#!/usr/bin/perl ## This program removes barcode sequences from fastq reads and places them ## in the name. This program also removes adpater sequences from the 3' end. ## Qual scores corresponding to the removed barcode and adapter are removed ## as well. The reads are separted into separate files based on species and ## enzymes (for the pines). This part of the code will not be necessary in ## most cases where each lane contains a single experiment. Sequences not ## matching any barcodes are written to a separate file (miderrors.txt). ## This now includes a function for correcting barcodes that are off. ## zg 4ix11 - This is a new version that will work with 8, 9, or 10 bp barcoes. ## cab 8nov12 -- lines are read in groups of 4, skipping the regular expression to track where we are ## cab 10nov12 -- use Levenshtein distance to find barcode correction (faster) ## cab 16dec12 -- catch instances where raw data are not in a set of four lines ## parse_barcodes.jan.pl barcodes_manacus1.csv rawreads_flowcell1/UW_1.fastq use warnings; use Text::LevenshteinXS 'distance'; unless (scalar @ARGV > 2){ die "I need three arguments to run: barcodefile fastqfile MACHINENAME"; } my $barcodes = shift(@ARGV); my $infile = shift (@ARGV); my $devicename = shift (@ARGV); unless($devicename){ die "Please provide a machine name that appears after \@ on info lines of fastq file"; } open (INFILE, $infile) or die "You are a dummy"; open (MIDS, $barcodes) or die "Could not open MID file"; my %mids; my %midsctr; ; ## get rid of top line in MIDS file while(){ chomp; @line = split ',', $_; $line[1] =~ tr/[a-z]/[A-Z]/; ## catch lower-case barcode input and make it uppercase $bcode = "$line[1]"."CAATTC"; # add restriction site, not necessary if barcode + res. site is included $mids{$bcode} = $line[2]; $midsctr{$bcode} = 0; ## initialize counters to zero } close (MIDS) or die "Could not close MIDS\n"; @barcodes = sort keys %mids; $infile =~ s/.*\/([\w.]+fq)$/$1/; ## simplify file name by ## dropping leading folder name $infile =~ s/.*\/([\w.]+fa)$/$1/; $infile =~ s/.*\/([\w.]+fastq)$/$1/; open (SEQ, "> parsed_"."$infile") or die "Could not open SEQ\n"; open (CRAP, "> miderrors_"."$infile") or die "Could not open CRAP\n"; my $getit = 0; my $mseprob = 0; my $seqcnt = 0; my $goodmid = 0; my $goodmidctr = 0; my $badmidctr = 0; my $adlen; my $adrem = 0; my @ad; my $bclen = 16; # 10 bc and 6 res. site my $qline; my $tooshort = 0; while (){ unless(/^\@$devicename/){ ## input file is foobarred here, with data not in sets of 4 lines print "parse error -- $seqcnt\n$_\n"; while($_ != /^\@$devicename/){ ; } print "Back on track --> $_\n"; } $seqcnt++; # if(!($seqcnt % 10000)){ # print "$seqcnt\n"; # } chomp($_ = ); if (s/(TTACAGATCGGAAGAG.*)//){ ## CTTACAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG ## potentially has Illpcr seq at end, so we lop this off ## @ad = split "", $1; $adlen = @ad; $mseprob++; } else { $adlen = 0; } $line10 = substr($_, 0, $bclen); ## substr EXPR,OFFSET,LENGTH $line9 = substr($_, 0, ($bclen - 1)); # 9 bp barcode $line8 = substr($_, 0, ($bclen - 2)); # 8 bp barcode if($mids{$line10}){ ## this is a barcode, which I have now pulled off s/^$line10//; if (/[ATCGN]/) { ## didn't remove it all, there is seq in $_ print SEQ "@"."$mids{$line10}"." -- "."$seqcnt\n"; print SEQ "$_\n"; $goodmid = 1; $goodmidctr++; $midsctr{$line10}++; } $whichL = 10; } elsif($mids{$line9}){ ## this is a barcode, which I have now pulled off s/^$line9//; if (/[ATCGN]/) { ## didn't remove it all, there is seq in $_ print SEQ "@"."$mids{$line9}"." -- "."$seqcnt\n"; print SEQ "$_\n"; $goodmid = 1; $goodmidctr++; $midsctr{$line9}++; } $whichL = 9; } elsif($mids{$line8}){ ## this is a barcode, which I have now pulled off s/^$line8//; if (/[ATCGN]/) { ## didn't remove it all, there is seq in $_ print SEQ "@"."$mids{$line8}"." -- "."$seqcnt\n"; print SEQ "$_\n"; $goodmid = 1; $goodmidctr++; $midsctr{$line8}++; } $whichL = 8; } elsif(length $line10 != $bclen){ $goodmid = 0; ## this is a special case, where don't have ## enough remainging sequence to even test ## for a mid $tooshort++; } else { ## potential mid error ($line10b, $n10) = correctmid($line10); $minN = $n10; $whichL = 10; if ($minN > 1){ ($line9b, $n9) = correctmid($line9); if ($n9 < $minN){ $minN = $n9; $whichL = 9; } if ($minN > 1){ ($line8b, $n8) = correctmid($line8); if ($n8 < $minN){ $minN = $n8; $whichL = 8; } } } if ($minN > 1){ ## can't correct print CRAP "$_\n"; $goodmid = 0; $badmidctr++; } else { ## has been corrected if ($whichL == 10){ $line = $line10b; s/$line10//; } elsif ($whichL == 9){ $line = $line9b; s/$line9//; } elsif ($whichL == 8){ $line = $line8b; s/$line8//; } if (/[ATCGN]/) { ## didn't remove it all print SEQ "@"."$mids{$line}"." -- "."$seqcnt\n"; print SEQ "$_\n"; $goodmid = 1; $goodmidctr++; $midsctr{$line}++; } else { $goodmid = 0; } } } chomp($_ = ); ### should be info line that separates seq and qual, often + if ($goodmid == 1){ print SEQ "$_\n"; } chomp($_ = ); ### quality line if ($goodmid == 1){ if ($whichL == 10){ $seqlength = (length $_) - $bclen - $adlen; $qline = substr($_, $bclen, $seqlength); } elsif ($whichL == 9){ $seqlength = (length $_) - $bclen - $adlen + 1; $qline = substr($_, ($bclen - 1), $seqlength); } elsif ($whichL == 8){ $seqlength = (length $_) - $bclen - $adlen + 2; $qline = substr($_, ($bclen - 2), $seqlength); } print SEQ "$qline\n"; $goodmid = 0; } } open(REPORT, "> parsereport_$infile") or die "Failed to open report file"; print REPORT "Good mids count: $goodmidctr\n"; print REPORT "Bad mids count: $badmidctr\n"; print REPORT "Number of seqs with potential MSE adapter in seq: $mseprob\n"; print REPORT "Seqs that were too short after removing MSE and beyond: $tooshort\n"; foreach my $k (sort keys %midsctr){ print REPORT "$k,$midsctr{$k}\n"; } close(REPORT) or die "Could not close REPORT\n"; close(SEQ) or die "Could not close SEQ\n"; close(CRAP) or die "Could not close CRAP\n"; ##--------- sub routines -----------------## sub correctmid{ my $corrected; my $min = 100; my $mindex = -1; for my $i (0 .. $#barcodes){ $dist = distance($_[0], $barcodes[$i]); if($min > $dist){ $min = $dist; $mindex = $i; } } return($barcodes[$mindex], $min); }