Published February 4, 2021
| Version v1
Dataset
Open
Table 2 in Synopsis of the Evippinae (Araneae, Lycosidae) of Israel, with description of a new species
Authors/Creators
- 1. The National Natural History Collections, The Hebrew University of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel. & The Department of Ecology, Evolution and Behavior, The Hebrew University of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel.
- 2. University Ghent, Terrestrial Ecology Unit, K. L. Ledeganckstraat 35, 9000 Gent, Belgium.
- 3. The Department of Ecology, Evolution and Behavior, The Hebrew University of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel.
- 4. The National Natural History Collections, The Hebrew University of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel.
Description
Table 2. Primers used for molecular phylogeny.
| Name | Sequence | Gene | Direction | Source |
|---|---|---|---|---|
| LepF1 | ATTCAACCAATCATAAAGATATTGG | COI | F | Hebert et al. 2004 |
| LCO1490 | GGTCAACAAATCATAAAGATATTGG | COI | R | Folmer et al. 1994 |
| LepR1 | TAAACTTCTGGATGTCCAAAAAATCA | COI | R | Hebert et al. 2004 |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | COI | F | Folmer et al. 1994 |
| TL-1-N-12718 | TGCATTAGAATTAGAATCTA | NADH | F | Piacentini & Ramirez 2019 |
| M510 | ATACTAATTCKGATTCKCCTTC | NADH | R | Piacentini & Ramirez 2019 |
Notes
Published as part of Steinpress, Igor Armiach, Alderweireldt, Mark, Cohen, Mira, Chipman, Ariel & Gavish-Regev, Efrat, 2021, Synopsis of the Evippinae (Araneae, Lycosidae) of Israel, with description of a new species, pp. 92 in European Journal of Taxonomy 733 on page 92, DOI: 10.5852/ejt.2021.733.1225, http://zenodo.org/record/4505891
Files
Files
(1.3 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:b384fafe3290144ed49de81c3d6f61d1
|
1.3 kB | Download |
System files
(8.7 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:a5788a66dacbedd06ecbe751b7d254f2
|
8.7 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.5852/ejt.2021.733.1225 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FF8EFF9DBA54C13AFFFD185B745C0538 (LSID)
- Journal article: http://publication.plazi.org/id/FF8EFF9DBA54C13AFFFD185B745C0538 (URL)
- Journal article: http://zenodo.org/record/4505891 (URL)
- Journal article: http://zoobank.org/22EF594A-81C2-4C8B-AF9A-0DC86C3B5BA3 (URL)
References
- Folmer O., Black M., Hoeh W., Lutz R. & Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 (5): 294 - 299.
- Piacentini L. N. & Ramirez M. J. 2019. Hunting the wolf: A molecular phylogeny of the wolf spiders (Araneae, Lycosidae). Molecular Phylogenetics and Evolution 136: 227 - 240. https: // doi. org / 10.1016 / j. ympev. 2019.04.004