Published March 25, 2022
| Version v1
Dataset
Open
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae)
Authors/Creators
- 1. Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture and Rural Affair / Engineering Research Center of Green development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China & Key Laboratory of Ecological Impacts of Hydraulic-Projects and Restoration of Aquatic Ecosystem of Ministry of Water Resources, Institute of Hydroecology, Ministry of Water Resources and Chinese Academy of Sciences, Wuhan 430079, China
- 2. Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture and Rural Affair / Engineering Research Center of Green development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
Description
Table 1. Primer sequences of PCR products for target genes.
| Gene | Primer | Sequence (5'-3') | Reference |
|---|---|---|---|
| CO1 | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Folmer et al. (1994) |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAAT | Folmer et al. (1994) | |
| LCO3 | TCNACHAAYCATAAAGAYATTGGTAC | Krebes et al. (2010) | |
| 16S | 16STf | GGTAWHYTRACYGTGCTAAG | MacDonald et al. (2005) |
| 16Sbr | CCGGTTTGAACTCAGATCATGT | Palumbi et al. (1991) | |
| 28S | 28F | TTAGTAGGGGCGACCGAACAGGGAT | Hou et al. (2007) |
| 28R | GTCTTTCGCCCCTATGCCCAACTGA | Hou et al. (2007) | |
| EF1α | EF1αF | CACTACTGGTCATCTCATCTAC | Hou et al. (2011) |
| EF1αR | ACTTCCAGGAGAGTCTCAAAC | Hou et al. (2011) |
Notes
Published as part of Zhang, Kui, Wang, Jun, Ge, Yihao, Ma, Jishun & Zhou, Qiong, 2022, A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae), pp. 129 in ZooKeys 1090 on page 129, DOI: 10.3897/zookeys.1090.78834
Files
Files
(2.3 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:075e52a785c4645ad6d009130537813f
|
2.3 kB | Download |
System files
(13.3 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:0427fb2b9e34b911fff865dcd2602a0d
|
13.3 kB | Download |
Additional details
Identifiers
References
- Folmer, O, Black, M, Hoeh, W, Lutz, R, Vrijenhoek, R, 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 (5): 294 - 299, https://pubmed.ncbi.nlm.nih.gov/7881515/
- Krebes, L, Blank, M, Juerss, K, Zettler, ML, Bastrop, R, 2010. Glacial-driven vicariance in the amphipod Gammarus duebeni. Molecular Phylogenetics and Evolution 54 (2): 372 - 385, DOI: https://doi.org/10.1016/j.ympev.2009.07.034
- MacDonald III, KS, Yampolsky, L, Duffy, JE, 2005. Molecular and morphological evolution of the amphipod radiation of Lake Baikal. Molecular Phylogenetics and Evolution 35 (2): 323 - 343, DOI: https://doi.org/10.1016/j.ympev.2005.01.013
- Palumbi, SR, Martin, A, Romano, S, Mcmillan, WO, Stice, L, Grabowski, G, 1991. A Simple Fool's Guide to PCR. University of Hawaii Press.
- Hou, Z, Fu, J, Li, S, 2007. A molecular phylogeny of the genus Gammarus (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Molecular Phylogenetics and Evolution 45 (2): 596 - 611, DOI: https://doi.org/10.1016/j.ympev.2007.06.006
- Hou, Z, Sket, B, Fiser, C, Li, S, 2011. Eocene habitat shift from saline to freshwater promoted Tethyan amphipod diversification. Proceedings of the National Academy of Sciences of the United States of America 108 (35): 14533 - 14538, DOI: https://doi.org/10.1073/pnas.1104636108