THANK YOU for using IMGT/GENE-DB |
![]() |
IMGT®, the international ImMunoGeneTics information system® | http://www.imgt.org |
Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005).
PMID: 15608191
![]() |
IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates
The FASTA header contains 15 fields separated by '|': 1. IMGT/LIGM-DB accession number(s) 2. IMGT gene and allele name 3. species 4. IMGT allele functionality 5. exon(s), region name(s), or extracted label(s) 6. start and end positions in the IMGT/LIGM-DB accession number(s) 7. number of nucleotides in the IMGT/LIGM-DB accession number(s) 8. codon start, or 'NR' (not relevant) for non coding labels 9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB 10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB 11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors 12. number of amino acids (AA): this field indicates that the sequence is in amino acids 13. number of characters in the sequence: nt (or AA)+IMGT gaps=total 14. partial (if it is) 15. reverse complementary (if it is)
>X04457|IGLJ1*01|Homo sapiens|F|J-REGION|30..67|38 nt|2| | | | |38+0=38| | | ttatgtcttcggaactgggaccaaggtcaccgtcctag >M15641|IGLJ2*01|Homo sapiens|F|J-REGION|29..66|38 nt|2| | | | |38+0=38| | | tgtggtattcggcggagggaccaagctgaccgtcctag >M15642|IGLJ3*01|Homo sapiens|F|J-REGION|29..66|38 nt|2| | | | |38+0=38| | | tgtggtattcggcggagggaccaagctgaccgtcctag >D87023|IGLJ3*02|Homo sapiens|F|J-REGION|30587..30624|38 nt|2| | | | |38+0=38| | | ttgggtgttcggcggagggaccaagctgaccgtcctag >X51755|IGLJ4*01|Homo sapiens|ORF|J-REGION|19209..19246|38 nt|2| | | | |38+0=38| | | ttttgtatttggtggaggaacccagctgatcattttag >X51755|IGLJ5*01|Homo sapiens|ORF|J-REGION|22918..22955|38 nt|2| | | | |38+0=38| | | ctgggtgtttggtgaggggaccgagctgaccgtcctag >D87017|IGLJ5*02|Homo sapiens|ORF|J-REGION|11386..11423|38 nt|2| | | | |38+0=38| | | ctgggtgtttggtgaggggacggagctgaccgtcctag >M18338|IGLJ6*01|Homo sapiens|F|J-REGION|30..67|38 nt|2| | | | |38+0=38| | | taatgtgttcggcagtggcaccaaggtgaccgtcctcg >X51755|IGLJ7*01|Homo sapiens|F|J-REGION|30017..30054|38 nt|2| | | | |38+0=38| | | tgctgtgttcggaggaggcacccagctgaccgtcctcg >D87017|IGLJ7*02|Homo sapiens|F|J-REGION|18513..18550|38 nt|2| | | | |38+0=38| | | tgctgtgttcggaggaggcacccagctgaccgccctcg
© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT