Identifying the Fusarium species involved in foot rot disease of beans in the UK using a combined molecular and microbiological approach
Authors/Creators
Description
Materials and methods
Fungal isolation
Isolates (113) were prepared from both soil and infected plant samples that were received from the Plant Clinic at the Processors and Growers Research Organisation (PGRO). The samples were from different regions of England, United Kingdom (Table 1).
Table 1: The locations and number of isolates obtained for infected faba bean and soil samples used in the study. * = includes soil isolates
|
Location |
Number of isolates obtained |
Month(s) |
|
PGRO experimental plots |
29* (13 soil, 16 plant) |
November 2022 |
|
Cambridgeshire |
2 |
June 2023 |
|
Oxfordshire |
3 |
June-July 2023 |
|
Durham |
3 |
July 2023 |
|
Shropshire |
4 |
July and August2023 |
|
Lincolnshire |
5 |
July and August 2023 |
|
Northumberland |
5 |
July and August 2023 |
|
Staffordshire |
4 |
July and August 2023 |
|
Suffolk |
4 |
July 2023 |
|
Leicestershire |
2 |
July 2023 |
|
Essex |
4 |
July 2023 |
|
Norfolk |
34 |
August 2023 |
|
Yorkshire |
6 |
September 2023 |
|
Hampshire |
2 |
July 2023 |
|
Undisclosed PGRO locations |
6 |
Undisclosed |
Infected plant samples were disinfected by placing pieces of infected stems/root in 10 % sodium hypochlorite solution for 5 min. The samples were rinsed twice using sterilised distilled water and placed on sterilised filter paper to be dried for 10 min at room temperature inside a laminar flow hood. The dried samples were moved to potato dextrose agar medium (PDA) inside 9 cm diameter plastic Petri dishes. Petri dishes were incubated at 22 °C with 12 h fluorescent photoperiod, and light intensity of 20-25 µMol.m-2.s-1.
Once colonies had formed, clonal isolates were prepared from the colonies as follows. Approximately 1 mm2 of the colony was collected using a flame-sterilised inoculation loop and was sequentially spread onto three Petri dishes containing 2 % water agar, to dilute the inoculum gradually. The Petri dishes were incubated for 24 h as described above. The third Petri dish for each isolate was examined under a stereoscope, and one separated hypha was transferred using a flame-sterilised scalpel to another Petri dish containing PDA medium, and incubated for seven days to provide a clonal isolate. The isolates were stored for future use using two methods, for routine or long-term storage. For routine storage (months), three discs of the PDA medium containing the clonal isolate were transferred to a 2 ml microcentrifuge tube containing 1 ml of sterilised distilled water, the tube sealed with parafilm and stored at -20 °C. For long-term storage (3-4 years) the clonal isolate was plated onto a Petri dish containing many pieces of 1 cm long sterilised filter paper on PDA medium, and the colony was allowed to grow for seven days to cover the filter paper. The pieces of filter paper were removed and placed inside an empty Petri dish and dried for seven days at room temperature. The filter paper pieces were then transferred to an empty 2 ml plastic microcentrifuge tube and stored at -20 °C. Koch`s postulates were confirmed for each of the isolates by re-isolation, inoculation, and identification.
Pathogenicity testing
Pathogenicity testing was conducted using susceptible faba bean seedlings (cv. Lynx) grown in test tubes in a mixture of perlite/vermiculite. The growth media was prepared by adding one volume of vermiculite (the capacity of a 1000 ml plastic beaker) to one volume of perlite inside an autoclave bag; this was mixed to ensure equal distribution of each component, and 1 litre of distilled water was added. The autoclave bag was closed and autoclaved for 20 min at 121 °C, and the mixture was transferred to fill 2/3 of the test tubes (150 x 24 mm, 1.2 ml wall; borosilicate glass 150 x 24 mm, rimless, Appleton Woods Ltd), which were then sealed with cotton wool and aluminium foil, prior to being autoclaved.
Seeds were soaked in sterilized distilled water overnight and placed in 10 % sodium hypochlorite for 5 min. The seeds were washed three times with sterilised distilled water and placed on sterilised filter paper until dry. The seeds were then transferred to 9 cm petri dishes containing 1.2 % Tap Water Agar (12 g agar in 1 l of tap water, autoclaved in a 2 l conical flask), where they were allowed to germinate for four days in the incubator at 24 °C before being transferred to test tubes containing the vermiculite/perlite mixture.
Following transfer, the seedlings were allowed to grow for five to seven days until they were suitable for inoculation (4-5 cm root length). The seedlings were inoculated by placing a 10 mm block of PDA medium containing a ten-day old fungal culture against the stem base. A small piece of sterilised cotton was placed around the stem to ensure adequate moisture at the inoculation site. The inoculated seedlings were incubated at 24 °C, with a 12 h photoperiod and light intensity of 20-25 µMol.m-2.s-1.
Disease severity was monitored daily from 5-6 days after inoculation. Root and stem infection were scored on days 15 and 25 using a 5-point scale (Figure 2):
0 = healthy roots, no discolouration.
1 = up to 20 % root or stem base discoloured.
2 = 20-40 % root or stem base discoloured.
3 = 40-60 % root or stem base discoloured.
4 = 60-80 % root or stem base discoloured, stunting of plant.
5 = total discoloration, dead plant.
DNA extraction
Clonal colonies were cultured on 50 ml of Potato Dextrose Broth (PDB) medium (FORMEDIUMTM) in a 250 ml flask and incubated for seven days on a rotary shaker (22 °C with 70 RPM). The mycelium for each isolate was harvested by transferring the contents of each flask into a 50 ml falcon tube and centrifuging at 5000 RPM for 10 min. The supernatant was discarded, and the mycelium pellet stored at -20 °C. Mycelium (1 ml) was transferred to a 2 ml safe-lock microcentrifuge tube. The tubes were covered with parafilm which was pierced to allow moisture to evaporate. Samples were freeze-dried (-45 °C, 0.133 mbar) for 48 h. Freeze-dried mycelium (15 mg) was transferred to a 2 ml safe lock microcentrifuge tube containing two carbon steel ball bearings (3 mm diameter, grade 1000, SimplyBearings). The mycelium was homogenised for 4 min using a TissueLyser (Retsch MM400; 30 RPS), after which 120 µl of TNES buffer was added and the samples were homogenised again as before.
Total DNA was extracted from the samples following the BOMB-Bio nucleic acid tissue DNA extraction protocol (Oberacker et al., 2019). The samples were incubated at 55 °C overnight after adding 2 µl of proteinase K and 3 µl of RNAase A. Following incubation, 240 µl of GITC lysis buffer was added, mixed and samples incubated at room temperature for 5 min. Isopropanol (480 µl) was added and, following centrifugation (5000 RPM; 5 min), 650 µl was transferred to a new tube with 200 µl of 1X BOMB-Bio magnetic bead solution (1:50 carboxylated SeraMag Speed Beads magnetic beads in TE) and mixed. The solution was placed on a magnetic rack to hold the beads with DNA bound to them in place whilst the supernatant was removed. The beads with bound DNA were washed once with isopropanol (400 µl) and twice with 80 % ethanol (400 µl). The solution was removed from the magnet, beads were allowed to dry briefly and 70 µl of nuclease free water was added to elute the DNA. The beads were removed by placing the samples back on the magnetic rack and transferring the supernatant to a new tube. The extracted DNA concentration was estimated using a Qubit 4 and 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen) according to the manufacturer’s instructions.
Polymerase Chain Reaction (PCR)
DNA was amplified using PCR with three sets of primers: Internal Transcribed Spacer (ITS) primers ITS1/ITS4 (Raja et al., 2017) and two sets of Translation Elongation Factor one α primers, 1018F/1620R and EF1/EF2 (O’Donnell et al., 1998; Raja et al., 2017). Prior to PCR, the template DNA concentration was adjusted to 5 ng/μl using molecular grade water. The PCR mix contained: 12.5 µl of 2x MyTaq Red Mix (Meridian Bioscience), 3 µl of template DNA, 1 µl of each primer (10 µM) and 7.5 µl of nuclease free water to a final volume of 25 µl. The cycling conditions and sequence of each primer are given in Table 2. The PCR products were separated alongside a 1 kbp ladder (GeneRuler 1 kb Plus DNA Ladder Thermo scientific SM1331) using gel electrophoresis in a 1 % agarose gel in TAE buffer stained with GelRed® nucleic acid stain (Sigma Aldrich). Gels were visualised with a UV transilluminator (BioRad) to confirm successful amplification.
Table 2: The ITS (ITS1 and ITS4) and TEF1α (1018F, 1620R, EF1 and EF2) primer sequences and PCR conditions.
|
Primer |
Sequence (5’-3’) |
Initial Melt |
Melt |
Anneal |
Extension |
Final extension |
|
|
ITS1: ITS4: (Raja et al., 2017) |
CGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC |
94 °C 5 min |
94°C 30 sec |
55 °C 1 min |
72 °C 2 min |
72 °C 7 min |
|
|
35 cycles |
|||||||
|
1018F: 1620R: (O’Donnell et al., 1998; Raja et al., 2017) |
GAYTTCATCAAGAACATGAT GACGTTGAADCCRACRTTGTC |
94 °C 5 min
|
94 °C 30 sec |
Touch down 66-56 °C 1 min
|
72 °C 1 min |
72 °C 10 min |
|
|
9 cycles |
|||||||
|
94 °C 30 sec |
56 °C 1 min
|
72 °C 1 min |
|||||
|
Remaining 26 cycles |
|||||||
|
EF1: EF2: (O’Donnell et al., 1998) (Raja et al., 2017) |
ATGGGTAAGGARGACAAGAC GGARGTACCAGT SATCATGTT
|
95 °C 2 min |
95 °C 30 sec |
54.1 °C 1 min |
72 °C 1 min |
72 °C 5 min |
|
|
35 cycles |
|||||||
Prior to sequencing, the PCR products were purified using solid-phase reversible immobilisation (SPRI) magnetic beads. To each PCR product, 1 X SPRI beads were added at a 1:2 ratio of PCR product to bead solution (50 µl PCR product to 100 µl SPRI beads) and the mixture incubated for 5 min at room temperature. The tubes were transferred to the magnetic plate for 5 min until the solution was clear, at which point the supernatant was discarded and the beads were washed twice with 80% ethanol for 60 s each time. Ethanol was removed and the beads held on the magnetic plate were allowed to dry for 5-10 min at room temperature. The tubes containing the dry beads were removed from the magnetic plate, and 50 µl of molecular grade nuclease free water was added to each tube, mixed and incubated for 5 min, allowing the DNA to elute. The tubes were placed back on the magnetic plate for 5 min until the solution was clear, at which point the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Sanger sequencing was carried out using ITS1, ITS4 primers and EF1, EF2 primers. All sequencing was carried out by Eurofins Genomics.
Following sequencing, the chromatograms obtained were trimmed and analysed using Geneious Prime (version 2023.0.4). First, low-quality bases (e.g., overlapping peaks) were trimmed from each end and the sequence upstream from that site, including the primer sequence, was deleted. The forward and reverse sequence for each sample were assembled using the de novo assemble function in Geneious at the highest sensitivity to create a consensus sequence (highest threshold quality: 60%). A basic local alignment search tool (BLAST) search was carried out for the consensus sequences using the NCBI-NR database for the ITS sequences, and, for the TEF1α sequences, the data available on the Fusarium ID database (Torres-Cruz et al., 2022). All of the TEF1α consensus sequences from all samples were subsequently aligned with the available sequences on the Fusarium ID database (Geneious global alignment with free end gaps, 65% similarity), and a phylogenetic tree was generated (genetic distance model Tamura-Nei, neighbour joining method, bootstrap with 100 replicates).
Files
Files
(32.5 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:7da73d0410fad4b25da2b58041545694
|
5.9 kB | Download |
|
md5:6ae1a1157e2ff6c04922d5395e926633
|
13.4 kB | Download |
|
md5:1e6a85d79c972e5db6f603745edc8ef8
|
13.2 kB | Download |
Additional details
Dates
- Created
-
2024-10-18