Published September 10, 2024
| Version v1
Dataset
Open
Table 2 in Unravelling the Molecular Identity of Bulgarian Jumping Plant Lice of the Family Aphalaridae (Hemiptera: Psylloidea)
Description
Table 2. PCR primers and conditions.
| Gene | Primer Set | Primer Sequence′ (5 ′ –3 ′) | Amplicon Size (bp) | PCR Conditions | Primer References |
|---|---|---|---|---|---|
| LCOP-F | AGAACWAAYCATAAAAYWATTGG | 654 | 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 50 ◦ C 30 s and 72 ◦ C | [54] | |
| HCO2198R C_LepFolF | TAAACTTCAGGGTGACCAAAAAATCA ATTCAACCAATCATAAAGATATTGG | 658 | for 1 min; 72 ◦ C for 10 min 94 ◦ C for 1 min, 5 cycles of 94 ◦ C for 30 s, 45–50 ◦ C for 40 s, 72 ◦ C for 1 min, 30–35 cycles of 94 ◦ C | [58] | |
| for 30 s, 51–54 ◦ C for 40 s and 72 ◦ C | |||||
| COI | C_LepFolR LCO1490F | TAAACTTCTGGATGTCCAAAAAATCA GGTCAACAAATCATAAAGATATTGG | 654 | for 1 min, 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 51 ◦ C 30 s and 72 ◦ C | [58] |
| HCO2198R VpmCOIF2 | TAAACTTCAGGGTGACCAAAAAATCA TACCTYTGAATTTGCAATTC | 646 | for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 46 ◦ C 30 s and 72 ◦ C | [59] | |
| VpmCOIR4 | AATAARTGTTGGTATAARATAGG | for 1 min; 72 ◦ C for 10 min | |||
| Cytbf | TGAGGNCAAATATCHTTYTGA | 393 | 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C | [16, 49] | |
| Cytb | Cytbr CytbnewF2 CytbnewR CytbnewF1 | GCAAATARRAARTATCATTCDG TGATTATGRGGAGGDTTYGC GTTGAATATGDATDGGDGTWAC TATGAGGAGGDTTYGCWGTTG | 330 248 | for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C for 1 min; 72 ◦ C for 10 min 95 ◦ C for 3 min; 35 cycles of 95 ◦ C for 30 s, 53 ◦ C 30 s and 72 ◦ C | This study This study |
| CytbnewR | GTTGAATATGDATDGGDGTWAC | for 1 min; 72 ◦ C for 10 min |
Notes
Published as part of Pramatarova, Monika, Burckhardt, Daniel, Malenovský, Igor, Gjonov, Ilia, Schuler, Hannes & Štarhová Serbina, Liliya, 2024, Unravelling the Molecular Identity of Bulgarian Jumping Plant Lice of the Family Aphalaridae (Hemiptera: Psylloidea), pp. 11 in Insects 15 (9) on page 11, DOI: 10.3390/insects15090683, http://zenodo.org/record/15085268
Files
Files
(3.0 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:c0a2ac9fec32fbcd31faf108a5524e7a
|
3.0 kB | Download |
System files
(11.2 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:9813b3b4355e2e237c9478a0243765bf
|
11.2 kB | Download |
Additional details
Identifiers
Related works
- Is part of
- Journal article: 10.3390/insects15090683 (DOI)
- Journal article: urn:lsid:plazi.org:pub:FFC7FFC5C9275706EC0FFFA2600E3145 (LSID)
- Journal article: http://publication.plazi.org/id/FFC7FFC5C9275706EC0FFFA2600E3145 (URL)
- Journal article: http://zenodo.org/record/15085268 (URL)
References
- 54. Bastin, S.; Percy, D. M.; Siverio, F. Establishing Reliable DNA Barcoding Primers for Jumping Plant Lice (Psylloidea, Hemiptera). BMC Res. Notes 2023, 16, 322. [CrossRef] [PubMed]
- 58. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294-299. [CrossRef]
- 59. Oettl, S.; Schlink, K. Molecular Identification of Two Vector Species, Cacopsylla melanoneura and Cacopsylla picta (Hemiptera: Psyllidae), of Apple Proliferation Disease and Further Common Psyllids of Northern Italy. J. Econ. Entomol. 2015, 108, 2174-2183. [CrossRef]
- 16. Percy, D. M.; Crampton-Platt, A.; Sveinsson, S.; Lemmon, A. R.; Lemmon, E. M.; Ouvrard, D.; Burckhardt, D. Resolving the Psyllid Tree of Life: Phylogenomic Analyses of the Superfamily Psylloidea (Hemiptera). Syst. Entomol. 2018, 43, 762-776. [CrossRef]
- 49. Timmermans, M. J. T. N.; Dodsworth, S.; Culverwell, C. L.; Bocak, L.; Ahrens, D.; Littlewood, D. T. J.; Pons, J.; Vogler, A. P. Why Barcode? High-Throughput Multiplex Sequencing of Mitochondrial Genomes for Molecular Systematics. Nucleic Acids Res. 2010, 38, e 197. [CrossRef]