This NematodesEAPreadme.txt file was generated on 2021-09-16 by Gabriella Panto'

GENERAL INFORMATION

1. Title of Dataset: Nematodes community composition and environmental parameters, Eastern Antarctic Peninsula 

2. Author Information

	A. Principal Investigator Contact Information
		Name: Gabriella Panto'
		Institution: University of Gent 
		Address: Krijgslaan 281, Building S8, Ghent, Belgium
		Email: Gabriella.Panto@UGent.be 

	B. Associate or Co-investigator Contact Information
		Name: Francesca Pasotti 
		Institution: University of Gent 
		Address: Krijgslaan 281, Building S8, Ghent, Belgium
		Email: Francesca.Pasotti@UGent.be

	C. Associate or Co-investigator Contact Information
		Name: Lara Macheriotou
		Institution: University of Gent 
		Address: Krijgslaan 281, Building S8, Ghent, Belgium
		Email: Lara.Macheriotou@UGent.be

        D. Associate or Co-investigator Contact Information
		Name: Ann Vanreusel
		Institution: University of Gent 
		Address: Krijgslaan 281, Building S8, Ghent, Belgium
		Email: Ann.Vanreusel@UGent.be

3. Date of data collection (single date, range, approximate date) : February/March 2018

4. Geographic location of data collection: Prince Gustav Channel (PGC) and Duse Bay (DB) in the Eastern Antarctic Peninsula (EAP)

5. Information about funding sources that supported the collection of the data: The environmental and molecular research was carried out with infrastructure funded by EMBRC Belgium (FWO project GOH3817N).


DATA & FILE OVERVIEW

1. File List: 

Environmental_parameters.xlsx: contains the list of all the environmental parameters analyzed in the study, date, event, location and depth at which they were recorded. The files also contains their unit and from which layer of sediment core they were extracted.
Meiofauna_Count_ID.xlsx: contains i) metadata of the samples collection during the cruise; ii) the count of meiofauna extracted from sediment cores (total and Nematoda); iii) the list of meiofauna taxa identified per layer, replicate and location/depth
Metabarcoding_Nematodes.xlsx: file contains the DNA sequences extracted during the metabarcoding analysis. Values indicate the number of unique sequences recorded per station, layer and replicate. 


METHODOLOGICAL INFORMATION

1. Description of methods used for collection/generation of data: detailed methodologies are described in: Pantó G., Pasotti F., Macheriotou L. and Vanreusel A. (2021). Combining Traditional Taxonomy and Metabarcoding: Assemblage Structure of Nematodes in the Shelf Sediments of the Eastern Antarctic Peninsula. Front. Mar. Sci. 8:629706. doi: 10.3389/fmars.2021.629706 

Sediment samples were collected using a 12-core Multicorer (MUC) type Oktopus, each core having an inner diameter of 10 cm. For each core, the sediment was divided in equal horizontal slices of 2 cm, down to 8 cm depth. In turn, each slice was equally divided in two subsamples and preserved in different conditions according to the prospected analysis. 
Specifically, the first half was stored in a 250 mL container and fixed with 4% formaldehyde (buffered with pre-filtered seawater) for morphological meiofauna community analysis (density, biodiversity). The second half was placed in plastic bags and frozen at -80 °C for molecular analysis of meiofauna (i.e. metabarcoding) and for the examination of environmental variables (pigments, organic matter, sediment grain size).

2. Methods for processing the data: 

Environmental parameters: the concentration of individual pigments was calculated using the response factor of standard pigments (Van Heukelem and Thomas, 2001) and TOC and TN contents were measured using Flash 2000 NC Sediment Analyser from Interscience. Grain size was estimated using the Mastersizer Hydro 2000G (MALVERN) particle size analyser: 
the measurable particle range size is between 0.01 µm - 2000 µm in171 volume percent. Grain size distributions were evaluated with the Mastersizer 2000 5.4 program.

Meiofauna: samples fixed in 4% formaldehyde were then sieved over a 1000-µm sieve on top of a 32 µm sieve. Organisms larger than 1000-µm (macrofauna) were dyed with Rose Bengal (0.5 g L−1) and stored in 4% formaldehyde for further analysis. The meiofauna fraction (between 1000 and 32 µm) was extracted by density-gradient centrifugation with the colloidal silica polymer LUDOX HS40, with a specific density of 1.18 g/cm3 (protocol described in Heip  et al. 1982; Vanhove et al. 1999). The resulting extracted sample was finally dyed with Rose Bengal
(0.5 g L−1) and stored in 4% formaldehyde. The meiofauna was counted at the stereomicroscope. The counting of the most abundant taxon (Nematoda) was performed with the use of an eight-chambered meiofauna sample-splitter (Jensen, 1982). Organisms were initially identified to higher taxon level (genus for Nematodes), and results were standardized to individuals per 10 cm-2. Quantification of meiofauna was performed on three replicates (A, B, C) per station.

Metabarcoding: the molecular analysis of meiofauna was performed on the entire vertical profile (0-8 cm) of all frozen samples (three to four replicates per station). Samples frozen at -80 °C were initially defrosted and meiofauna was extracted following the density-gradient centrifugation procedure using LUDOX HS40. Samples were then processed in order to extract the DNA from the extracted organisms, and stored frozen at - 20 °C. 
Using the “16S Metagenomic Sequencing Library Preparation” protocol (Amplicon, 2013) SSU_F_04- SSU/22_R primers (GCTTGTCTCAAAGATTAAGCC, TCCAAGGAAGGCAGCAGGC respectively) were assembled with Illumina overhang adapters. The above mentioned primers were used to amplify the 18S (V1-V2 region) ribosomal locus of each sample in triplicate. After purification, biological replicates were pooled and sequenced at Edinburgh Genomics on an Illumina MiSeq-v3 2x300bp paired-end read run (https://genomics.ed.ac.uk/)

3. Instrument- or software-specific information needed to interpret the data: 

All analysis were performed with the “vegan” and “ggplot2” packages on Rstudio (v 3.6.1) versions 2.5 – 5 and 3.2.1