yunnan University, Kunming 650504, Yunnan, China & School of Life Sciences, Yunnan University, Kunming 650504, Yunnan, China
Description
TABLE 1. The primer information of each gene fragment used for DNA amplification in this study.
| Gene | Primer name | Primer sequence (5ʹ-3ʹ) | Reference |
|---|---|---|---|
| nr SSU | CoF | TCTCAAAGATTAAGCCATGC | Wang et al., 2015a |
| CoR | TCACCAACGGAGACCTTG | ||
| nr LSU | LR5 | ATCCTGAGGGAAACTTC | Vilgalys and Hester, 1990; |
| LR0R | GTACCCGCTGAACTTAAGC | Rehner and Samuels, 1994 | |
| tef-1α | 983F | GCYCCYGGHCAYCGTGAYTTYAT | Rehner and Buckley, 2005 |
| 2218R | ATGACACCRACRGCRACRGTYTG | ||
| rpb1 | CRPB1A | CAYCCWGGYTTYATCAAGAA | Castlebury et al., 2004; Bischoff et al., 2006 |
| RPB1C | CCNGCDATNTCRTTRTCCATRTA | ||
| rpb2 | fRPB2-5F | GAYGAYMGWGATCAYTTYGG | Liu et al., 1999 |
| fRPB2-7cR | CCCATRGCTTGYTTRCCCAT | ||
| ITS | ITS4 | TCCTCCGCTTATTGATATGC | White et al., 1990 |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG |
Notes
Published as part of Chen, Yue, Sun, Tao, Tang, De-Xiang, Liu, Zuo-Heng, Ma, Jin-Mei, Ma, Shao-Bin & Yu, Hong, 2024, Morphology and Phylogeny Reveal A New Species Of Papiliomyces (Clavicipiteae, Hypocreales) From Yunnan, China, pp. 137 in Phytotaxa 644 (2) on page 137, DOI: 10.11646/phytotaxa.644.2.5, http://zenodo.org/record/13214617
Files
Files
(1.8 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:4639a02a992d76ffe6560ee45f889e1f
|
1.8 kB | Download |
System files
(12.0 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:570e6d7413cae9a26e06a23fd2396065
|
12.0 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.11646/phytotaxa.644.2.5 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FFB9AF79927B4D03FFAD1C77FFA2014F (LSID)
- Journal article: http://publication.plazi.org/id/FFB9AF79927B4D03FFAD1C77FFA2014F (URL)
- Journal article: http://zenodo.org/record/13214617 (URL)
References
- Wang, Y. B., Yu, H., Dai, Y. D., Wu, C. K., Zeng, W. B., Yuan, F. & Liang, Z. Q. (2015 a) Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China. Mycological Progress 14: 70. https: // doi. org / 10.1007 / s 11557 - 015 - 1090 - 7
- Vilgalys, R. & Hester, M. (1990) Rapid genetic identifcation and mapping of enzymatically amplifed ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238 - 4246. https: // doi. org / 10.1128 / jb. 172.8.4238 - 4246.1990
- Rehner, S. A. & Samuels, G. J. (1994) Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625 - 634. https: // doi. org / 10.1016 / S 0953 - 7562 (09) 80409 - 7
- Rehner, S. A. & Buckley, E. (2005) A Beauveria phylogeny inferred from nuclear ITS and EF 1 - α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84 - 98. https: // doi. org / 10.1080 / 15572536.2006.11832842
- Castlebury, L. A., Rossman, A. Y., Sung, G. H., Hyten, A. S. & Spatafora, J. W. (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108: 864 - 872. https: // doi. org / 10.1017 / S 0953756204000607
- Bischoff, J. F., Rehner, S. A. & Humber, R. A. (2006) Metarhizium frigidum sp. nov.: A cryptic species of M. anisopliae and a member of the M. flavoviride complex. Mycologia 98: 737 - 745. https: // doi. org / 10.3852 / mycologia. 98.5.737
- Liu, Y. J., Whelen, S. & Hall, B. D. (1999) Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 12: 1799 - 1808. https: // doi. org / 10.1093 / oxfordjournals. molbev. a 026092
- White, T. J., Bruns, T. D., Lee, S. B. & Taylor, J. W. (1990) Amplifcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J. & White, T. J. (Eds) PCR protocols: a guide to methods and applications. Academic, New York pp. 315 - 322.