THANK YOU for using IMGT/GENE-DB |
![]() |
IMGT®, the international ImMunoGeneTics information system® | http://www.imgt.org |
Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005).
PMID: 15608191
![]() |
IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates
The FASTA header contains 15 fields separated by '|': 1. IMGT/LIGM-DB accession number(s) 2. IMGT gene and allele name 3. species 4. IMGT allele functionality 5. exon(s), region name(s), or extracted label(s) 6. start and end positions in the IMGT/LIGM-DB accession number(s) 7. number of nucleotides in the IMGT/LIGM-DB accession number(s) 8. codon start, or 'NR' (not relevant) for non coding labels 9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB 10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB 11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors 12. number of amino acids (AA): this field indicates that the sequence is in amino acids 13. number of characters in the sequence: nt (or AA)+IMGT gaps=total 14. partial (if it is) 15. reverse complementary (if it is)
>K02545|TRBJ1-1*01|Homo sapiens|F|J-REGION|749..796|48 nt|3| | | | |48+0=48| | | tgaacactgaagctttctttggacaaggcaccagactcacagttgtag >K02545|TRBJ1-2*01|Homo sapiens|F|J-REGION|886..933|48 nt|3| | | | |48+0=48| | | ctaactatggctacaccttcggttcggggaccaggttaaccgttgtag >M14158|TRBJ1-3*01|Homo sapiens|F|J-REGION|1499..1548|50 nt|2| | | | |50+0=50| | | ctctggaaacaccatatattttggagagggaagttggctcactgttgtag >M14158|TRBJ1-4*01|Homo sapiens|F|J-REGION|2095..2145|51 nt|3| | | | |51+0=51| | | caactaatgaaaaactgttttttggcagtggaacccagctctctgtcttgg >M14158|TRBJ1-5*01|Homo sapiens|F|J-REGION|2368..2417|50 nt|2| | | | |50+0=50| | | tagcaatcagccccagcattttggtgatgggactcgactctccatcctag >M14158|TRBJ1-6*01|Homo sapiens|F|J-REGION|2859..2911|53 nt|2| | | | |53+0=53| | | ctcctataattcacccctccactttgggaatgggaccaggctcactgtgacag >L36092|TRBJ1-6*02|Homo sapiens|F|J-REGION|643043..643095|53 nt|2| | | | |53+0=53| | | ctcctataattcacccctccactttgggaacgggaccaggctcactgtgacag >X02987|TRBJ2-1*01|Homo sapiens|F|J-REGION|800..849|50 nt|2| | | | |50+0=50| | | ctcctacaatgagcagttcttcgggccagggacacggctcaccgtgctag >X02987|TRBJ2-2*01|Homo sapiens|F|J-REGION|995..1045|51 nt|3| | | | |51+0=51| | | cgaacaccggggagctgttttttggagaaggctctaggctgaccgtactgg >X02987|TRBJ2-2P*01|Homo sapiens|ORF|J-REGION|1132..1177|46 nt|1| | || |46+0=46| | | ctgagaggcgctgctgggcgtctgggcggaggactcctggttctgg >X02987|TRBJ2-3*01|Homo sapiens|F|J-REGION|1282..1330|49 nt|1| | | | |49+0=49| | | agcacagatacgcagtattttggcccaggcacccggctgacagtgctcg >X02987|TRBJ2-4*01|Homo sapiens|F|J-REGION|1432..1481|50 nt|2| | | | |50+0=50| | | agccaaaaacattcagtacttcggcgccgggacccggctctcagtgctgg >X02987|TRBJ2-5*01|Homo sapiens|F|J-REGION|1553..1600|48 nt|3| | | | |48+0=48| | | accaagagacccagtacttcgggccaggcacgcggctcctggtgctcg >X02987|TRBJ2-6*01|Homo sapiens|F|J-REGION|1673..1725|53 nt|2| | | | |53+0=53| | | ctctggggccaacgtcctgactttcggggccggcagcaggctgaccgtgctgg >M14159|TRBJ2-7*01|Homo sapiens|F|J-REGION|2316..2362|47 nt|2| | | | |47+0=47| | | ctcctacgagcagtacttcgggccgggcaccaggctcacggtcacag >X02987|TRBJ2-7*02|Homo sapiens|ORF|J-REGION|1890..1936|47 nt|2| | | | |47+0=47| | | ctcctacgagcagtacgtcgggccgggcaccaggctcacggtcacag
© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT