Published February 7, 2024
| Version v1
Dataset
Open
TABLE 1 in A new species of planthopper in the genus Paraphenice (Hemiptera: Derbidae: Otiocerinae) from palms in eastern Madagascar
Authors/Creators
- 1. University of Florida, Department of Entomology and Nematology - Fort Lauderdale Research and Education Center; 3205 College Ave., Davie, FL 33314 - 7719, USA
- 2. Museum and Institute of Zoology, Polish Academy of Sciences, Warszawa, Poland
- 3. Institute of Environmental Sciences, Faculty of Biology, Jagiellonian University ul. Gronostajowa 7, 30 - 387 Kraków, Poland
- 4. University of Delaware, Department of Entomology and Wildlife Ecology, 250 Townsend Hall, Newark, DE 19716 - 2160, USA
- 5. CIRAD, UMR PVBMT, F- 97410 Saint-Pierre, La Réunion, France
- 6. Madagascar Biodiversity Institute, Parc Botanique et Zoologique de Tsimbazaza, Antananarivo 101, Madagascar
Description
TABLE 1. Primers used to amplify loci used for assessment of Paraphenice fluctus sp. n. and corresponding annealing temperatures and extension times.
| Gene | Primer Name | Sequence (5’ 6 3’) | Annealing | Extension | Reference |
|---|---|---|---|---|---|
| COI | LCO1490 HCO2198 | GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA | 40˚C | 1 min. 30 sec. | Folmer et al. 1994 |
| 18S | 18SFI 18SRI | ACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA | 50˚C | 2 min. | Bahder et al. 2019 |
| 28S | V X | GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC | 55˚C | 1 min. 30 sec. | Cryan et al. 2000 |
Notes
Published as part of Bahder, Brian W., Stroiński, Adam, Łukasik, Piotr, Bartlett, Charles R., Pilet, Fabian & Hasinjaka, Rasolondalao Harin'Hala, 2024, A new species of planthopper in the genus Paraphenice (Hemiptera: Derbidae: Otiocerinae) from palms in eastern Madagascar, pp. 464 in Zootaxa 5406 (3) on page 464, DOI: 10.11646/zootaxa.5406.3.5, http://zenodo.org/record/10628088
Files
Files
(1.2 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:9ad864af0d77e496edb27241acf37942
|
1.2 kB | Download |
System files
(7.8 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:fa9fa5a3fef113554ab1763000b717a9
|
7.8 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.11646/zootaxa.5406.3.5 (DOI)
- Journal article: urn:lsid:plazi.org:pub:5D38FFD4FF94C765423CDF0CFF99FFBE (LSID)
- Journal article: http://publication.plazi.org/id/5D38FFD4FF94C765423CDF0CFF99FFBE (URL)
- Journal article: http://zenodo.org/record/10628088 (URL)
- Journal article: http://zoobank.org/F49F1B8A-ECD4-47E8-972E-8FC37D1ED472 (URL)
References
- Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3 (5), 294 - 299.
- Bahder, B. W., Bartlett, C. R., Barrantes, E. A. B, Zumbado Echavarria, M. A., Humphries, A. R., Helmick, E. E., Ascunce, M. S. & Goss, E. M. (2019) A new species of Omolicna (Hemiptera: Auchenorrhyncha: Fulgoroidea: Derbidae) from coconut palm in Costa Rica and new country records for Omolicna brunnea and Omolicna triata. Zootaxa, 4577 (3), 501 - 514. https: // doi. org / 10.11646 / zootaxa. 4577.3.5
- Cryan, J. R., Wiegmann, B. M., Deitz, L. L. & Dietrich, C. H. (2000). Phylogeny of the treehoppers (Insecta: Hemiptera: Membracidae): Evidence from two nuclear genes. Molecular Phylogenetics and Evolution, 17 (2), 317 - 334. https: // doi. org / 10.1006 / mpev. 2000.0832