THANK YOU for using IMGT/GENE-DB |
![]() |
IMGT®, the international ImMunoGeneTics information system® | http://www.imgt.org |
Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005).
PMID: 15608191
![]() |
IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates
The FASTA header contains 15 fields separated by '|': 1. IMGT/LIGM-DB accession number(s) 2. IMGT gene and allele name 3. species 4. IMGT allele functionality 5. exon(s), region name(s), or extracted label(s) 6. start and end positions in the IMGT/LIGM-DB accession number(s) 7. number of nucleotides in the IMGT/LIGM-DB accession number(s) 8. codon start, or 'NR' (not relevant) for non coding labels 9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB 10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB 11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors 12. number of amino acids (AA): this field indicates that the sequence is in amino acids 13. number of characters in the sequence: nt (or AA)+IMGT gaps=total 14. partial (if it is) 15. reverse complementary (if it is)
>X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| | | ggtacaactggaacgac >X13972|IGHD1-14*01|Homo sapiens|ORF|D-REGION|14518..14534|17 nt|1| | | | |17+0=17| | | ggtataaccggaaccac >X97051|IGHD1-20*01|Homo sapiens|F|D-REGION|62015..62031|17 nt|1| | | | |17+0=17| | | ggtataactggaacgac >X97051|IGHD1-26*01|Homo sapiens|F|D-REGION|72169..72188|20 nt|1| | | | |20+0=20| | | ggtatagtgggagctactac >X13972|IGHD1-7*01|Homo sapiens|F|D-REGION|5266..5282|17 nt|1| | | | |17+0=17| | | ggtataactggaactac >X55575|IGHD1/OR15-1a*01|Homo sapiens|ORF|D-REGION|63..79|17 nt|1| | | | |17+0=17| | | ggtataactggaacaac >X55576|IGHD1/OR15-1b*01|Homo sapiens|ORF|D-REGION|63..79|17 nt|1| | | | |17+0=17| | | ggtataactggaacaac >J00234|IGHD2-15*01|Homo sapiens|F|D-REGION|29..59|31 nt|1| | || |31+0=31| | | aggatattgtagtggtggtagctgctactcc >J00232|IGHD2-2*01|Homo sapiens|F|D-REGION|29..59|31 nt|1| | || |31+0=31| | | aggatattgtagtagtaccagctgctatgcc >X97051|IGHD2-2*02|Homo sapiens|F|D-REGION|36367..36397|31 nt|1| | | | |31+0=31| | | aggatattgtagtagtaccagctgctatacc >M35648|IGHD2-2*03|Homo sapiens|F|D-REGION|70..100|31 nt|1| | | | |31+0=31| | | tggatattgtagtagtaccagctgctatgcc >J00235|IGHD2-21*01|Homo sapiens|F|D-REGION|29..56|28 nt|1| | || |28+0=28| | | agcatattgtggtggtgattgctattcc >X97051|IGHD2-21*02|Homo sapiens|F|D-REGION|64644..64671|28 nt|1| | | | |28+0=28| | | agcatattgtggtggtgactgctattcc >X13972|IGHD2-8*01|Homo sapiens|F|D-REGION|7949..7979|31 nt|1| | | | |31+0=31| | | aggatattgtactaatggtgtatgctatacc >J00233|IGHD2-8*02|Homo sapiens|F|D-REGION|29..59|31 nt|1| | | | |31+0=31| | | aggatattgtactggtggtgtatgctatacc >X55577|IGHD2/OR15-2a*01|Homo sapiens|ORF|D-REGION|68..98|31 nt|1| | | | |31+0=31| | | agaatattgtaatagtactactttctatgcc >X55578|IGHD2/OR15-2b*01|Homo sapiens|ORF|D-REGION|68..98|31 nt|1| | | | |31+0=31| | | agaatattgtaatagtactactttctatgcc >X13972|IGHD3-10*01|Homo sapiens|F|D-REGION|10659..10689|31 nt|1| | | | |31+0=31| | | gtattactatggttcggggagttattataac >X93615|IGHD3-10*02|Homo sapiens|F|D-REGION|30..59|30 nt|1| | || |30+0=30| | | gtattactatgttcggggagttattataac >X93614|IGHD3-16*01|Homo sapiens|F|D-REGION|30..66|37 nt|1| | | | |37+0=37| | | gtattatgattacgtttgggggagttatgcttatacc >X97051|IGHD3-16*02|Homo sapiens|F|D-REGION|57552..57588|37 nt|1| | | | |37+0=37| | | gtattatgattacgtttgggggagttatcgttatacc >X93616|IGHD3-22*01|Homo sapiens|F|D-REGION|30..60|31 nt|1| | | | |31+0=31| | | gtattactatgatagtagtggttattactac >X13972|IGHD3-3*01|Homo sapiens|F|D-REGION|804..834|31 nt|1| | | | |31+0=31| | | gtattacgatttttggagtggttattatacc >X93618|IGHD3-3*02|Homo sapiens|F|D-REGION|30..60|31 nt|1| | | | |31+0=31| | | gtattagcatttttggagtggttattatacc >X13972|IGHD3-9*01|Homo sapiens|F|D-REGION|10475..10505|31 nt|1| | | | |31+0=31| | | gtattacgatattttgactggttattataac >X55579|IGHD3/OR15-3a*01|Homo sapiens|ORF|D-REGION|210..240|31 nt|1| | | | |31+0=31| | | gtattatgatttttggactggttattatacc >X55580|IGHD3/OR15-3b*01|Homo sapiens|ORF|D-REGION|210..240|31 nt|1| | | | |31+0=31| | | gtattatgatttttggactggttattatacc >X13972|IGHD4-11*01|Homo sapiens|ORF|D-REGION|11550..11565|16 nt|1| | | | |16+0=16| | | tgactacagtaactac >X97051|IGHD4-17*01|Homo sapiens|F|D-REGION|58699..58714|16 nt|1| | | | |16+0=16| | | tgactacggtgactac >X97051|IGHD4-23*01|Homo sapiens|ORF|D-REGION|68334..68352|19 nt|1| | | | |19+0=19| | | tgactacggtggtaactcc >X13972|IGHD4-4*01|Homo sapiens|F|D-REGION|1952..1967|16 nt|1| | | | |16+0=16| | | tgactacagtaactac >X55581|IGHD4/OR15-4a*01|Homo sapiens|ORF|D-REGION|83..101|19 nt|1| | | | |19+0=19| | | tgactatggtgctaactac >X55582|IGHD4/OR15-4b*01|Homo sapiens|ORF|D-REGION|82..100|19 nt|1| | | | |19+0=19| | | tgactatggtgctaactac >X13972|IGHD5-12*01|Homo sapiens|F|D-REGION|12506..12528|23 nt|1| | | | |23+0=23| | | gtggatatagtggctacgattac >X97051|IGHD5-18*01|Homo sapiens|F|D-REGION|59661..59680|20 nt|1| | | | |20+0=20| | | gtggatacagctatggttac >X97051|IGHD5-24*01|Homo sapiens|ORF|D-REGION|69300..69319|20 nt|1| | | | |20+0=20| | | gtagagatggctacaattac >X13972|IGHD5-5*01|Homo sapiens|F|D-REGION|2913..2932|20 nt|1| | | | |20+0=20| | | gtggatacagctatggttac >X55583|IGHD5/OR15-5a*01|Homo sapiens|ORF|D-REGION|94..116|23 nt|1| | | | |23+0=23| | | gtggatatagtgtctacgattac >X55584|IGHD5/OR15-5b*01|Homo sapiens|ORF|D-REGION|94..116|23 nt|1| | | | |23+0=23| | | gtggatatagtgtctacgattac >X13972|IGHD6-13*01|Homo sapiens|F|D-REGION|14011..14031|21 nt|1| | | | |21+0=21| | | gggtatagcagcagctggtac >X97051|IGHD6-19*01|Homo sapiens|F|D-REGION|61503..61523|21 nt|1| | | | |21+0=21| | | gggtatagcagtggctggtac >X97051|IGHD6-25*01|Homo sapiens|F|D-REGION|71666..71683|18 nt|1| | | | |18+0=18| | | gggtatagcagcggctac >X13972|IGHD6-6*01|Homo sapiens|F|D-REGION|4762..4779|18 nt|1| | | | |18+0=18| | | gagtatagcagctcgtcc >J00256|IGHD7-27*01|Homo sapiens|F|D-REGION|621..631|11 nt|1| | | | |11+0=11| | | ctaactgggga
© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT