Published May 19, 2021 | Version v1

Table 1 in Integrative descriptions of two new Macrobiotus species (Tardigrada, Eutardigrada, Macrobiotidae) from Mississippi (USA) and Crete (Greece)

  • 1. Department of Biological and Environmental Science, University of Jyvaskyla, PO Box 35, FI- 40014 Jyvaeskylae, Finland
  • 2. Department of Invertebrate Evolution, Institute of Zoology and Biomedical Research, Faculty of Biology, Jagiellonian University, Gronostajowa 9, 30 - 387 Krakow, Poland

Description

Table 1. Primers with their original references used for amplification of the four DNA fragments sequenced in the study.

DNA markerPrimer namePrimer directionPrimer sequence (5 ’-3’)Primer source
18S rRNA18S_Tar_Ff1forwardAGGCGAAACCGCGAATGGCTCStec et al. (2017a)
18S_Tar_Rr1reverseGCCGCAGGCTCCACTCCTGG
28S rRNA28S_Eutar_FforwardACCCGCTGAACTTAAGCATATGąsiorek et al. (2018)
28SR0990reverseCCTTGGTCCGTGTTTCAAGACMironov et al. (2012)
ITS-2ITS2_Eutar_FfforwardCGTAACGTGAATTGCAGGACStec et al. (2018a)
ITS2_Eutar_RrreverseTCCTCCGCTTATTGATATGC
COILCO1490-JJforwardCHACWAAYCATAAAGATATYGGAstrin and Stüben (2008)
HCO2198-JJreverseAWACTTCVGGRTGVCCAAARAATCA

Notes

Published as part of Vecchi, Matteo & Stec, Daniel, 2021, Integrative descriptions of two new Macrobiotus species (Tardigrada, Eutardigrada, Macrobiotidae) from Mississippi (USA) and Crete (Greece), pp. 281 in Zoosystematics and Evolution 97 (1) on page 281, DOI: 10.3897/zse.97.65280

Files

Files (2.5 kB)

Name Size Download all
md5:a0a5eaabd6a1757a9cc9b1ba806473a2
2.5 kB Download

System files (9.7 kB)

Name Size Download all
md5:e4b92a8b1eb907eb46416806253be2d9
9.7 kB Download

Additional details

References

  • Stec, D, Zawierucha, K, Michalczyk, L, 2017a. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300 (3): 403 - 420, DOI: https://doi.org/10.11646/zootaxa.4300.3.4
  • Gasiorek, P, Stec, D, Zawierucha, Z, Kristensen, RM, Michalczyk, L, 2018. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472 (2): 261 - 297, DOI: https://doi.org/10.11646/zootaxa.4472.2.3
  • Mironov, SV, Dabert, J, Dabert, M, 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54 - 61, DOI: https://doi.org/10.11646/zootaxa.3253.1.2
  • Stec, D, Morek, W, Gasiorek, P, Michalczyk, L, 2018a. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16 (4): 357 - 376, DOI: https://doi.org/10.1080/14772000.2018.1424267
  • Astrin, JJ, Stueben, PE, 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22 (5): 503 - 522, DOI: https://doi.org/10.1071/IS07057