THANK YOU
for using IMGT/GENE-DB
IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org

Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005). PMID: 15608191 pdf

IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates

IMGT/GENE-DB reference sequences in FASTA format:

Nucleotide sequences for IMGT alleles


The FASTA header contains 15 fields separated by '|':

1. IMGT/LIGM-DB accession number(s)
2. IMGT gene and allele name
3. species
4. IMGT allele functionality
5. exon(s), region name(s), or extracted label(s)
6. start and end positions in the IMGT/LIGM-DB accession number(s)
7. number of nucleotides in the IMGT/LIGM-DB accession number(s)
8. codon start, or 'NR' (not relevant) for non coding labels
9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB
10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB
11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors
12. number of amino acids (AA): this field indicates that the sequence is in amino acids
13. number of characters in the sequence: nt (or AA)+IMGT gaps=total
14. partial (if it is)
15. reverse complementary (if it is)

Number of results = 1
>M22148+M22149+M22150|TRDC*01|Homo sapiens|F|EX1+EX2+EX3| |466 nt|1|+1| | | |466+0=466| | |
ngaagtcagcctcataccaaaccatccgtttttgtcatgaaaaatggaacaaatgtcgct
tgtctggtgaaggaattctaccccaaggatataagaataaatctcgtgtcatccaagaag
ataacagagtttgatcctgctattgtcatctctcccagtgggaagtacaatgctgtcaag
cttggtaaatatgaagattcaaattcagtgacatgttcagttcaacacgacaataaaact
gtgcactccactgactttgaagtgaagacagattctacagatcacgtaaaaccaaaggaa
actgaaaacacaaagcaaccttcaaagagctgccataaacccaaagccatagttcatacc
gagaaggtgaacatgatgtccctcacagtgcttgggctacgaatgctgtttgcaaagact
gttgccgtcaattttctcttgactgccaagttatttttcttgtaag


-> IMGT/GENE-DB Documentation
-> IMGT/GENE-DB Query page
-> IMGT/GENE-DB direct links
-> IMGT/GENE-DB statistics
-> IMGT/GENE-DB program versions
-> IMGT/GENE-DB data updates
logo CNRS Université de Montpellier logo UE

© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT