THANK YOU
for using IMGT/GENE-DB
IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org

Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005). PMID: 15608191 pdf

IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates

IMGT/GENE-DB reference sequences in FASTA format:

Nucleotide sequences for F+ORF+all P alleles


The FASTA header contains 15 fields separated by '|':

1. IMGT/LIGM-DB accession number(s)
2. IMGT gene and allele name
3. species
4. IMGT allele functionality
5. exon(s), region name(s), or extracted label(s)
6. start and end positions in the IMGT/LIGM-DB accession number(s)
7. number of nucleotides in the IMGT/LIGM-DB accession number(s)
8. codon start, or 'NR' (not relevant) for non coding labels
9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB
10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB
11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors
12. number of amino acids (AA): this field indicates that the sequence is in amino acids
13. number of characters in the sequence: nt (or AA)+IMGT gaps=total
14. partial (if it is)
15. reverse complementary (if it is)

Number of results = 9
>J00242|IGKJ1*01|Homo sapiens|F|J-REGION|251..288|38 nt|2| | | | |38+0=38| | |
gtggacgttcggccaagggaccaaggtggaaatcaaac
>J00242|IGKJ2*01|Homo sapiens|F|J-REGION|612..650|39 nt|3| | | | |39+0=39| | |
tgtacacttttggccaggggaccaagctggagatcaaac
>Z70260|IGKJ2*02|Homo sapiens|(F)|J-REGION|288..325,c|38 nt|2| |1|| |38+0=38| | |
gtgcacttttggccaggggaccaagctggagatcaaac
>U95246|IGKJ2*03|Homo sapiens|(F)|J-REGION|281..319,c|39 nt|3| |1| | |39+0=39| | |
tgtacagttttggccaggggaccaagctggagatcaaac
>Z46620|IGKJ2*04|Homo sapiens|(F)|J-REGION|302..340,c|39 nt|3| |1|| |39+0=39| | |
tgtgcagttttggccaggggaccaagctggagatcaaac
>J00242|IGKJ3*01|Homo sapiens|F|J-REGION|918..955|38 nt|2| | | | |38+0=38| | |
attcactttcggccctgggaccaaagtggatatcaaac
>J00242|IGKJ4*01|Homo sapiens|F|J-REGION|1260..1297|38 nt|2| | | | |38+0=38| | |
gctcactttcggcggagggaccaaggtggagatcaaac
>AF103571|IGKJ4*02|Homo sapiens|(F)|J-REGION|270..307,c|38 nt|2| |1| | |38+0=38| | |
gctcacgttcggcggagggaccaaggtggagatcaaac
>J00242|IGKJ5*01|Homo sapiens|F|J-REGION|1575..1612|38 nt|2| | | | |38+0=38| | |
gatcaccttcggccaagggacacgactggagattaaac


-> IMGT/GENE-DB Documentation
-> IMGT/GENE-DB Query page
-> IMGT/GENE-DB direct links
-> IMGT/GENE-DB statistics
-> IMGT/GENE-DB program versions
-> IMGT/GENE-DB data updates
logo CNRS Université de Montpellier logo UE

© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT