Rogas shimborii Quicke & Sharkey 2025, sp. nov.
Authors/Creators
- 1. Integrative Insect Ecology Research Unit, Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
- 2. The Hymenoptera Institute, 1339 La Loma Dr., Redlands, CA, 92373, USA
- 3. Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 - 6018, USA
Description
Rogas shimborii Quicke & Sharkey sp. nov.
Type material.
Holotype. Costa Rica • ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, Pailas Dos, 10.76 ° N, 85.334 ° W, 809 m, 2. viii. 2018, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap PL 12-9); CNC (Specimen voucher: BIOUG 58035-F 04; BIN BOLD: AEF 7075). Paratype: Costa Rica • 1 ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, Pailas Dos, 10.764 ° N, 85.333 ° W, 853 m, 25. vi. 2020, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap (PL 12-6); CNC. (Specimen voucher: BIOUG 63902-A 02; BIN BOLD: AEF 707).
Diagnostics.
BOLD: AEF 7075. Consensus barcode: TTTATATTTTTTATTTGGTATTTGAGCGGGGCTTTTAGGGCTATCTATAAGGTTAATTATTCGGTTAGAATTAAGTATACCTGGGAGGTTATTAGGTAATGATCAGATTTATAATGGAATAGTAACTGCACATGCATTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATGGCTTTCCCTCGTATAAATAATATAAGATTTTGATTGTTAATTCCGTCATTAATTTTATTATTATTAAGAGCTATTGTAAATGTAGGGGTTGGTACAGGTTGAACAATTTATCCTCCTTTATCTTCTTTAATAGGGCATGGAGGGATATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATCTCTTCTATTATAGGGGTTGTAAATTTTATTTCTACAATTTTTAATATAAAGTTAATTTCTATTAGTCTAGATCAGATTAATTTATTTGTATGGTCTGTTTTAATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCGGGGGCCATTACAATATTATTAACAGATCGTAATTTAAATACAACTTTTTTTGATTTTTCAGGGGGGGGGGATCCTGTTTTATTTCAACATTTATTT
The new species may be distinguished from all other described species by its bicolorous (black and ivory-white metasoma (Fig. 1 A, B); these are reddish-yellow, ochreous-yellow or brown in R. luteus, R. oyeyamensis (Watanabe, 1937), R. roxana (Telenga, 1941), R. nigrovenosus (Vojnovskaja-Krieger, 1935), R. nigristigma Chen & He, and R. flavus Chen & He, 1997 largely uniformly black in R. nigricans Chen & He, 1997, and R. nigridorsum Belokobylskij, 1996. The infuscate median transverse band of the forewing (Fig. 2 A) is also unique to this species.
Etymology.
Named in honor of Eduardo Mitio Shimbori in recognition of his contributions to Neotropical Rogadinae systematics.
Molecular results
Analysis of the concatenated two gene data set recovers the new species nested within the Old World Rogas representatives, and as sister group to R. roxana from the Russian Far East, though with low support (Fig. 3), and far removed from Triraphis. However, the latter genus was not recovered as monophyletic and its two clades were well separated. The larger clade was entirely comprised of Meso- and South American species whereas the smaller clade largely contained Old World species but also including T. discoideus (Cresson, 1869) from North America and one species, T. robertomirandai Sharkey, 2021, from Costa Rica.
Notes
Files
Files
(3.4 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:d3bb80c93ce3874c8c402f6f8770ddae
|
3.4 kB | Download |
System files
(23.9 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:7071277ba6b5e200aa0d20c647b8aa08
|
23.9 kB | Download |
Linked records
Additional details
Identifiers
Biodiversity
- Collection code
- CNC
- Material sample ID
- BIOUG 58035-F 04 , BIOUG 63902-A 02
- Event date
- 2018-08-02 , 2020-06-25
- Verbatim event date
- 2018-08-02 , 2020-06-25
- Scientific name authorship
- Quicke & Sharkey
- Kingdom
- Animalia
- Phylum
- Arthropoda
- Order
- Hymenoptera
- Family
- Braconidae
- Genus
- Rogas
- Species
- shimborii
- Taxon rank
- species
- Taxonomic status
- sp. nov.
- Type status
- holotype , paratype
- Taxonomic concept label
- Rogas shimborii Quicke & Sharkey, 2025
References
- Watanabe C (1937) Contribution to the knowledge of braconid fauna of the Empire of Japan (Hymenoptera). Journal of the Faculty of Agriculture. Hokkaido Imperial University 42: 1-188.
- Telenga NA (1941) Family Braconidae, subfamily Braconinae (continuation) and Sigalphinae. Fauna USSR. Hymenoptera 5 (3): 1-466.
- Vojnovskaja-Krieger T (1935) Neue Braconiden-Arten aus der UdSSR. Entomologicheskoye Obozreniye 25: 304.
- Chen X, He J (1997) Revision of the subfamily Rogadinae (Hymenoptera: Braconidae) from China. Zoologische Verhandelingen Leiden 308: 1-187.
- Belokobylskij SA (1996) Contribution to the knowledge of braconid fauna of the subfamily Rogadinae (Hymenoptera, Braconidae) of Russian Far East and eastern. Part 1. Far Eastern Entomologist = Dal'nevostochnyi Entomolog 27 - 28: 1 - 12.
- Cresson ET (1869) List of the North American species of the genus Aleiodes Wesmael. Transactions of the American Entomological Society 2: 377-382. https://doi.org/10.2307/25076223
- Sharkey MJ, Janzen DH, Hallwachs W, Chapman EG, Smith MA, Dapkey T, Brown A, Ratnasigham S, Naik S, Manjunat R, Perez K, Milton M, Hebert PDN, Shaw SR, Kittel RN, Solis A, Metz M, Goldstein PZ, Brown JW, Quicke DLJ, van Achterberg C, Brown BV, Burns JM (2021) Minimalist revision and description of 411 new species in 11 subfamilies of Costa Rican braconid parasitic wasps, including host records. Zootaxa 1013: 1-665. https://doi.org/10.3897/zookeys.1013.55600