Genomic sequencing of the holotype of Jemadia demarmelsi Orellana, [2010] (type locality in Venezuela: Bolívar) in the MIZA collection reveals that in genomic trees it is placed in its own clade of similar prominence to J. pseudognetus and J. hospita (Fig. 1), and its COI barcode differs by 4.3% (28 bp) and 3.0% (20 bp) from these species, respectively. Therefore, we confirm the close relationship of J. demarmelsi with these two species and its distinctness from them at the species level. Moreover, sequencing of a female specimen from Bolívar, Venezuela (NVG-20054H05, Fig. 2) with very large forewing hyaline spots that are similar to J. demarmelsi holotype establishes it as a female of J. demarmelsi due to genetic similarities (Fig. 1, COI barcodes 100% identical). Interestingly, the coloration of the bands in the female is cyan-blue, not purplish, as in the male holotype. The COI barcode sequence of the holotype of J. demarmelsi, sample NVG-22029C06, GenBank accession OR178493, 658 base pairs is:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGATTATTAATTCGAACTGAGCTAGGAATTCCAGGATCTTTAATCGGA GATGATCAAATCTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTTCTTTGACCCTGCTTATTTCAAGCAG TATTGTAGAAAATGGTGCTGGTACTGGTTGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCCCACCAAGGAGCCTCTGTAGATATAGCTATTTTTTCT TTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATCAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCAT TATTTGTTTGAGCAGTTGGAATTACAGCATTACTTTTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATATTAA TACCTCTTTCTTTGACCCTGCTGGAGGTGGGGATCCTATTTTATATCAACATTTATTT