THANK YOU
for using IMGT/GENE-DB
IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org

Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005). PMID: 15608191 pdf

IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates

IMGT/GENE-DB reference sequences in FASTA format:

Nucleotide sequences for F+ORF+all P alleles


The FASTA header contains 15 fields separated by '|':

1. IMGT/LIGM-DB accession number(s)
2. IMGT gene and allele name
3. species
4. IMGT allele functionality
5. exon(s), region name(s), or extracted label(s)
6. start and end positions in the IMGT/LIGM-DB accession number(s)
7. number of nucleotides in the IMGT/LIGM-DB accession number(s)
8. codon start, or 'NR' (not relevant) for non coding labels
9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB
10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB
11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors
12. number of amino acids (AA): this field indicates that the sequence is in amino acids
13. number of characters in the sequence: nt (or AA)+IMGT gaps=total
14. partial (if it is)
15. reverse complementary (if it is)

Number of results = 10
>X04457|IGLJ1*01|Homo sapiens|F|J-REGION|30..67|38 nt|2| | | | |38+0=38| | |
ttatgtcttcggaactgggaccaaggtcaccgtcctag
>M15641|IGLJ2*01|Homo sapiens|F|J-REGION|29..66|38 nt|2| | | | |38+0=38| | |
tgtggtattcggcggagggaccaagctgaccgtcctag
>M15642|IGLJ3*01|Homo sapiens|F|J-REGION|29..66|38 nt|2| | | | |38+0=38| | |
tgtggtattcggcggagggaccaagctgaccgtcctag
>D87023|IGLJ3*02|Homo sapiens|F|J-REGION|30587..30624|38 nt|2| | | | |38+0=38| | |
ttgggtgttcggcggagggaccaagctgaccgtcctag
>X51755|IGLJ4*01|Homo sapiens|ORF|J-REGION|19209..19246|38 nt|2| | | | |38+0=38| | |
ttttgtatttggtggaggaacccagctgatcattttag
>X51755|IGLJ5*01|Homo sapiens|ORF|J-REGION|22918..22955|38 nt|2| | | | |38+0=38| | |
ctgggtgtttggtgaggggaccgagctgaccgtcctag
>D87017|IGLJ5*02|Homo sapiens|ORF|J-REGION|11386..11423|38 nt|2| | | | |38+0=38| | |
ctgggtgtttggtgaggggacggagctgaccgtcctag
>M18338|IGLJ6*01|Homo sapiens|F|J-REGION|30..67|38 nt|2| | | | |38+0=38| | |
taatgtgttcggcagtggcaccaaggtgaccgtcctcg
>X51755|IGLJ7*01|Homo sapiens|F|J-REGION|30017..30054|38 nt|2| | | | |38+0=38| | |
tgctgtgttcggaggaggcacccagctgaccgtcctcg
>D87017|IGLJ7*02|Homo sapiens|F|J-REGION|18513..18550|38 nt|2| | | | |38+0=38| | |
tgctgtgttcggaggaggcacccagctgaccgccctcg


-> IMGT/GENE-DB Documentation
-> IMGT/GENE-DB Query page
-> IMGT/GENE-DB direct links
-> IMGT/GENE-DB statistics
-> IMGT/GENE-DB program versions
-> IMGT/GENE-DB data updates
logo CNRS Université de Montpellier logo UE

© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT