THANK YOU for using IMGT/GENE-DB |
![]() |
IMGT®, the international ImMunoGeneTics information system® | http://www.imgt.org |
Citing IMGT/GENE-DB: Giudicelli, V. et al. Nucleic Acids Res., 33: D256 - D261 (2005).
PMID: 15608191
![]() |
IMGT/GENE-DB program version: 3.1.33 (22 March 2021)
IMGT/GENE-DB data updates
The FASTA header contains 15 fields separated by '|': 1. IMGT/LIGM-DB accession number(s) 2. IMGT gene and allele name 3. species 4. IMGT allele functionality 5. exon(s), region name(s), or extracted label(s) 6. start and end positions in the IMGT/LIGM-DB accession number(s) 7. number of nucleotides in the IMGT/LIGM-DB accession number(s) 8. codon start, or 'NR' (not relevant) for non coding labels 9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB 10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB 11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors 12. number of amino acids (AA): this field indicates that the sequence is in amino acids 13. number of characters in the sequence: nt (or AA)+IMGT gaps=total 14. partial (if it is) 15. reverse complementary (if it is)
>M22148+M22149+M22150|TRDC*01|Homo sapiens|F|EX1+EX2+EX3| |466 nt|1|+1| | | |466+0=466| | | ngaagtcagcctcataccaaaccatccgtttttgtcatgaaaaatggaacaaatgtcgct tgtctggtgaaggaattctaccccaaggatataagaataaatctcgtgtcatccaagaag ataacagagtttgatcctgctattgtcatctctcccagtgggaagtacaatgctgtcaag cttggtaaatatgaagattcaaattcagtgacatgttcagttcaacacgacaataaaact gtgcactccactgactttgaagtgaagacagattctacagatcacgtaaaaccaaaggaa actgaaaacacaaagcaaccttcaaagagctgccataaacccaaagccatagttcatacc gagaaggtgaacatgatgtccctcacagtgcttgggctacgaatgctgtttgcaaagact gttgccgtcaattttctcttgactgccaagttatttttcttgtaag
© Copyright 1995-2021 IMGT®, the international ImMunoGeneTics information system® | Terms of use | About us | Contact us | Citing IMGT