[ { "name": "SAMD00123367", "accession": "SAMD00123367", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-10T00:00:00Z", "update": "2022-04-01T01:23:20.257Z", "submitted": "2020-04-10T18:12:26.180Z", "characteristics": { "External Id": [ { "text": "SAMD00123367", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Suzuki Lab , Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo" } ], "INSDC first public": [ { "text": "2020-04-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-09T18:31:24Z" } ], "INSDC secondary accession": [ { "text": "DRS136282" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS136282" } ], "cell line": [ { "text": "H1299", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003043" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample name": [ { "text": "ATAC-seq_H1299_48h_G11_GSK1210151A (Inhibitor_BET)_0.1", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_H1299_48h_G11_GSK1210151A (Inhibitor_BET)_0.1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00123367", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-10T18:12:26.180Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00123367" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00123367{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00123367/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00123367/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00123367" } } }, { "name": "SAMD00235411", "accession": "SAMD00235411", "sraAccession": "DRS242526", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-02T00:00:00Z", "update": "2024-06-02T02:19:12.317Z", "submitted": "2022-06-02T12:05:29.100Z", "characteristics": { "External Id": [ { "text": "SAMD00235411", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Radiation Research Center for Frontier Science Facilities for Gene Technology, Research Institute for Radiation Biology and Medicine, Hiroshima University" } ], "INSDC first public": [ { "text": "2022-06-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2024-05-26T04:52:37.500Z" } ], "INSDC secondary accession": [ { "text": "DRS242526" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS242526" } ], "biomaterial provider": [ { "text": "JCRB Cell Bank", "tag": "attribute" } ], "cell line": [ { "text": "SKNO-1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "shRNA_2 against human KDM4B", "tag": "attribute" } ], "sample name": [ { "text": "SKNO1 4B sh2", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq 4B sh2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMD00235411", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-06-02T12:05:29.100Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00235411" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00235411{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00235411/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00235411/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00235411" } } }, { "name": "SAMD00316482", "accession": "SAMD00316482", "sraAccession": "DRS296884", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-21T00:00:00Z", "update": "2024-06-04T13:18:47.020Z", "submitted": "2023-04-21T12:06:08.450Z", "characteristics": { "External Id": [ { "text": "SAMD00316482", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Epigenomics Cancer Institute, Japanese Foundation of Cancer Research" } ], "INSDC first public": [ { "text": "2023-04-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2024-05-26T07:36:25.190Z" } ], "INSDC secondary accession": [ { "text": "DRS296884" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS296884" } ], "biomaterial provider": [ { "text": "Cancer Epigenomics, Cancer Institute of JFCR", "tag": "attribute" } ], "cell line": [ { "text": "MDA-MB-453", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample name": [ { "text": "ATAC_11-19_no_37", "tag": "attribute" } ], "title": [ { "text": "MB453_exp_ERa-E380Q_ATAC_11-19_no_37" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMD00316482", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-04-21T12:06:08.450Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00316482" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00316482{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00316482/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00316482/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00316482" } } }, { "name": "SAMD00324177", "accession": "SAMD00324177", "sraAccession": "DRS305450", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-19T00:00:00Z", "update": "2024-05-27T15:59:25.974Z", "submitted": "2023-05-19T13:34:24.797Z", "characteristics": { "External Id": [ { "text": "SAMD00324177", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Japanese foundation for cancer research, Cancer Institute" } ], "INSDC first public": [ { "text": "2023-05-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2024-05-19T07:51:44.453Z" } ], "INSDC secondary accession": [ { "text": "DRS305450" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS305450" } ], "biomaterial_provider": [ { "text": "Shunsuke Kitajima", "tag": "attribute" } ], "cell_line": [ { "text": "NCI-H2122", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample_name": [ { "text": "H2122 PEM 3", "tag": "attribute" } ], "title": [ { "text": "NCI-H2122 cells treated with 500nM pemetrexed for 72h 3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMD00324177", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-05-19T13:34:24.797Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00324177" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00324177{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00324177/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00324177/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00324177" } } }, { "name": "SAMD00596646", "accession": "SAMD00596646", "sraAccession": "DRS313712", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-06-30T00:00:00Z", "update": "2024-06-04T16:45:04.061Z", "submitted": "2023-06-30T15:06:27.950Z", "characteristics": { "External Id": [ { "text": "SAMD00596646", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Osaka University, Institute for Protein Research" } ], "INSDC first public": [ { "text": "2023-06-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2024-05-26T15:32:51.190Z" } ], "INSDC secondary accession": [ { "text": "DRS313712" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "DRS313712" } ], "age": [ { "text": "neonate", "tag": "attribute" } ], "biomaterial_provider": [ { "text": "ATCC", "tag": "attribute" } ], "cell_line": [ { "text": "HFF-1", "tag": "attribute" } ], "cell_subtype": [ { "text": "rep_1", "tag": "attribute" } ], "cell_type": [ { "text": "fibroblast", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "description": [ { "text": "ATACseq collected after 48 h stimulation" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "isolate": [ { "text": "normal human foreskin pooled from two individuals.", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample_name": [ { "text": "ATAC_HFF_PDL24_CON_1", "tag": "attribute" } ], "sample_type": [ { "text": "PDL24", "tag": "attribute" } ], "sex": [ { "text": "male", "tag": "attribute" } ], "tissue": [ { "text": "foreskin", "tag": "attribute" } ], "title": [ { "text": "ATAC_PDL24_CON_1" } ], "treatment": [ { "text": "2%FBS DMEM", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMD00596646", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-06-30T15:06:27.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00596646" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00596646{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00596646/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00596646/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00596646" } } }, { "name": "76585bf0-2c8a-11e6-ba59-68b599768938", "accession": "SAMEA4028888", "sraAccession": "ERS1199998", "webinSubmissionAccountId": "Webin-2", "taxId": 9606, "status": "PUBLIC", "release": "2016-09-26T11:40:29Z", "update": "2024-02-02T06:26:53.457Z", "submitted": "2016-06-08T13:19:45Z", "characteristics": { "ArrayExpress-Species": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2016-09-26T11:40:29Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2016-06-08T13:19:45Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA4028888", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SC" } ], "INSDC first public": [ { "text": "2016-09-26T11:40:29Z" } ], "INSDC last update": [ { "text": "2016-06-08T13:19:45Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS1199998" } ], "Submitter Id": [ { "text": "76585bf0-2c8a-11e6-ba59-68b599768938", "tag": "Namespace:SC" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sample description": [ { "text": "ATAC-seq library preparation from B-lymphoblastoids", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "LCL-ATAC6437612" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA4028888", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2018-12-07T06:21:13.788Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4028888" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4028888{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4028888/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4028888/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA4028888" } } }, { "name": "E-MTAB-6931:Het1A-GATA6_4d_rep1", "accession": "SAMEA4753711", "sraAccession": "ERS2573810", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-30T17:02:49Z", "update": "2024-02-06T15:46:25.365Z", "submitted": "2018-06-22T14:00:08Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2018-08-30T17:02:49Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-06-22T14:00:08Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA4753711", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UOM" } ], "INSDC first public": [ { "text": "2018-08-30T17:02:49Z" } ], "INSDC last update": [ { "text": "2018-06-22T14:00:08Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS2573810" } ], "Submitter Id": [ { "text": "E-MTAB-6931:Het1A-GATA6_4d_rep1", "tag": "Namespace:UOM" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell line": [ { "text": "Het1A", "tag": "attribute" } ], "cell type": [ { "text": "epithelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: The cells were generated by infecting cells with 2nd generation lentiviruses. The genes are under Tet-on control. 2d and 4d indicates either doxycycline induction for 2 or 4 days. Het1A, Het1A-HNF4A and Het1A-GATA6 cells were cultured in DMEM (+10% FBS and 1% PenStrep) with 100ng/mL doxycycline for 2 or 4 days. Cells were trypsinised and counted. 50000 cells were taken forward for Tn5 reaction. 50000 cells were lysed in ATAC lysis buffer and Tn5 reactions were performed as described in Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. 2013. Jason D. Buenrostro, Paul G. Giresi, Lisa C. Zaba, Howard Y. Chang and William J. Greenleaf. doi:10.1038/nmeth.2688 Libraries were constructed by amplifying transposed DNA with Illumina Nextera adapters." } ], "disease": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "genotype": [ { "text": "GATA6-tet-on", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "esophagus", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001043" ], "tag": "attribute" } ], "phenotype": [ { "text": "doxycyclin mediated overexpression of GATA6", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "Het1A-GATA6_4d_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA4753711", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T05:11:40.539Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4753711" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4753711{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4753711/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4753711/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA4753711" } } }, { "name": "E-MTAB-7035:L3.6pl_ATAC_C2", "accession": "SAMEA4799826", "sraAccession": "ERS2619744", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-18T17:02:52Z", "update": "2024-02-06T16:07:46.238Z", "submitted": "2018-07-20T14:53:24Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2018-12-18T17:02:52Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-07-20T14:53:24Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA4799826", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Section of Tumor Epigenetics, Department of General, Visceral and Pediatric Surgery, University Medical Center Gottingen, 37075 Gottingen, Germany" } ], "INSDC first public": [ { "text": "2018-12-18T17:02:52Z" } ], "INSDC last update": [ { "text": "2018-07-20T14:53:24Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS2619744" } ], "Submitter Id": [ { "text": "E-MTAB-7035:L3.6pl_ATAC_C2", "tag": "Namespace:Section of Tumor Epigenetics, Department of General, Visceral and Pediatric Surgery, University Medical Center Gottingen, 37075 Gottingen, Germany" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell line": [ { "text": "L3.6pl", "tag": "attribute" } ], "cell type": [ { "text": "epithelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: ATAC was performed following the protocol of Buenrostro et al. Briefly, 50,000 L3.6pl cells were trypsinized and washed twice with cold PBS. Then cells were re-suspended in lysis buffer (10mM Tris-HCl pH 7.5, 10mM NaCl, 3mM MgCl2, 0.1% IGEPAL CA-630) and incubated for 15 minutes at a rotating wheel at 4ºC followed by centrifugation and in re-suspended in 50 µl of transposition mix composed of 2.5µl of TDE1 (Nextera Tn5 Transposase), 25 µl TD (2x reaction buffer) in nuclease free water (Nextera DNA Library Prep Kit, FC-121-1030, Illumina). Then it was incubated at 37 degrees for 30 minutes. MinElute PCR Purification kit (Qiagen) was used for DNA extraction following the instructions of the manufacturer. ATAC libraries were made using the Nextera DNA Library Prep Kit according to Buenrostro et al. The libraries were amplified for 15 cycles in total of: 98ºC for 10 seconds, 63ºC for 30 seconds, and 72ºC for 60 seconds." } ], "disease": [ { "text": "pancreatic adenosquamous carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006732" ], "tag": "attribute" } ], "metastatic site": [ { "text": "celiac lymph node", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002508" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "pancreas", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "L3.6pl_ATAC_C2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA4799826", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T05:21:04.632Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4799826" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4799826{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4799826/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4799826/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA4799826" } } }, { "name": "E-MTAB-67141538747278:human_skin_fibr_229", "accession": "SAMEA4957855", "sraAccession": "ERS2776435", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-10T17:03:13Z", "update": "2024-02-06T17:07:08.113Z", "submitted": "2018-10-05T14:52:06Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2018-10-10T17:03:13Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-10-05T14:52:06Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA4957855", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "WELLCOME TRUST SANGER INSTITUTE" } ], "INSDC first public": [ { "text": "2018-10-10T17:03:13Z" } ], "INSDC last update": [ { "text": "2018-10-05T14:52:06Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS2776435" } ], "Submitter Id": [ { "text": "E-MTAB-67141538747278:human_skin_fibr_229", "tag": "Namespace:WELLCOME TRUST SANGER INSTITUTE" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell type": [ { "text": "fibroblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000057" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: The spleen from a C57BL/6Jax mouse was mashed by a 2-ml syringe plunger through a 70 μm cell strainer (Fisher Scientific 10788201) into 30 ml 1X DPBS (ThermoFisher 14190169) supplied with 2 mM EDTA and 0.5% (w/v) BSA (Sigma A9418). Cells were centrifuged down, supernatant was removed, and the cell pellet was briefly vortexed. 5 ml 1X RBC lysis buffer (ThermoFisher 00-4300-54) was used to resuspend the cell pellet, and the cell suspension was vortexed again, and left on bench for 5 minutes to lyse red blood cells. Then 45 ml 1X DPBS was added, and cells were centrifuged down. 30 ml 1X DPBS were used to resuspend the cell pellet. The cell suspension was passed through a Miltenyi 30 μm Pre-Separation Filter (Miltenyi 130-041-407), and the cell number was determined using C-chip counting chamber (VWR DHC-N01). All centrifugations were done at 500 g, 4 °C, 5 minutes. After tagmentation, DAPI was added at a final concentration of 1 ug/ml. Then DAPI positive nuclei were sorted into 384-well plate using BD-INFLUX sorter. The nuclei sorting was performed at the Flow Cytometry facility at the Wellcome Trust Sanger Institute. Nuclei prepration and ATAC-seq procedure are performed simultaneously, i.e. Fast-ATAC protocol was used (Corces et al. Nature Genetics, 48, 1193-1203, 2016). Briefly, 50,000 cells were pelleted down at 500 g, 4 degree for 5 minutes. Then cell pellet was resuspended in 50 ul tagmentation mix containing 33 mM Tris-acetate, pH7.8, 66 mM potassium acetate, 10 mM magnesium acetate, 16% (v/v) dimethylformamide, 0.01% digitonin, 5 ul Tn5 transposes (Nextera kit, Illumina Cat No. FC-121-1030). The tagmentation reaction was put on a thermomixer, with 37 degree for 30 minutes. Then reaction was stopped by adding 50 ul 20 mM EDTA pH 8.0. After tagmentation, DAPI was added at a final concentration of 1 ug/ml. Then DAPI positive nuclei were sorted into 384-well plate using BD-INFLUX sorter. The nuclei sorting was performed at the Flow Cytometry facility at the Wellcome Trust Sanger Institute. DNA was purified first by Qiagen minElute PCR purification kit according to the manufacturer's instruction, then by AmupureXP beads with 0.5X upper cutoff and a 1.2X lower cutoff according to manufacturer's instruction. Libraries were constructed in the Illumina Nextera DNA Library preparation kit." } ], "individual": [ { "text": "human 1", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "skin", "tag": "attribute" } ], "post analysis well quality": [ { "text": "pass", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "title": [ { "text": "human_skin_fibr_229" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA4957855", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T05:44:36.475Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4957855" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4957855{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4957855/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4957855/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA4957855" } } }, { "name": "KLF1-24_I16-1573-04-m4", "accession": "SAMEA5424632", "sraAccession": "ERS3229920", "webinSubmissionAccountId": "Webin-51607", "taxId": 9606, "status": "PUBLIC", "release": "2020-01-06T04:04:25Z", "update": "2024-02-06T19:25:19.466Z", "submitted": "2019-03-15T10:10:05Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2020-01-06T04:04:25Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2019-03-15T10:10:05Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA5424632", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ERASMUS MC" } ], "INSDC first public": [ { "text": "2020-01-06T04:04:25Z" } ], "INSDC last update": [ { "text": "2019-03-15T10:10:05Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS3229920" } ], "Submitter Id": [ { "text": "KLF1-24_I16-1573-04-m4", "tag": "Namespace:ERASMUS MC" } ], "cell type": [ { "text": "Erythroid progenitors", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000038" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "KLF1 haploinsufficiency m4 proliferating erythroblasts ATAC-seq fastq files" } ], "dev stage": [ { "text": "Adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "tissue type": [ { "text": "Peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "KLF1 haploinsufficiency m4 proliferating erythroblasts ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA5424632", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-01-29T09:48:50.482Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5424632" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5424632{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5424632/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5424632/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA5424632" } } }, { "name": "E-MTAB-7844:Caki-1_3", "accession": "SAMEA5547874", "sraAccession": "ERS3349925", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-28T04:03:11Z", "update": "2024-02-06T20:40:21.770Z", "submitted": "2019-04-03T12:06:59Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2019-06-28T04:03:11Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2019-04-03T12:06:59Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA5547874", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Novartis Institutes for Biomedical Research" } ], "INSDC first public": [ { "text": "2019-06-28T04:03:11Z" } ], "INSDC last update": [ { "text": "2019-04-03T12:06:59Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS3349925" } ], "Submitter Id": [ { "text": "E-MTAB-7844:Caki-1_3", "tag": "Namespace:Novartis Institutes for Biomedical Research" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell line": [ { "text": "Caki1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002149" ], "tag": "attribute" } ], "cell type": [ { "text": "epithelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: 150000 Cells were lysed in ATAC-lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) and immediately processed for tagmentation. Tagmentation was performed as described in Buenrostro et al. Curr Protoc. Mol. Biol., 2016 using the Illumina Nextera Tn5 Transposase. ATAC-seq libraries were amplified from the tagmentation reaction by PCR using the PPC (PCR Primer mix) from the Illumina Nextera Tn5 Transposase kit and adding barcodes from the Nextera Index Kit (24 indexes 96 samples). DNA was purified using AmpPure XP beads." } ], "disease": [ { "text": "clear cell renal carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000349" ], "tag": "attribute" } ], "genotype": [ { "text": "doxycycline inducible PAX8 knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "kidney", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "Caki-1_3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA5547874", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-06-29T02:22:56.066Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5547874" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5547874{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5547874/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA5547874/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA5547874" } } }, { "name": "E-MTAB-8676:rs411 edited 3 (SPI1 -/-)", "accession": "SAMEA6479266", "sraAccession": "ERS4243749", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-05T04:03:52Z", "update": "2024-02-07T01:57:50.333Z", "submitted": "2020-01-16T11:41:59Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2020-06-05T04:03:52Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2020-01-16T11:41:59Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA6479266", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Division of Immunology and Allergy, The Children’s Hospital of Philadelphia, Abramson Research Center" } ], "INSDC first public": [ { "text": "2020-06-05T04:03:52Z" } ], "INSDC last update": [ { "text": "2020-01-16T11:41:59Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS4243749" } ], "Submitter Id": [ { "text": "E-MTAB-8676:rs411 edited 3 (SPI1 -/-)", "tag": "Namespace:Division of Immunology and Allergy, The Children’s Hospital of Philadelphia, Abramson Research Center" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell line": [ { "text": "RS4;11", "tag": "attribute" } ], "cell type": [ { "text": "lymphoblast", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000572" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: RS4:11 cells were electroporated alone (unedited, SPI1+/+) or with CAS9 and a guide RNA sequence (GGGGGUGGAAGUCCCAGUAA) targeting exon three of SPI1 (CRISPR Knockout Pool, Synthego). Editing efficiency approached 50%. Clonal populations of mono (SPI1+/-) and biallelically edited cells (SPI1-/-) were obtained via limiting dilution and clonal expansion. Edits were confirmed via Sanger sequencing and with PU.1 immunoblots. Cell aliquots of 100,000 were washed twice and then resuspended in cold lysis buffer before being spun down. The supernatants were discarded, and then nuclei were resuspended in cold transposition reaction mix from the Illumina Tagment DNA Enzyme kit. The transposition reaction was incubated at 37°C for 45 min. Immediately following transposition, 10µl of 3M Sodium Acetate was added to the DNA which was then purified using a Qiagen MinElute Kit. Transposed DNA fragments were PCR amplified for 12 cycles using NEBNext High-Fidelity 2x PCR Master Mix(NEB) with Nextera primers (Illumina). The PCR reaction was cleaned up using AMPureXP beads (Agencourt)" } ], "developmental stage": [ { "text": "adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "disease": [ { "text": "acute lymphoblastic leukemia", "tag": "attribute" } ], "genotype": [ { "text": "SPI1 -/-", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "bone marrow", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002371" ], "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "rs411 edited 3 (SPI1 -/-)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA6479266", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-12-07T04:28:37.643Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA6479266" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA6479266{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA6479266/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA6479266/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA6479266" } } }, { "name": "E-MTAB-10302:lapatinib day 7 rep2", "accession": "SAMEA8492014", "sraAccession": "ERS6176819", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-26T12:18:59Z", "update": "2024-02-21T00:14:52.015Z", "submitted": "2021-03-31T14:56:33Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2022-09-26T12:18:59Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-26T12:18:59Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA8492014", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The University of Manchester" } ], "INSDC first public": [ { "text": "2022-09-26T12:18:59Z" } ], "INSDC last update": [ { "text": "2022-09-26T12:18:59Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS6176819" } ], "Submitter Id": [ { "text": "E-MTAB-10302:lapatinib day 7 rep2", "tag": "Namespace:The University of Manchester" } ], "broker name": [ { "text": "ArrayExpress" } ], "cell_line": [ { "text": "OE19", "tag": "attribute" } ], "cell_type": [ { "text": "epithelial cell", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "description": [ { "text": "Protocols: OE19 cells were treated with DMSO for 1 day or 500 nM lapatinib for 1, 7 or 35 days and then trypsinised and collected Omni ATAC-seq protocol: Corces, M., Trevino, A., Hamilton, E. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14, 959–962 (2017). https://doi.org/10.1038/nmeth.4396 Omni ATAC-seq protocol: Corces, M., Trevino, A., Hamilton, E. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14, 959–962 (2017). https://doi.org/10.1038/nmeth.4396" } ], "developmental stage": [ { "text": "adult", "tag": "attribute" } ], "disease": [ { "text": "esophageal adenocarcinoma", "tag": "attribute" } ], "genotype": [ { "text": "wild type genotype", "tag": "attribute" } ], "isolate": [ { "text": "not applicable", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "tag": "attribute" } ], "organism part": [ { "text": "esophagogastric junction", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "lapatinib day 7 rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA8492014", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-03-21T07:12:44.657Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8492014" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8492014{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8492014/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8492014/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA8492014" } } }, { "name": "E-MTAB-10444:Th1 1h L", "accession": "SAMEA8693437", "sraAccession": "ERS6377921", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-09T17:08:15Z", "update": "2024-02-08T20:04:33.911Z", "submitted": "2021-05-05T16:40:23Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2021-09-09T17:08:15Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2021-09-09T17:08:15Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA8693437", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Linkoping University" } ], "INSDC first public": [ { "text": "2021-09-09T17:08:15Z" } ], "INSDC last update": [ { "text": "2021-09-09T17:08:15Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS6377921" } ], "Submitter Id": [ { "text": "E-MTAB-10444:Th1 1h L", "tag": "Namespace:Linkoping University" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell type": [ { "text": "naive T cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000084" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: Naïve T-cells were isolated from peripheral blood mononuclear cells (PBMCs) by magnetic bead separation using a Naive CD4+ T Cell Isolation Kit II (Miltenyi Biotec). The PBMCs were isolated from the buffy coat fraction of human blood using phase separation over lymphoprep (Axis Shields). Stimulation towards Th1 differentiation for 0.5, 1, 2, 6 and 24h. Specifically the cells were treated with a 1/1 ratio of Dynabeads® Human T-Activator CD3/CD28 (Thermofisher), recombinant IL-2 (10 ng/ml), recombinant IL-12 (5 ng/ml) and anti-IFNG (MAB285) (5 µg/ml) (Rnd Systems) in RPMI 1640 media (Gibco). For the Progesterone treated samples: Sampels were pre-incubated with 50 µM Progesterone (P4) for 12-14h prior to experiment and then reconstituted with fresh media containing above 50 µM P4 and above mentioned TH1 stimulation reagetnts to start the reaction. Non-progeterone treated sample were pre-incubated and reconstituted in growth media without P4. DNA was extracted from 50000 cells per sample in accordance with the OMNI-ATAC-seq method. Corces et al. Nature Methods 2017 Libarary construction was carried out in accordance with the OMNI-ATAC-seq method. Corces et al. Nature Methods 2017. Illumina NEXTERA primers and sequencing adapters were used to construct the index." } ], "developmental stage": [ { "text": "adult", "tag": "attribute" } ], "disease": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "individual": [ { "text": "L", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "blood", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "stimulus": [ { "text": "Anti-CD3/CD28, IL2 and IL12", "tag": "attribute" } ], "title": [ { "text": "Th1 1h L" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA8693437", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-04-08T04:13:19.237Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8693437" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8693437{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8693437/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA8693437/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA8693437" } } }, { "name": "HPSI0214i-pelm_3 derived macrophage day 40 with salmonella and IFNg", "accession": "SAMEA103884999", "domain": "self.BioSamplesMigration", "taxId": 9606, "status": "PUBLIC", "release": "2016-09-27T23:00:00Z", "update": "2023-10-28T01:53:35.093Z", "submitted": "2018-06-06T14:06:16.182Z", "characteristics": { "SRA accession": [ { "text": "ERS1677795" } ], "age": [ { "text": "40-44", "unit": "year" } ], "cell type": [ { "text": "iPSC derived cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005740" ] } ], "description": [ { "text": "Macrophages derived from induced pluripotent stem cell HPSI0214i-pelm_3 day 40 after start of differentiation, treated with salmonella and interferon gamma." } ], "differentiation start date": [ { "text": "2015/07/03" } ], "disease state": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ] } ], "ethnicity": [ { "text": "White - White British" } ], "material": [ { "text": "cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000322" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "project": [ { "text": "HipSci" } ], "sampling date": [ { "text": "2015/08/12" } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001265" ] } ], "target cell type": [ { "text": "macrophage", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000235" ] } ], "time point": [ { "text": "day 40", "unit": "day" } ], "treatment": [ { "text": "interferon gamma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003024" ] } ] }, "relationships": [ { "source": "SAMEA103884999", "type": "derived from", "target": "SAMEA6894418" }, { "source": "SAMEG317083", "type": "has member", "target": "SAMEA103884999" } ], "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/ERS1677795", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-06T14:06:16.182Z", "organization": [ { "Name": "Wellcome Trust Sanger Institue", "URL": "http://www.sanger.ac.uk" } ], "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA103884999" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA103884999{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA103884999/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA103884999/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA103884999" } } }, { "name": "E-MTAB-6617:Sample 3", "accession": "SAMEA104717429", "sraAccession": "ERS2318812", "webinSubmissionAccountId": "Webin-24", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-31T17:03:36Z", "update": "2024-02-06T14:35:28.017Z", "submitted": "2018-03-23T15:03:15Z", "characteristics": { "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2018-08-31T17:03:36Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-03-23T15:03:15Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA104717429", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The Children’s Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2018-08-31T17:03:36Z" } ], "INSDC last update": [ { "text": "2018-03-23T15:03:15Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS2318812" } ], "Submitter Id": [ { "text": "E-MTAB-6617:Sample 3", "tag": "Namespace:The Children’s Hospital of Philadelphia" } ], "broker name": [ { "text": "ArrayExpress", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009737" ] } ], "cell type": [ { "text": "T follicular helper cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002038" ], "tag": "attribute" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "description": [ { "text": "Protocols: The following cells were sorted from human children healthy donor tonsils: naive CD4+CD45RO- T cells (Naive) and CD4+CD45RO+CD25-CXCR5hiPD1hi follicular helper CD4+ T cells (TFH). For each of the TFH and Naive libraries, 50,000 live cells were harvested. The ATAC-seq libraries were generated following a previously published protocol (Buenrostro et al., Nature Methods, 2013). The nuclei were isolated from the 50,000 cells. The isolated nuclei were treated with Tn5 Transposes from Nextera DNA Sample Preparation Kit and the transposed DNA was purified using a Qiagen MinElute Kit. The transposed DNA libraries were amplified by PCR for 12 cycles and isolated by Ampure XP beads." } ], "developmental stage": [ { "text": "juvenile stage", "tag": "attribute" } ], "disease": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "individual": [ { "text": "TC60", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002865" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] }, { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "organism part": [ { "text": "tonsil", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002372" ], "tag": "attribute" } ], "phenotype": [ { "text": "CD4+CD45RO+CD25-CXCR5hiPD1hi", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "Sample 3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA104717429", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T03:07:39.223Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA104717429" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA104717429{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA104717429/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA104717429/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA104717429" } } }, { "name": "ENCODE biosample ENCBS360WKF", "accession": "SAMN06273137", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-01-26T00:00:00Z", "update": "2022-03-30T00:19:22.385Z", "submitted": "2017-01-26T09:21:09.290Z", "characteristics": { "External Id": [ { "text": "SAMN06273137", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ENCODE" } ], "INSDC first public": [ { "text": "2017-01-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-20T17:55:30.408Z" } ], "INSDC secondary accession": [ { "text": "SRS1945407" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1945407" } ], "cell type": [ { "text": "dendritic cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000451" ], "tag": "attribute" } ], "description": [ { "text": "Homo sapiens dendritic in vitro differentiated cells treated with 100 ng/mL Lipopolysaccharide for 2 hours" } ], "donor id": [ { "text": "ENCDO088XVR", "tag": "attribute" } ], "lab": [ { "text": "Manuel Garber, UMass", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "in vitro differentiated cells", "tag": "attribute" } ], "title": [ { "text": "ENCODE biosample ENCBS360WKF" } ], "treatments": [ { "text": "treatment_term_id: CHEBI:16412; treatment_term_name: Lipopolysaccharide; treatment_type: chemical; duration: 2; duration_units: hour;", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06273137", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-01-26T09:21:09.290Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06273137" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06273137{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06273137/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06273137/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06273137" } } }, { "name": "GSM2541756", "accession": "SAMN06616141", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-04-27T00:00:00Z", "update": "2022-03-30T02:38:20.315Z", "submitted": "2017-03-17T15:09:30.743Z", "characteristics": { "External Id": [ { "text": "SAMN06616141", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute" } ], "INSDC first public": [ { "text": "2018-04-27T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2056243" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2056243" } ], "cell type": [ { "text": "GMP", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000557" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Bone Marrow CD34+", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000034" ], "tag": "attribute" } ], "tissue": [ { "text": "CD34+ Bone Marrow", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000034" ], "tag": "attribute" } ], "title": [ { "text": "BM1077-GMP-Frozen-160107-12" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06616141", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-03-17T15:09:30.743Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06616141" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06616141{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06616141/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06616141/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06616141" } } }, { "name": "GSM2546436", "accession": "SAMN06629446", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-06-22T00:00:00Z", "update": "2022-03-30T02:45:58.765Z", "submitted": "2017-03-23T10:32:43.793Z", "characteristics": { "External Id": [ { "text": "SAMN06629446", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-06-22T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2064886" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2064886" } ], "age of death": [ { "text": "19", "tag": "attribute" } ], "alcohol toxicology": [ { "text": "negative", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002371" ], "tag": "attribute" } ], "cause of death": [ { "text": "sudden cardiac death", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004278" ], "tag": "attribute" } ], "cell type": [ { "text": "Neuronal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000540" ], "tag": "attribute" } ], "gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "inferior temporal cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002576" ], "tag": "attribute" } ], "title": [ { "text": "351_N_ITC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06629446", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-03-23T10:32:43.793Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06629446" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06629446{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06629446/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06629446/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06629446" } } }, { "name": "GSM2564031", "accession": "SAMN06687719", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-07T00:00:00Z", "update": "2022-03-30T03:06:06.393Z", "submitted": "2017-04-05T07:51:18.963Z", "characteristics": { "External Id": [ { "text": "SAMN06687719", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Translational and Computational Neuroimmunology, Neurology, Columbia University Medical Center" } ], "INSDC first public": [ { "text": "2018-12-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-12-07T01:25:22.350Z" } ], "INSDC secondary accession": [ { "text": "SRS2101338" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2101338" } ], "batch": [ { "text": "Batch 2", "tag": "attribute" } ], "number of read pairs": [ { "text": "26782866", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "overexpression": [ { "text": "MAPT", "tag": "attribute" } ], "source_name": [ { "text": "forebrain neurons_Tau", "tag": "attribute" } ], "tissue/cell type": [ { "text": "Forebrain neurons", "tag": "attribute" } ], "title": [ { "text": "Tau rep1 b2" } ], "treatment": [ { "text": "Untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06687719", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-05T07:51:18.963Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06687719" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06687719{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06687719/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06687719/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06687719" } } }, { "name": "GSM2564061", "accession": "SAMN06688196", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-01T00:00:00Z", "update": "2022-03-30T03:06:18.871Z", "submitted": "2017-04-05T08:36:15.553Z", "characteristics": { "External Id": [ { "text": "SAMN06688196", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2020-04-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-01T01:26:28.150Z" } ], "INSDC secondary accession": [ { "text": "SRS2101501" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2101501" } ], "cell line": [ { "text": "HepG2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001187" ], "tag": "attribute" } ], "cell type": [ { "text": "liver cancer cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sirna": [ { "text": "NTG (AM4611 Life Tech.)", "tag": "attribute" } ], "source_name": [ { "text": "HepG2_NTG", "tag": "attribute" } ], "title": [ { "text": "ATACseq on NTG replicate A" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06688196", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-05T08:36:15.553Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06688196" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06688196{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06688196/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06688196/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06688196" } } }, { "name": "GSM2575298", "accession": "SAMN06711434", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-04-14T00:00:00Z", "update": "2022-03-30T03:12:57.121Z", "submitted": "2017-04-12T09:56:03.610Z", "characteristics": { "External Id": [ { "text": "SAMN06711434", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Pennsylvania" } ], "INSDC first public": [ { "text": "2017-04-14T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2121742" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2121742" } ], "cell line": [ { "text": "WM989", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002873" ], "tag": "attribute" } ], "cell type": [ { "text": "melanoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000756" ], "tag": "attribute" } ], "drug tx": [ { "text": "no drug", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population": [ { "text": "mix", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCIT_C64925" ], "tag": "attribute" } ], "source_name": [ { "text": "WM989 cell line", "tag": "attribute" } ], "title": [ { "text": "mix-p14-noDrug-v2_ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06711434", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-12T09:56:03.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06711434" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06711434{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06711434/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06711434/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06711434" } } }, { "name": "GSM2679869", "accession": "SAMN07269643", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-06-23T00:00:00Z", "update": "2022-03-30T05:46:16.292Z", "submitted": "2017-06-22T14:36:12.240Z", "characteristics": { "External Id": [ { "text": "SAMN07269643", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hospital For Special Surgery" } ], "INSDC first public": [ { "text": "2017-06-23T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2306811" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2306811" } ], "cell type": [ { "text": "monocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000576" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary human monocyte-derived macrophages", "tag": "attribute" } ], "tissue": [ { "text": "peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "ATAC_N_rep5" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07269643", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-06-22T14:36:12.240Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07269643" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07269643{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07269643/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07269643/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07269643" } } }, { "name": "GSM2692576", "accession": "SAMN07312216", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-07-04T00:00:00Z", "update": "2022-03-30T05:57:42.018Z", "submitted": "2017-07-03T13:11:11.867Z", "characteristics": { "External Id": [ { "text": "SAMN07312216", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genentech" } ], "INSDC first public": [ { "text": "2017-07-04T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2333357" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2333357" } ], "cell line": [ { "text": "PC9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002847" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NSCLC", "tag": "attribute" } ], "title": [ { "text": "6c: ALDH_High_Erl_OCSA ATAC-seq" } ], "treatment": [ { "text": "12 hour 1 μM erlotinib", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07312216", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-07-03T13:11:11.867Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07312216" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07312216{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07312216/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07312216/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07312216" } } }, { "name": "GSM2698926", "accession": "SAMN07339217", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-04-26T00:00:00Z", "update": "2022-03-30T06:07:35.328Z", "submitted": "2017-07-10T11:21:19.010Z", "characteristics": { "External Id": [ { "text": "SAMN07339217", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jacobsen, MCDB, University of California Los Angeles" } ], "INSDC first public": [ { "text": "2018-04-26T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2345457" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2345457" } ], "cell type": [ { "text": "TFAP2C knockout line 2 UCLA hESCs cultured for 5 days", "tag": "attribute" } ], "library type": [ { "text": "Nextera ATAC-seq", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage number": [ { "text": "p30", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002948" ], "tag": "attribute" } ], "source_name": [ { "text": "TFAP2C knockout line 2 UCLA hESCs cultured for 5 days", "tag": "attribute" } ], "title": [ { "text": "TFAP2C-/- Line 2 5d 5iLAF treatment ATAC [ATAC-Seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07339217", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-07-10T11:21:19.010Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07339217" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07339217{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07339217/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07339217/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07339217" } } }, { "name": "GSM2706219", "accession": "SAMN07361140", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-05-04T00:00:00Z", "update": "2022-03-30T06:13:44.151Z", "submitted": "2017-07-18T09:41:09.950Z", "characteristics": { "External Id": [ { "text": "SAMN07361140", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tsinghua University" } ], "INSDC first public": [ { "text": "2018-05-04T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2363480" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2363480" } ], "developmental stage": [ { "text": "2-cell", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001285" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Preimplantation embryo", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000922" ], "tag": "attribute" } ], "title": [ { "text": "Human_2-cell_ATAC-Seq_re1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07361140", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-07-18T09:41:09.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07361140" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07361140{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07361140/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07361140/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07361140" } } }, { "name": "GSM2722105", "accession": "SAMN07423758", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-04T00:00:00Z", "update": "2022-03-30T06:37:38.107Z", "submitted": "2017-07-28T14:11:07.493Z", "characteristics": { "External Id": [ { "text": "SAMN07423758", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2017-08-04T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2393360" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2393360" } ], "cell line": [ { "text": "GM02171", "tag": "attribute" } ], "cell type": [ { "text": "adult fibroblasts", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human adult fibroblasts", "tag": "attribute" } ], "timepoint": [ { "text": "d10", "tag": "attribute" } ], "title": [ { "text": "ATAC_miNs_D10_B" } ], "treatment": [ { "text": "miR-9/9*-124", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07423758", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-07-28T14:11:07.493Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07423758" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07423758{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07423758/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07423758/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07423758" } } }, { "name": "GSM2774973", "accession": "SAMN07614499", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-04-25T00:00:00Z", "update": "2022-03-30T07:42:22.335Z", "submitted": "2017-09-07T09:26:33.827Z", "characteristics": { "4oht": [ { "text": "Yes", "tag": "attribute" } ], "External Id": [ { "text": "SAMN07614499", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MRC Cancer Unit, University of Cambridge" } ], "INSDC first public": [ { "text": "2018-04-25T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2497162" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2497162" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "23-28", "tag": "attribute" } ], "source_name": [ { "text": "IMR90", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001196" ], "tag": "attribute" } ], "title": [ { "text": "ATAC_RIS_Rep2" } ], "vector 1": [ { "text": "ER:HRAS(G12V)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07614499", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-09-07T09:26:33.827Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07614499" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07614499{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07614499/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07614499/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07614499" } } }, { "name": "GSM2817565", "accession": "SAMN07795402", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-11-10T00:00:00Z", "update": "2022-03-30T08:55:54.907Z", "submitted": "2017-10-17T12:26:05.747Z", "characteristics": { "External Id": [ { "text": "SAMN07795402", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Pennsylvania" } ], "INSDC first public": [ { "text": "2018-11-10T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2601150" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2601150" } ], "cell type": [ { "text": "Adipose derived stem cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000034" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "<7", "tag": "attribute" } ], "source_name": [ { "text": "primary cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002660" ], "tag": "attribute" } ], "tissue": [ { "text": "Adipose", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001013" ], "tag": "attribute" } ], "title": [ { "text": "ASC-young-2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07795402", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-10-17T12:26:05.747Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07795402" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07795402{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07795402/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07795402/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07795402" } } }, { "name": "GSM2859809", "accession": "SAMN08035713", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-08T00:00:00Z", "update": "2022-03-30T10:47:16.141Z", "submitted": "2017-11-16T15:11:07.880Z", "characteristics": { "External Id": [ { "text": "SAMN08035713", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "von Eyss, Leibniz Institute on Aging" } ], "INSDC first public": [ { "text": "2018-08-08T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2695429" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2695429" } ], "cell line": [ { "text": "T47D", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001247" ], "tag": "attribute" } ], "cell type": [ { "text": "breast cancer cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002885" ], "tag": "attribute" } ], "construct/sirna": [ { "text": "siCtrl", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "Rep1", "tag": "attribute" } ], "source_name": [ { "text": "T47D", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001247" ], "tag": "attribute" } ], "title": [ { "text": "siCtrl_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08035713", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-11-16T15:11:07.880Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08035713" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08035713{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08035713/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08035713/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08035713" } } }, { "name": "GSM2860586", "accession": "SAMN08045017", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-07-24T00:00:00Z", "update": "2022-03-30T10:50:16.773Z", "submitted": "2017-11-20T14:03:15.833Z", "characteristics": { "External Id": [ { "text": "SAMN08045017", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2018-07-24T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2702633" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2702633" } ], "cell line": [ { "text": "OCI-AML2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006706" ], "tag": "attribute" } ], "cell type": [ { "text": "acute myeloid leukemia cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "OCI-AML2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006706" ], "tag": "attribute" } ], "title": [ { "text": "MEF2C_WT_control_induced_3" } ], "treatment": [ { "text": "doxycycline", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_50845" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08045017", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-11-20T14:03:15.833Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045017" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045017{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045017/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045017/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08045017" } } }, { "name": "GSM2861488", "accession": "SAMN08045257", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-02T00:00:00Z", "update": "2022-03-30T10:50:22.011Z", "submitted": "2017-11-20T14:19:09.337Z", "characteristics": { "External Id": [ { "text": "SAMN08045257", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics, Stanford University" } ], "INSDC first public": [ { "text": "2019-07-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-02T01:29:19.333Z" } ], "INSDC secondary accession": [ { "text": "SRS2702592" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2702592" } ], "biological replicate": [ { "text": "A", "tag": "attribute" } ], "media": [ { "text": "+EGF (complete)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "6", "tag": "attribute" } ], "sirna": [ { "text": "BRCA2-1", "tag": "attribute" } ], "source_name": [ { "text": "hTert-HME1 cell line", "tag": "attribute" } ], "tissue": [ { "text": "hTert-HME1 cell line", "tag": "attribute" } ], "title": [ { "text": "siB2-1_comp_A" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08045257", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-11-20T14:19:09.337Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045257" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045257{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045257/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08045257/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08045257" } } }, { "name": "GSM2879944", "accession": "SAMN08144802", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-01-15T00:00:00Z", "update": "2022-03-30T11:28:06.531Z", "submitted": "2017-12-07T13:02:42.993Z", "characteristics": { "External Id": [ { "text": "SAMN08144802", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology, Stanford University" } ], "INSDC first public": [ { "text": "2018-01-15T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2742942" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2742942" } ], "cell line": [ { "text": "Jurkat", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002796" ], "tag": "attribute" } ], "cell type": [ { "text": "single Jurkat T cell", "tag": "attribute" } ], "gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Jurkat T cells", "tag": "attribute" } ], "title": [ { "text": "Jurkat single cell 301" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08144802", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-07T13:02:42.993Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08144802" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08144802{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08144802/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08144802/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08144802" } } }, { "name": "Col3_2", "accession": "SAMN08165046", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-02T06:38:17.127Z", "update": "2022-03-30T11:34:27.496Z", "submitted": "2017-12-12T14:03:04.420Z", "characteristics": { "External Id": [ { "text": "SAMN08165046", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wayne State University" } ], "INSDC first public": [ { "text": "2020-04-02T06:38:17.127Z" } ], "INSDC last update": [ { "text": "2020-04-02T06:38:17.127Z" } ], "INSDC secondary accession": [ { "text": "SRS3441712" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS3441712" } ], "age": [ { "text": "21 weeks gestation", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009698" ], "tag": "attribute" } ], "biomaterial provider": [ { "text": "ScienCell", "tag": "attribute" } ], "cell type": [ { "text": "colonic epithelial cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0011108" ], "tag": "attribute" } ], "description": [ { "text": "Colonocytes cultured for 2 hours with gut microbiota derived from healthy individual 3." } ], "isolate": [ { "text": "2950, lot 9810", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "tissue": [ { "text": "colon", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001155" ], "tag": "attribute" } ], "title": [ { "text": "Human Colonocytes Inoculated with Microbiome from Ind3 for 2 hrs" } ], "treatment": [ { "text": "Microbiome from Ind3 for 2hrs", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08165046", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-12T14:03:04.420Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08165046" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08165046{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08165046/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08165046/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08165046" } } }, { "name": "GSM2893676", "accession": "SAMN08200557", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-01-28T00:00:00Z", "update": "2022-03-30T11:46:14.722Z", "submitted": "2017-12-18T19:56:05.273Z", "characteristics": { "External Id": [ { "text": "SAMN08200557", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Oro, Dermatology, Stanford University" } ], "INSDC first public": [ { "text": "2019-01-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-01-28T01:27:18.763Z" } ], "INSDC secondary accession": [ { "text": "SRS2767020" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2767020" } ], "cell type": [ { "text": "surface ectoderm progenitor cells", "tag": "attribute" } ], "genotype/variation": [ { "text": "TetO-TFAP2C", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "originating cell line": [ { "text": "H9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003045" ], "tag": "attribute" } ], "source_name": [ { "text": "early surface ectoderm differentiation from hESC", "tag": "attribute" } ], "title": [ { "text": "AP2Cd7On_2" } ], "treatment and stage": [ { "text": "Dox+ for 7 days", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08200557", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-18T19:56:05.273Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08200557" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08200557{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08200557/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08200557/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08200557" } } }, { "name": "GSM2895191", "accession": "SAMN08204728", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-16T00:00:00Z", "update": "2022-03-30T11:47:15.072Z", "submitted": "2017-12-19T14:51:07.263Z", "characteristics": { "External Id": [ { "text": "SAMN08204728", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "DGT, CLST, RIKEN" } ], "INSDC first public": [ { "text": "2018-10-16T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2771004" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2771004" } ], "cell type": [ { "text": "chondrocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000138" ], "tag": "attribute" } ], "oa stage": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human knee articular cartilage", "tag": "attribute" } ], "tissue": [ { "text": "catilage", "tag": "attribute" } ], "tissue type": [ { "text": "fresh", "ontologyTerms": [ "http://purl.obolibrary.org/obo/OBI_0000971" ], "tag": "attribute" } ], "title": [ { "text": "7.oLT" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08204728", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-19T14:51:07.263Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08204728" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08204728{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08204728/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08204728/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08204728" } } }, { "name": "GSM2897103", "accession": "SAMN08224287", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-01T00:00:00Z", "update": "2022-03-30T11:53:38.561Z", "submitted": "2017-12-21T09:52:03.377Z", "characteristics": { "External Id": [ { "text": "SAMN08224287", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences" } ], "INSDC first public": [ { "text": "2019-05-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-01T01:39:21.113Z" } ], "INSDC secondary accession": [ { "text": "SRS2780773" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2780773" } ], "cell line": [ { "text": "HAP1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007598" ], "tag": "attribute" } ], "clone": [ { "text": "9-907", "tag": "attribute" } ], "knockout": [ { "text": "ARID2", "tag": "attribute" } ], "library": [ { "text": "ATAC-seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007045" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "HAP1 cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_HAP1_ARID2_r1_907_9" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08224287", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-21T09:52:03.377Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08224287" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08224287{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08224287/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08224287/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08224287" } } }, { "name": "GSM2937021", "accession": "SAMN08370443", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-08-28T00:00:00Z", "update": "2022-03-30T12:38:50.287Z", "submitted": "2018-01-17T11:11:16.603Z", "characteristics": { "External Id": [ { "text": "SAMN08370443", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Vanderbilt University Medical Center" } ], "INSDC first public": [ { "text": "2019-08-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-08-28T13:26:17.680Z" } ], "INSDC secondary accession": [ { "text": "SRS2856076" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2856076" } ], "cell line": [ { "text": "G401", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002179" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "ten-thirty", "tag": "attribute" } ], "source_name": [ { "text": "MRT cells", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq OMOMYC rep1" } ], "transfection": [ { "text": "OMOMYC", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08370443", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-17T11:11:16.603Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08370443" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08370443{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08370443/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08370443/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08370443" } } }, { "name": "GSM2949333", "accession": "SAMN08405447", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-23T00:00:00Z", "update": "2022-03-30T12:53:34.425Z", "submitted": "2018-01-26T12:46:02.517Z", "characteristics": { "External Id": [ { "text": "SAMN08405447", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Johns Hopkins University School of Medicine" } ], "INSDC first public": [ { "text": "2019-04-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-23T06:46:28.650Z" } ], "INSDC secondary accession": [ { "text": "SRS2870728" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2870728" } ], "cell line": [ { "text": "AC16", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "AC16", "tag": "attribute" } ], "title": [ { "text": "AC16_ATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08405447", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-26T12:46:02.517Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08405447" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08405447{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08405447/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08405447/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08405447" } } }, { "name": "GSM2970942", "accession": "SAMN08434958", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-02T00:00:00Z", "update": "2022-03-30T12:58:35.116Z", "submitted": "2018-01-29T20:11:11.213Z", "characteristics": { "External Id": [ { "text": "SAMN08434958", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genome Sciences, University of Washington" } ], "INSDC first public": [ { "text": "2018-08-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-08-02T03:24:24.397Z" } ], "INSDC secondary accession": [ { "text": "SRS2896793" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2896793" } ], "cell type": [ { "text": "Immortalized skeletal muscle myoblasts", "tag": "attribute" } ], "crispr guide": [ { "text": "Meis1 knockout 6", "tag": "attribute" } ], "crispr perturbation target": [ { "text": "Meis1 knockout", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "54-1", "tag": "attribute" } ], "time": [ { "text": "Day 0", "tag": "attribute" } ], "title": [ { "text": "bulk ATAC 54-1 Day 0 MeisKO guide 6" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08434958", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-29T20:11:11.213Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08434958" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08434958{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08434958/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08434958/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08434958" } } }, { "name": "GSM2974390", "accession": "SAMN08448353", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-09T00:00:00Z", "update": "2022-03-30T13:03:46.007Z", "submitted": "2018-01-31T13:41:11.713Z", "characteristics": { "External Id": [ { "text": "SAMN08448353", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of New South Wales" } ], "INSDC first public": [ { "text": "2019-11-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-09T02:27:20.747Z" } ], "INSDC secondary accession": [ { "text": "SRS2903355" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2903355" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ALL xenograft cells", "tag": "attribute" } ], "tissue": [ { "text": "ALL xenograft cells", "tag": "attribute" } ], "title": [ { "text": "ALL11_Dex_ATAC" } ], "treatment": [ { "text": "Dex", "tag": "attribute" } ], "xenograft id": [ { "text": "ALL11", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CLO_0001705" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08448353", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-31T13:41:11.713Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08448353" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08448353{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08448353/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08448353/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08448353" } } }, { "name": "GSM2977486", "accession": "SAMN08457713", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-02-03T00:00:00Z", "update": "2022-03-30T13:07:17.141Z", "submitted": "2018-02-02T14:11:03.550Z", "characteristics": { "External Id": [ { "text": "SAMN08457713", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "HSCRB" } ], "INSDC first public": [ { "text": "2018-02-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-02-03T01:24:25.537Z" } ], "INSDC secondary accession": [ { "text": "SRS2909150" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2909150" } ], "cell line background": [ { "text": "BJ-5ta", "tag": "attribute" } ], "cell type": [ { "text": "immortalized BJ foreskin fibroblast cell line", "tag": "attribute" } ], "genotype/variation": [ { "text": "FOXA2 doxycycline inducible", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BJ Fibroblasts", "tag": "attribute" } ], "title": [ { "text": "BJ_ATAC_FOXA2_10dExp_12dWD_Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08457713", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-02-02T14:11:03.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08457713" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08457713{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08457713/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08457713/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08457713" } } }, { "name": "GSM3089880", "accession": "SAMN08896955", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-10-15T00:00:00Z", "update": "2022-03-30T16:20:07.185Z", "submitted": "2018-04-09T11:08:13.127Z", "characteristics": { "External Id": [ { "text": "SAMN08896955", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "USC Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California" } ], "INSDC first public": [ { "text": "2019-10-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-10-15T10:24:19.617Z" } ], "INSDC secondary accession": [ { "text": "SRS3143841" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3143841" } ], "cell line": [ { "text": "Brx68", "tag": "attribute" } ], "dissociation_protocol": [ { "text": "bonedisso", "tag": "attribute" } ], "generation": [ { "text": "1", "tag": "attribute" } ], "grown_in_culture": [ { "text": "yes", "tag": "attribute" } ], "metastatic site": [ { "text": "bone", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002481" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "bone", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002481" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_Brx68_bonejaw_mets_2_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08896955", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-04-09T11:08:13.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08896955" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08896955{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08896955/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08896955/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08896955" } } }, { "name": "GSM3111022", "accession": "SAMN08982087", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-10T00:00:00Z", "update": "2022-03-30T16:52:07.362Z", "submitted": "2018-04-25T14:36:03.820Z", "characteristics": { "External Id": [ { "text": "SAMN08982087", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Quertermous, Medicine Cardiology, Stanford University" } ], "INSDC first public": [ { "text": "2018-08-10T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3219094" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3219094" } ], "cell line": [ { "text": "2356", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "cell culture", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0000214" ], "tag": "attribute" } ], "source_name": [ { "text": "coronary artery smooth muscle cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002592" ], "tag": "attribute" } ], "title": [ { "text": "2356 [ATAC-seq]", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007045" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08982087", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-04-25T14:36:03.820Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982087" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982087{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982087/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982087/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08982087" } } }, { "name": "GSM3132747", "accession": "SAMN09080968", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-15T00:00:00Z", "update": "2022-03-30T17:33:40.527Z", "submitted": "2018-05-07T09:21:13.980Z", "characteristics": { "External Id": [ { "text": "SAMN09080968", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology Program, Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2019-05-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-15T01:36:21.740Z" } ], "INSDC secondary accession": [ { "text": "SRS3264504" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3264504" } ], "differentiation stage": [ { "text": "Pancreatic Progenitors 1", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002351" ], "tag": "attribute" } ], "genotype": [ { "text": "FOXA2 -/-", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ES-derived progenitors", "tag": "attribute" } ], "tissue": [ { "text": "ES-derived progenitors", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_PP1-FOXA2 KO1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09080968", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-07T09:21:13.980Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09080968" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09080968{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09080968/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09080968/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09080968" } } }, { "name": "GSM3140953", "accession": "SAMN09205921", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-05-15T00:00:00Z", "update": "2022-03-30T18:29:55.739Z", "submitted": "2018-05-14T10:16:18.550Z", "characteristics": { "External Id": [ { "text": "SAMN09205921", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-05-15T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3297675" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3297675" } ], "cell line": [ { "text": "RWPE1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002323" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RWPE1 Prosate Cells", "tag": "attribute" } ], "tissue": [ { "text": "Prosate", "tag": "attribute" } ], "title": [ { "text": "Schlap1 Replicate B" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09205921", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-14T10:16:18.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09205921" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09205921{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09205921/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09205921/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09205921" } } }, { "name": "GSM3152054", "accession": "SAMN09253946", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-10-16T00:00:00Z", "update": "2022-03-30T18:47:21.879Z", "submitted": "2018-05-24T09:56:12.810Z", "characteristics": { "External Id": [ { "text": "SAMN09253946", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hideo Watanabe, Department of Medicine, Division of Pulmonary, Critical Care and Sleep Medicine, Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2019-10-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-10-16T21:04:17.210Z" } ], "INSDC secondary accession": [ { "text": "SRS3334912" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3334912" } ], "cell type": [ { "text": "NCI-H69", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002300" ], "tag": "attribute" } ], "experimental conditions": [ { "text": "Basal conditions 48h", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "12-15", "tag": "attribute" } ], "source_name": [ { "text": "Small Cell Lung Cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "tissue": [ { "text": "Small Cell Lung Cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "title": [ { "text": "H69-replicate3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09253946", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-24T09:56:12.810Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09253946" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09253946{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09253946/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09253946/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09253946" } } }, { "name": "GSM3161729", "accession": "SAMN09272127", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-01T00:00:00Z", "update": "2022-03-30T18:57:59.171Z", "submitted": "2018-05-28T12:26:08.570Z", "characteristics": { "External Id": [ { "text": "SAMN09272127", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Pittsburgh" } ], "INSDC first public": [ { "text": "2019-05-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-01T02:07:18.147Z" } ], "INSDC secondary accession": [ { "text": "SRS3346510" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3346510" } ], "cell line": [ { "text": "RL95_2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Endometrial adenosquamous carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1001952" ], "tag": "attribute" } ], "tissue": [ { "text": "Endometrial adenosquamous carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1001952" ], "tag": "attribute" } ], "title": [ { "text": "RL95_2 ATAC-seq replicate 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09272127", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-28T12:26:08.570Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09272127" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09272127{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09272127/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09272127/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09272127" } } }, { "name": "GSM3163884", "accession": "SAMN09276576", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-10-24T00:00:00Z", "update": "2022-03-30T19:00:27.540Z", "submitted": "2018-05-29T16:07:24.077Z", "characteristics": { "External Id": [ { "text": "SAMN09276576", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of California, Berkeley" } ], "INSDC first public": [ { "text": "2019-10-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-10-24T04:30:18.650Z" } ], "INSDC secondary accession": [ { "text": "SRS3350737" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3350737" } ], "cell type": [ { "text": "H1 hESC-derived neural progenitor cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Neural progenitor cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000047" ], "tag": "attribute" } ], "title": [ { "text": "ATACseq_7TP_12hr_rep2" } ] }, "submittedVia": "JSON_API", "create": "2018-05-29T16:07:24.077Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09276576" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09276576{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09276576/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09276576/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09276576" } } }, { "name": "GSM3169431", "accession": "SAMN09291893", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-28T00:00:00Z", "update": "2022-03-30T19:06:52.978Z", "submitted": "2018-06-01T09:55:07.710Z", "characteristics": { "External Id": [ { "text": "SAMN09291893", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Aryee, Broad Institute" } ], "INSDC first public": [ { "text": "2019-02-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-28T02:11:19.853Z" } ], "INSDC secondary accession": [ { "text": "SRS3364338" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3364338" } ], "cell line": [ { "text": "TF1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ], "tag": "attribute" } ], "cell type": [ { "text": "hematopoietic cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ATCC", "tag": "attribute" } ], "title": [ { "text": "S0067_G11-B10-C11-C6-B8-E10-F9-F8_G11_G008 [TF1_clones_ATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09291893", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-01T09:55:07.710Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09291893" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09291893{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09291893/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09291893/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09291893" } } }, { "name": "GSM3170784", "accession": "SAMN09293686", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-28T00:00:00Z", "update": "2022-03-30T19:07:41.945Z", "submitted": "2018-06-01T10:44:19.567Z", "characteristics": { "External Id": [ { "text": "SAMN09293686", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Aryee, Broad Institute" } ], "INSDC first public": [ { "text": "2019-02-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-28T03:19:27.060Z" } ], "INSDC secondary accession": [ { "text": "SRS3365779" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3365779" } ], "celltype": [ { "text": "primary hematopoietic cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CD34+ hematopoietic cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000037" ], "tag": "attribute" } ], "supplemented with": [ { "text": "CC100", "tag": "attribute" } ], "title": [ { "text": "CC100-C1-1-27 [CC100_scATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09293686", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-01T10:44:19.567Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09293686" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09293686{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09293686/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09293686/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09293686" } } }, { "name": "GSM3215732", "accession": "SAMN09492423", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-20T00:00:00Z", "update": "2022-03-30T20:28:41.431Z", "submitted": "2018-06-26T16:33:12.833Z", "characteristics": { "External Id": [ { "text": "SAMN09492423", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2018-12-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-12-20T03:37:27.053Z" } ], "INSDC secondary accession": [ { "text": "SRS3467476" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3467476" } ], "cell type": [ { "text": "Primary epidermal keratinocyte", "tag": "attribute" } ], "differentiation status": [ { "text": "Differentiated (Day 3)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary epidermal keratinocyte", "tag": "attribute" } ], "title": [ { "text": "scATAC-D3-28" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09492423", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-26T16:33:12.833Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09492423" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09492423{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09492423/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09492423/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09492423" } } }, { "name": "GSM3218299", "accession": "SAMN09496831", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-20T00:00:00Z", "update": "2022-03-30T20:30:42.319Z", "submitted": "2018-06-26T18:32:19.517Z", "characteristics": { "External Id": [ { "text": "SAMN09496831", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2018-12-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-12-20T06:24:36.163Z" } ], "INSDC secondary accession": [ { "text": "SRS3476536" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3476536" } ], "cell type": [ { "text": "GM12878 cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "GM12878 cell line", "tag": "attribute" } ], "title": [ { "text": "GM12878 cell 2389" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09496831", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-26T18:32:19.517Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09496831" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09496831{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09496831/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09496831/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09496831" } } }, { "name": "GSM3240330", "accession": "SAMN09532155", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-14T00:00:00Z", "update": "2022-03-30T20:45:46.914Z", "submitted": "2018-07-02T08:26:08.593Z", "characteristics": { "External Id": [ { "text": "SAMN09532155", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology and Bioinformatics, Broad Institute" } ], "INSDC first public": [ { "text": "2021-05-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-14T02:13:23.677Z" } ], "INSDC secondary accession": [ { "text": "SRS3492290" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3492290" } ], "cell line": [ { "text": "A673 Ewing sarcoma", "tag": "attribute" } ], "genotype/variation": [ { "text": "STAG2 null", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "A673 clones with STAG2 null", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq on A673 STAG2 null" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN09532155", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-07-02T08:26:08.593Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09532155" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09532155{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09532155/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09532155/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09532155" } } }, { "name": "GSM3320382", "accession": "SAMN09769848", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-09-06T00:00:00Z", "update": "2022-03-30T21:52:53.941Z", "submitted": "2018-08-06T18:12:08.330Z", "characteristics": { "External Id": [ { "text": "SAMN09769848", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2018-09-06T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3632375" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3632375" } ], "cell type": [ { "text": "Immature_NK", "tag": "attribute" } ], "donor": [ { "text": "1004", "tag": "attribute" } ], "lineage": [ { "text": "NK", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000623" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "primary blood", "tag": "attribute" } ], "title": [ { "text": "1004-Immature_NK-U" } ], "treatment": [ { "text": "no_treament", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09769848", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-06T18:12:08.330Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09769848" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09769848{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09769848/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09769848/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09769848" } } }, { "name": "GSM3321015", "accession": "SAMN09770761", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-05T00:00:00Z", "update": "2022-03-30T21:53:10.318Z", "submitted": "2018-08-07T06:56:08.290Z", "characteristics": { "External Id": [ { "text": "SAMN09770761", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MIMG, UCLA" } ], "INSDC first public": [ { "text": "2018-10-05T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3632979" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3632979" } ], "cell type": [ { "text": "small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "lung", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002048" ], "tag": "attribute" } ], "tissue": [ { "text": "lung", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002048" ], "tag": "attribute" } ], "title": [ { "text": "lung: NCI-H2227 ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09770761", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-07T06:56:08.290Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09770761" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09770761{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09770761/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09770761/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09770761" } } }, { "name": "C4-2B, ATAC-seq, EPZ6438, rep2", "accession": "SAMN09832427", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-14T00:00:00Z", "update": "2022-03-30T22:13:59.997Z", "submitted": "2018-08-14T15:16:03.550Z", "characteristics": { "External Id": [ { "text": "SAMN09832427", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Michigan-Ann Arbor" } ], "INSDC first public": [ { "text": "2018-08-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-08-14T18:09:21.507Z" } ], "INSDC secondary accession": [ { "text": "SRS3670024" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS3670024" } ], "age": [ { "text": "50", "tag": "attribute" } ], "assay": [ { "text": "ATAC-seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007045" ], "tag": "attribute" } ], "biomaterial provider": [ { "text": "Michigan Center for Translational Pathology", "tag": "attribute" } ], "cell line": [ { "text": "C4-2B", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006365" ], "tag": "attribute" } ], "description": [ { "text": "C4-2B, ATAC-seq, EPZ6438, rep2" } ], "isolate": [ { "text": "C4-2B", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006365" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "2", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "tissue": [ { "text": "Prostate", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002367" ], "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ], "treatment": [ { "text": "EPZ6438", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09832427", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-14T15:16:03.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09832427" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09832427{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09832427/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09832427/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09832427" } } }, { "name": "GSM3334214", "accession": "SAMN09839561", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-16T00:00:00Z", "update": "2022-03-30T22:17:00.488Z", "submitted": "2018-08-15T16:50:03.983Z", "characteristics": { "External Id": [ { "text": "SAMN09839561", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hansen group, Biotech Research and Innovation Centre (BRIC), University of Copenhagen" } ], "INSDC first public": [ { "text": "2018-08-16T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3674396" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3674396" } ], "cell line": [ { "text": "Osteosarcoma cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sirna transfection": [ { "text": "siSET8", "tag": "attribute" } ], "source_name": [ { "text": "Osteosarcoma cell line", "tag": "attribute" } ], "title": [ { "text": "siSET8 Replicate4" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09839561", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-15T16:50:03.983Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09839561" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09839561{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09839561/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09839561/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09839561" } } }, { "name": "GSM3349780", "accession": "SAMN09873848", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-04T00:00:00Z", "update": "2022-03-30T22:28:17.983Z", "submitted": "2018-08-21T22:26:03.697Z", "characteristics": { "External Id": [ { "text": "SAMN09873848", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford's Postdoctoral Scholar programs" } ], "INSDC first public": [ { "text": "2019-07-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-05T05:55:18.077Z" } ], "INSDC secondary accession": [ { "text": "SRS3698811" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3698811" } ], "cell type": [ { "text": "iPSC-CMs", "tag": "attribute" } ], "day post-differentiation": [ { "text": "day 40", "tag": "attribute" } ], "genotype/variation": [ { "text": "LMNA WT/MT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "iPSC-CMs", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_III-3-MT, rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09873848", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-21T22:26:03.697Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09873848" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09873848{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09873848/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09873848/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09873848" } } }, { "name": "GSM3373881", "accession": "SAMN09948042", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-09-27T00:00:00Z", "update": "2022-03-30T22:59:21.763Z", "submitted": "2018-09-03T09:41:06.170Z", "characteristics": { "External Id": [ { "text": "SAMN09948042", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-09-27T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3734887" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3734887" } ], "cell type": [ { "text": "CD4+CD25+ cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004587" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sorted cell type": [ { "text": "CD4+CD25hiCD127loCD45RA+ (naïve) Tregs", "tag": "attribute" } ], "source_name": [ { "text": "Naïve Tregs", "tag": "attribute" } ], "subject status/id": [ { "text": "Healthy Donor 2", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "tissue": [ { "text": "peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "Donor2_naive Tregs [S05]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09948042", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-09-03T09:41:06.170Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09948042" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09948042{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09948042/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09948042/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09948042" } } }, { "name": "GSM3374852", "accession": "SAMN09953980", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-12T00:00:00Z", "update": "2022-03-30T23:02:36.924Z", "submitted": "2018-09-04T14:51:04.967Z", "characteristics": { "External Id": [ { "text": "SAMN09953980", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Aryee, Broad Institute" } ], "INSDC first public": [ { "text": "2019-03-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-12T01:39:26.247Z" } ], "INSDC secondary accession": [ { "text": "SRS3737988" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3737988" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population": [ { "text": "CD45+/Lin-/CD11c-/CD123+", "tag": "attribute" } ], "source_name": [ { "text": "human hematopoietic cells", "tag": "attribute" } ], "title": [ { "text": "Plasmacytoid dendritic cells sample 1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09953980", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-09-04T14:51:04.967Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09953980" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09953980{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09953980/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09953980/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09953980" } } }, { "name": "GSM3382060", "accession": "SAMN10026955", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-11-30T00:00:00Z", "update": "2022-03-30T23:26:41.713Z", "submitted": "2018-09-10T16:16:12.213Z", "characteristics": { "External Id": [ { "text": "SAMN10026955", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bradner Lab, Medical Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2018-11-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-11-30T04:06:22.987Z" } ], "INSDC secondary accession": [ { "text": "SRS3761691" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3761691" } ], "cell type": [ { "text": "CLL cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "OSU-CLL", "tag": "attribute" } ], "title": [ { "text": "OSUCLL_ATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10026955", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-09-10T16:16:12.213Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10026955" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10026955{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10026955/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10026955/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10026955" } } }, { "name": "GSM3445655", "accession": "SAMN10289900", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-01-12T00:00:00Z", "update": "2022-03-31T01:18:19.143Z", "submitted": "2018-10-24T16:25:04.413Z", "characteristics": { "External Id": [ { "text": "SAMN10289900", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pastor, Biochemistry, McGill University" } ], "INSDC first public": [ { "text": "2019-01-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-01-12T01:35:18.643Z" } ], "INSDC secondary accession": [ { "text": "SRS3978552" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3978552" } ], "cell line": [ { "text": "H1703", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002264" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H1703 lung cancer cells", "tag": "attribute" } ], "tissue": [ { "text": "lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001071" ], "tag": "attribute" } ], "title": [ { "text": "Control-infected H1703 ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10289900", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-24T16:25:04.413Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10289900" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10289900{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10289900/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10289900/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10289900" } } }, { "name": "GSM3453247", "accession": "SAMN10355962", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-18T00:00:00Z", "update": "2022-03-31T01:37:07.379Z", "submitted": "2018-10-31T14:26:03.607Z", "characteristics": { "External Id": [ { "text": "SAMN10355962", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Integrative Medical Sciences, Riken" } ], "INSDC first public": [ { "text": "2019-05-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-18T01:54:21Z" } ], "INSDC secondary accession": [ { "text": "SRS4002817" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4002817" } ], "cell type": [ { "text": "Fibroblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000057" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "10 to 15", "tag": "attribute" } ], "source_name": [ { "text": "Dermal fibroblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002551" ], "tag": "attribute" } ], "title": [ { "text": "TK_OVOL2_rep2 [ATAC-seq]" } ], "transgene": [ { "text": "TP63, KLF4, OVOL2", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10355962", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-31T14:26:03.607Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10355962" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10355962{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10355962/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10355962/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10355962" } } }, { "name": "GSM3462871", "accession": "SAMN10391725", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-11-08T00:00:00Z", "update": "2022-03-31T01:57:41.415Z", "submitted": "2018-11-07T11:32:08.237Z", "characteristics": { "External Id": [ { "text": "SAMN10391725", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Job Dekker Lab, Program in Systems Biology, UMass Medical School" } ], "INSDC first public": [ { "text": "2018-11-08T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS4027379" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS4027379" } ], "cell line": [ { "text": "U2OS with H2B-GFP and Halo tagged CTCF received from Anders Hansen in Xavier Darzacq lab in Berkeley", "tag": "attribute" } ], "cell type": [ { "text": "Bone", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002481" ], "tag": "attribute" } ], "enzyme": [ { "text": "Transposase-Tn5", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "protocol": [ { "text": "ATAC-seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007045" ], "tag": "attribute" } ], "source_name": [ { "text": "U2OS", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002869" ], "tag": "attribute" } ], "title": [ { "text": "U2OS H2B-GFP Halo-CTCF Mitotic Cell ATAC-seq R2T2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10391725", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-11-07T11:32:08.237Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10391725" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10391725{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10391725/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10391725/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10391725" } } }, { "name": "GSM3474895", "accession": "SAMN10430956", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-12T00:00:00Z", "update": "2022-03-31T02:09:44.797Z", "submitted": "2018-11-15T11:29:10.570Z", "characteristics": { "External Id": [ { "text": "SAMN10430956", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chang Lab, Stanford" } ], "INSDC first public": [ { "text": "2019-04-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-15T13:07:55.060Z" } ], "INSDC secondary accession": [ { "text": "SRS4045348" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4045348" } ], "cell type": [ { "text": "pre-leukemic HSCs", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient diagnosis": [ { "text": "acute myeloid leukemia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000222" ], "tag": "attribute" } ], "patient id": [ { "text": "SU353", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9823" ], "tag": "attribute" } ], "source_name": [ { "text": "pre-leukemic HSCs", "tag": "attribute" } ], "title": [ { "text": "HSCATAC_P165_29" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10430956", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-11-15T11:29:10.570Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10430956" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10430956{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10430956/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10430956/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10430956" } } }, { "name": "GSM3474545", "accession": "SAMN10431462", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-12T00:00:00Z", "update": "2022-03-31T02:10:03.962Z", "submitted": "2018-11-15T11:52:13.960Z", "characteristics": { "External Id": [ { "text": "SAMN10431462", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chang Lab, Stanford" } ], "INSDC first public": [ { "text": "2019-04-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-15T12:31:13.213Z" } ], "INSDC secondary accession": [ { "text": "SRS4045923" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4045923" } ], "cell type": [ { "text": "LSC", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient diagnosis": [ { "text": "acute myeloid leukemia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000222" ], "tag": "attribute" } ], "patient id": [ { "text": "SU353", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9823" ], "tag": "attribute" } ], "source_name": [ { "text": "LSC", "tag": "attribute" } ], "title": [ { "text": "SU353_LSC_5" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10431462", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-11-15T11:52:13.960Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10431462" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10431462{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10431462/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10431462/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10431462" } } }, { "name": "GSM3494239", "accession": "SAMN10492201", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-01-22T00:00:00Z", "update": "2022-03-31T02:36:50.717Z", "submitted": "2018-11-28T08:36:07.070Z", "characteristics": { "External Id": [ { "text": "SAMN10492201", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Duke University" } ], "INSDC first public": [ { "text": "2019-01-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-01-22T01:47:28.093Z" } ], "INSDC secondary accession": [ { "text": "SRS4087533" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4087533" } ], "age": [ { "text": "adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "Adipose from NICHD Brain and Tissue Bank for Developmental Disorders Donor 1104", "tag": "attribute" } ], "tissue": [ { "text": "adipose", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001013" ], "tag": "attribute" } ], "title": [ { "text": "H1.3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10492201", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-11-28T08:36:07.070Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10492201" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10492201{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10492201/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10492201/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10492201" } } }, { "name": "GSM3507393", "accession": "SAMN10574837", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-21T00:00:00Z", "update": "2022-03-31T03:02:28.751Z", "submitted": "2018-12-10T15:01:09.643Z", "characteristics": { "External Id": [ { "text": "SAMN10574837", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute" } ], "INSDC first public": [ { "text": "2019-06-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-21T06:33:52.590Z" } ], "INSDC secondary accession": [ { "text": "SRS4137463" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4137463" } ], "bead concentration": [ { "text": "5000", "tag": "attribute" } ], "cell type": [ { "text": "Human bone marrow mononuclear cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human bone marrow mononuclear cells", "tag": "attribute" } ], "title": [ { "text": "HumanBoneMarrow-ht-sciATAC-seq-Channel2" } ] }, "submittedVia": "JSON_API", "create": "2018-12-10T15:01:09.643Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10574837" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10574837{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10574837/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10574837/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10574837" } } }, { "name": "GSM3515255", "accession": "SAMN10596804", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-10T00:00:00Z", "update": "2022-03-31T03:13:41.044Z", "submitted": "2018-12-14T15:01:05.447Z", "characteristics": { "External Id": [ { "text": "SAMN10596804", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Epigenetics and Cell Fates Laboratory, Institute of Molecular and Cell Biology" } ], "INSDC first public": [ { "text": "2020-06-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-10T01:50:17.110Z" } ], "INSDC secondary accession": [ { "text": "SRS4146428" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4146428" } ], "cell type": [ { "text": "JK1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "JK1", "tag": "attribute" } ], "title": [ { "text": "JK1A-23" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10596804", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-12-14T15:01:05.447Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10596804" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10596804{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10596804/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10596804/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10596804" } } }, { "name": "GSM3516008", "accession": "SAMN10597936", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-10T00:00:00Z", "update": "2022-03-31T03:14:05.852Z", "submitted": "2018-12-14T16:23:34.703Z", "characteristics": { "External Id": [ { "text": "SAMN10597936", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Epigenetics and Cell Fates Laboratory, Institute of Molecular and Cell Biology" } ], "INSDC first public": [ { "text": "2020-06-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-10T02:40:15.240Z" } ], "INSDC secondary accession": [ { "text": "SRS4147529" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4147529" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Umblical Cord Blood Cells Undergoing Differentiation", "tag": "attribute" } ], "time point": [ { "text": "D8", "tag": "attribute" } ], "title": [ { "text": "D8_1A-65" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10597936", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-12-14T16:23:34.703Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10597936" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10597936{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10597936/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10597936/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10597936" } } }, { "name": "GSM3537188", "accession": "SAMN10686494", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-09T00:00:00Z", "update": "2022-03-31T03:47:49.545Z", "submitted": "2019-01-02T17:01:03.953Z", "characteristics": { "External Id": [ { "text": "SAMN10686494", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Pathology, Johns Hopkins School of Medicine" } ], "INSDC first public": [ { "text": "2020-06-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-09T01:46:33.400Z" } ], "INSDC secondary accession": [ { "text": "SRS4201614" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4201614" } ], "biological replicate": [ { "text": "2", "tag": "attribute" } ], "cell type": [ { "text": "endometrial epithelial cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0010710" ], "tag": "attribute" } ], "genotype": [ { "text": "ARID1A KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "endometrial epithelial cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0010710" ], "tag": "attribute" } ], "technical replicate": [ { "text": "3", "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq: ARID1A-KO2 rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10686494", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-02T17:01:03.953Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686494" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686494{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686494/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686494/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10686494" } } }, { "name": "GSM3537869", "accession": "SAMN10689195", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-26T00:00:00Z", "update": "2022-03-31T03:49:31.810Z", "submitted": "2019-01-03T11:06:02.973Z", "characteristics": { "External Id": [ { "text": "SAMN10689195", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Genetics, Weizmann Institute of Science" } ], "INSDC first public": [ { "text": "2021-03-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-26T01:23:17.173Z" } ], "INSDC secondary accession": [ { "text": "SRS4207604" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4207604" } ], "cell line": [ { "text": "WIBR3", "tag": "attribute" } ], "culture conditions": [ { "text": "conventional/primed", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hESCs, WIBR3 cell line", "tag": "attribute" } ], "title": [ { "text": "WIBR3_ATAC_PRIMED" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN10689195", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-03T11:06:02.973Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10689195" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10689195{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10689195/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10689195/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10689195" } } }, { "name": "GSM3558601", "accession": "SAMN10721742", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-22T00:00:00Z", "update": "2022-03-31T04:04:41.432Z", "submitted": "2019-01-10T09:26:13.830Z", "characteristics": { "External Id": [ { "text": "SAMN10721742", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute of MIT and Harvard, Harvard Medical School, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2019-11-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-22T19:16:19.670Z" } ], "INSDC secondary accession": [ { "text": "SRS4237827" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4237827" } ], "cell line": [ { "text": "TTC1240", "tag": "attribute" } ], "cell type": [ { "text": "tumor cell line", "tag": "attribute" } ], "lentivirus": [ { "text": "SMARCB1 FL", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "TTC1240", "tag": "attribute" } ], "title": [ { "text": "TTC1240_ATAC_N106_SMARCB1_FL_Rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10721742", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-10T09:26:13.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721742" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721742{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721742/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721742/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10721742" } } }, { "name": "GSM3560275", "accession": "SAMN10730292", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-01-11T00:00:00Z", "update": "2022-03-31T04:05:52.251Z", "submitted": "2019-01-11T11:21:03.610Z", "characteristics": { "External Id": [ { "text": "SAMN10730292", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2020-01-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-01-11T01:26:18.290Z" } ], "INSDC secondary accession": [ { "text": "SRS4245398" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4245398" } ], "cell type": [ { "text": "iPSC-derived hematopoietic cells", "tag": "attribute" } ], "harvest": [ { "text": "manual separation", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "AML_4_10Suspension_1", "tag": "attribute" } ], "time point": [ { "text": "day 16 of differentiation", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_Suspension rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10730292", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-11T11:21:03.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10730292" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10730292{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10730292/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10730292/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10730292" } } }, { "name": "GSM3561196", "accession": "SAMN10737711", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-01-14T00:00:00Z", "update": "2022-03-31T04:06:42.110Z", "submitted": "2019-01-13T21:26:04.483Z", "characteristics": { "External Id": [ { "text": "SAMN10737711", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics, University of North Carolina at Chapel Hill" } ], "INSDC first public": [ { "text": "2019-01-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-01-14T04:30:48.140Z" } ], "INSDC secondary accession": [ { "text": "SRS4248148" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4248148" } ], "cell type": [ { "text": "SGBS preadipocyte", "tag": "attribute" } ], "number cells": [ { "text": "50,000", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "preadipocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002334" ], "tag": "attribute" } ], "title": [ { "text": "SGBS_preadipocyte_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10737711", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-13T21:26:04.483Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10737711" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10737711{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10737711/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10737711/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10737711" } } }, { "name": "GSM3593228", "accession": "SAMN10882075", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-26T00:00:00Z", "update": "2022-03-31T05:05:58.975Z", "submitted": "2019-02-06T17:26:09.773Z", "characteristics": { "External Id": [ { "text": "SAMN10882075", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Montreal Heart Institute" } ], "INSDC first public": [ { "text": "2019-06-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-26T02:07:17.923Z" } ], "INSDC secondary accession": [ { "text": "SRS4337034" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4337034" } ], "cell type": [ { "text": "Human Coronary Artery Endothelial Cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "passages 7 to 9", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MP_0001914" ], "tag": "attribute" } ], "source_name": [ { "text": "Endothelial Cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000115" ], "tag": "attribute" } ], "title": [ { "text": "ATACseq_HCAEC_4h_r1" } ], "tnf-alpha treatment": [ { "text": "4h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10882075", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-06T17:26:09.773Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10882075" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10882075{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10882075/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10882075/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10882075" } } }, { "name": "GSM3603259", "accession": "SAMN10926448", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-15T00:00:00Z", "update": "2022-03-31T05:17:17.104Z", "submitted": "2019-02-13T15:08:06.447Z", "characteristics": { "External Id": [ { "text": "SAMN10926448", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Perelman School of Medicine at the University of Pennsylvania" } ], "INSDC first public": [ { "text": "2019-03-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-15T01:40:27.683Z" } ], "INSDC secondary accession": [ { "text": "SRS4361206" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4361206" } ], "cell type": [ { "text": "NeuN positive", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000540" ], "tag": "attribute" } ], "diagnosis": [ { "text": "FTD-ALS", "tag": "attribute" } ], "gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "genotype/variation": [ { "text": "TDP-43 positive", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Nuclei", "tag": "attribute" } ], "tissue": [ { "text": "Frontal cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001870" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq - NeuN positive/TDP-43 positive S6" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10926448", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-13T15:08:06.447Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10926448" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10926448{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10926448/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10926448/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10926448" } } }, { "name": "GSM3660284", "accession": "SAMN11082977", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-02-14T00:00:00Z", "update": "2022-03-31T06:10:42.327Z", "submitted": "2019-03-07T13:46:07.157Z", "characteristics": { "External Id": [ { "text": "SAMN11082977", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "WIMM, University of Oxford" } ], "INSDC first public": [ { "text": "2020-02-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-02-14T01:34:21.063Z" } ], "INSDC secondary accession": [ { "text": "SRS4463318" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4463318" } ], "cell type": [ { "text": "Th17", "tag": "attribute" } ], "day": [ { "text": "Day 0", "tag": "attribute" } ], "donor": [ { "text": "1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Th17", "tag": "attribute" } ], "title": [ { "text": "ATAC_D1_S1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11082977", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-07T13:46:07.157Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11082977" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11082977{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11082977/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11082977/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11082977" } } }, { "name": "GSM3670006", "accession": "SAMN11122076", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-18T00:00:00Z", "update": "2022-03-31T06:21:40.639Z", "submitted": "2019-03-13T16:27:12.127Z", "characteristics": { "External Id": [ { "text": "SAMN11122076", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Furnari, Pathology, UC San Diego" } ], "INSDC first public": [ { "text": "2019-12-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-18T02:02:19.640Z" } ], "INSDC secondary accession": [ { "text": "SRS4484427" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4484427" } ], "cell line": [ { "text": "Cal27", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Tongue", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001723" ], "tag": "attribute" } ], "tagmentation enzyme": [ { "text": "TDE1 Tagment DNA Enzyme, Illumina, #FC-121-1038", "tag": "attribute" } ], "title": [ { "text": "Cal27 ATAC-seq" } ], "tumor type": [ { "text": "HNSCC", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11122076", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-13T16:27:12.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11122076" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11122076{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11122076/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11122076/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11122076" } } }, { "name": "GSM3690746", "accession": "SAMN11282637", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-06T00:00:00Z", "update": "2022-03-31T07:28:44.280Z", "submitted": "2019-03-28T21:17:06.600Z", "characteristics": { "External Id": [ { "text": "SAMN11282637", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Unit of Functional Genomics in Psychiatry, Center for Psychiatric Genetics, NorthShore University HealthSystem" } ], "INSDC first public": [ { "text": "2020-05-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-05-06T01:19:19.793Z" } ], "INSDC secondary accession": [ { "text": "SRS4551668" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4551668" } ], "cell type": [ { "text": "iPS-derived Neural Progenitor Cell", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Neural Progenitor Cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000047" ], "tag": "attribute" } ], "title": [ { "text": "NSC_16_ATAC_Seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11282637", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-28T21:17:06.600Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11282637" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11282637{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11282637/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11282637/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11282637" } } }, { "name": "GSM3693104", "accession": "SAMN11290792", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-31T00:00:00Z", "update": "2022-03-31T07:31:26.650Z", "submitted": "2019-03-30T15:21:06.550Z", "characteristics": { "External Id": [ { "text": "SAMN11290792", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Salk Institute for Biological Studies" } ], "INSDC first public": [ { "text": "2019-03-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-31T01:53:31.310Z" } ], "INSDC secondary accession": [ { "text": "SRS4557136" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4557136" } ], "cell line": [ { "text": "MOLT-4", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001220" ], "tag": "attribute" } ], "disease state": [ { "text": "Adult T acute lymphoblastic leukemia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1001936" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "blood derived tumor cells", "tag": "attribute" } ], "title": [ { "text": "MOLT-4 (ATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11290792", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-30T15:21:06.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11290792" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11290792{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11290792/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11290792/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11290792" } } }, { "name": "GSM3713206", "accession": "SAMN11357740", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-23T00:00:00Z", "update": "2022-03-31T07:58:06.382Z", "submitted": "2019-04-08T10:18:10.480Z", "characteristics": { "External Id": [ { "text": "SAMN11357740", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Biology, Radboud Institute for Molecular Life Sciences" } ], "INSDC first public": [ { "text": "2019-05-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-23T01:55:17.657Z" } ], "INSDC secondary accession": [ { "text": "SRS4596682" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4596682" } ], "donor id": [ { "text": "human donor Donor2-D13", "tag": "attribute" } ], "genotype": [ { "text": "BAP1-/-", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BAP1-/- human organoids with 24 hr rescue of full length BAP1 expression", "tag": "attribute" } ], "tissue": [ { "text": "liver ductal organoids", "tag": "attribute" } ], "title": [ { "text": "hLiverOrganoids-ATACseq-V1-p53BAP1KO-FLrescue-D13-PB2newBAP1-8" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11357740", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-08T10:18:10.480Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11357740" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11357740{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11357740/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11357740/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11357740" } } }, { "name": "GSM3721973", "accession": "SAMN11414626", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-02T00:00:00Z", "update": "2022-03-31T08:15:06.898Z", "submitted": "2019-04-14T15:21:06.007Z", "characteristics": { "External Id": [ { "text": "SAMN11414626", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Obstetrics, Gynecology and Reproductive Biology, Michigan State University" } ], "INSDC first public": [ { "text": "2019-07-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-02T01:57:23.857Z" } ], "INSDC secondary accession": [ { "text": "SRS4620633" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4620633" } ], "cell line": [ { "text": "12Z endometriotic epithelial cells", "tag": "attribute" } ], "condition": [ { "text": "siARID1A knockdown", "tag": "attribute" } ], "genotype": [ { "text": "siARID1A knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "12Z cell line", "tag": "attribute" } ], "title": [ { "text": "A250_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11414626", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-14T15:21:06.007Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11414626" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11414626{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11414626/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11414626/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11414626" } } }, { "name": "lmnamutation_ipsec_atacseq_chunl", "accession": "SAMN11463459", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-17T00:50:08.023Z", "update": "2022-03-31T08:26:59.563Z", "submitted": "2019-04-18T15:54:03.950Z", "characteristics": { "External Id": [ { "text": "SAMN11463459", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University School of Medicine" } ], "INSDC first public": [ { "text": "2020-05-17T00:50:08.023Z" } ], "INSDC last update": [ { "text": "2020-05-17T00:50:08.023Z" } ], "INSDC secondary accession": [ { "text": "SRS4648279" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS4648279" } ], "age": [ { "text": "60", "tag": "attribute" } ], "biomaterial provider": [ { "text": "Stanford CVI biobank", "tag": "attribute" } ], "cell type": [ { "text": "Endothelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000115" ], "tag": "attribute" } ], "disease": [ { "text": "cardiolaminopathy", "tag": "attribute" } ], "isolate": [ { "text": "iPS cell line", "tag": "attribute" } ], "library": [ { "text": "5", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "tissue": [ { "text": "iPS cell line", "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11463459", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-18T15:54:03.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11463459" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11463459{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11463459/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11463459/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11463459" } } }, { "name": "GSM3791278", "accession": "SAMN11822486", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-06T00:00:00Z", "update": "2022-03-31T10:30:24.242Z", "submitted": "2019-05-22T09:31:12.933Z", "characteristics": { "External Id": [ { "text": "SAMN11822486", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Prof. Patrick Cramer, Molecular Biology, Max Planck Institute for Biophysical Chemistry" } ], "INSDC first public": [ { "text": "2020-05-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-05-06T01:28:17.410Z" } ], "INSDC secondary accession": [ { "text": "SRS4805118" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4805118" } ], "cell type": [ { "text": "RCH-ACV stably expressing estrogen inducible C/EBPa", "tag": "attribute" } ], "extract protocol": [ { "text": "Nextera Tn5 Transposase-1x NEBNext High-Fidelity 2x PCR Master Mix", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BLaER", "tag": "attribute" } ], "title": [ { "text": "ATAC_96h_rep1" } ], "treatment": [ { "text": "Beta-estradiol (100nM) treatment 96h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11822486", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-05-22T09:31:12.933Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822486" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822486{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822486/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822486/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11822486" } } }, { "name": "GSM3832924", "accession": "SAMN11893192", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-31T00:00:00Z", "update": "2022-03-31T11:06:45.570Z", "submitted": "2019-05-30T13:21:04.837Z", "characteristics": { "External Id": [ { "text": "SAMN11893192", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kundaje Lab, Biomedical Informatics, Stanford Unviersity" } ], "INSDC first public": [ { "text": "2019-05-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-31T03:54:19.030Z" } ], "INSDC secondary accession": [ { "text": "SRS4846716" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4846716" } ], "cell line": [ { "text": "MCF10A", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001200" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MCF10A mammary epithelial cells", "tag": "attribute" } ], "stiffness": [ { "text": "100Pa", "tag": "attribute" } ], "tissue culture substrate": [ { "text": "2D matrix", "tag": "attribute" } ], "title": [ { "text": "2D_Soft_rep2" } ] }, "submittedVia": "JSON_API", "create": "2019-05-30T13:21:04.837Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11893192" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11893192{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11893192/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11893192/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11893192" } } }, { "name": "GSM3893584", "accession": "SAMN12077980", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-23T00:00:00Z", "update": "2022-03-31T11:58:11.297Z", "submitted": "2019-06-17T11:26:04.627Z", "characteristics": { "External Id": [ { "text": "SAMN12077980", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "GIBH" } ], "INSDC first public": [ { "text": "2019-07-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-23T02:12:37.107Z" } ], "INSDC secondary accession": [ { "text": "SRS4979730" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4979730" } ], "cell line/strain": [ { "text": "H1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003042" ], "tag": "attribute" } ], "cell type": [ { "text": "hESCs derived Endothelial cells", "tag": "attribute" } ], "genotype": [ { "text": "H1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003042" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Endothelial cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000115" ], "tag": "attribute" } ], "title": [ { "text": "Vc-_GATA2+_ECs_rp2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12077980", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-06-17T11:26:04.627Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12077980" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12077980{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12077980/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12077980/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12077980" } } }, { "name": "GSM3902514", "accession": "SAMN12127387", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-16T00:00:00Z", "update": "2022-03-31T12:14:52.872Z", "submitted": "2019-06-24T12:22:06.257Z", "characteristics": { "External Id": [ { "text": "SAMN12127387", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Diabetes Research, Faculty of Medicine, Universite Libre de Bruxelles" } ], "INSDC first public": [ { "text": "2020-04-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-16T01:50:49.417Z" } ], "INSDC secondary accession": [ { "text": "SRS5018627" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5018627" } ], "cell line": [ { "text": "EndoC-BH1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "EndoC-BH1 cells", "tag": "attribute" } ], "timepoint": [ { "text": "24h", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_Experiment 4 - Interferon-alpha condition (24h)" } ], "treatment": [ { "text": "Interferon-alpha", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003021" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12127387", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-06-24T12:22:06.257Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12127387" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12127387{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12127387/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12127387/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12127387" } } }, { "name": "GSM3941189", "accession": "SAMN12275841", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-10-31T00:00:00Z", "update": "2022-03-31T12:51:45.888Z", "submitted": "2019-07-15T11:46:07.793Z", "characteristics": { "External Id": [ { "text": "SAMN12275841", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Research UK, Cambridge Institute" } ], "INSDC first public": [ { "text": "2019-10-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-10-31T03:06:21.040Z" } ], "INSDC secondary accession": [ { "text": "SRS5097460" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5097460" } ], "cell type": [ { "text": "ER+ Breast Cancer Cell Line", "tag": "attribute" } ], "genotype/variation": [ { "text": "MCF7 ARID1A knockout clone 11", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "35-45", "tag": "attribute" } ], "source_name": [ { "text": "MCF7-ARID1A_KO_Clone_11_ATAC-seq_4-hydroxy_Tamoxifen", "tag": "attribute" } ], "title": [ { "text": "MCF7-ARID1A_KO_Clone_11_4-hydroxy_tamoxifen_rep 4" } ], "treatment": [ { "text": "4-hydroxy tamoxifen", "tag": "attribute" } ] }, "submittedVia": "JSON_API", "create": "2019-07-15T11:46:07.793Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12275841" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12275841{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12275841/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12275841/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12275841" } } }, { "name": "GSM4008518", "accession": "SAMN12498860", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-25T00:00:00Z", "update": "2022-03-31T14:10:18.258Z", "submitted": "2019-08-05T15:21:14.230Z", "characteristics": { "External Id": [ { "text": "SAMN12498860", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Michigan" } ], "INSDC first public": [ { "text": "2020-06-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-25T01:44:17.277Z" } ], "INSDC secondary accession": [ { "text": "SRS5218891" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5218891" } ], "cell line": [ { "text": "H3.3K27M HSJD-DIPG007", "tag": "attribute" } ], "cell type": [ { "text": "DIPG cell line", "tag": "attribute" } ], "genotype": [ { "text": "Non targeted scrambled shRNA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DIPG cell line", "tag": "attribute" } ], "title": [ { "text": "2_3694Michigan_DIPG-007_Nontargeted" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12498860", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-08-05T15:21:14.230Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12498860" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12498860{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12498860/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12498860/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12498860" } } }, { "name": "GSM4008072", "accession": "SAMN12499211", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-10T00:00:00Z", "update": "2022-03-31T14:10:26.161Z", "submitted": "2019-08-05T16:06:10.333Z", "characteristics": { "External Id": [ { "text": "SAMN12499211", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Huang Lab, Department of Molecular Medicine, University of Texas Health Science Center at San Antonio" } ], "INSDC first public": [ { "text": "2020-11-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-10T01:50:49.993Z" } ], "INSDC secondary accession": [ { "text": "SRS5218567" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5218567" } ], "cell type": [ { "text": "Primary mammary epithelial cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "5", "tag": "attribute" } ], "source_name": [ { "text": "Human mammary epithelial cells (HMECs)", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001188" ], "tag": "attribute" } ], "title": [ { "text": "Mammary epithelial cell, U72_E04" } ], "treatment": [ { "text": "Untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12499211", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-08-05T16:06:10.333Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12499211" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12499211{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12499211/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12499211/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12499211" } } }, { "name": "GSM4021928", "accession": "SAMN12541232", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-05T00:00:00Z", "update": "2022-03-31T14:23:39.155Z", "submitted": "2019-08-08T20:11:05.113Z", "characteristics": { "External Id": [ { "text": "SAMN12541232", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Oncology, Johns Hopkins University" } ], "INSDC first public": [ { "text": "2020-05-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-05-05T01:40:38.307Z" } ], "INSDC secondary accession": [ { "text": "SRS5243097" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5243097" } ], "cell line": [ { "text": "HNSCC cell line SCC25", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "HNSCC cell line", "tag": "attribute" } ], "title": [ { "text": "SCC25PBS_replicate1" } ], "treatment": [ { "text": "PBS", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12541232", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-08-08T20:11:05.113Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12541232" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12541232{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12541232/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12541232/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12541232" } } }, { "name": "GSM4026149", "accession": "SAMN12558350", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-17T00:00:00Z", "update": "2022-03-31T14:27:39.687Z", "submitted": "2019-08-11T16:06:10.240Z", "characteristics": { "External Id": [ { "text": "SAMN12558350", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "GIBH" } ], "INSDC first public": [ { "text": "2021-08-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-17T07:38:43.970Z" } ], "INSDC secondary accession": [ { "text": "SRS5252680" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5252680" } ], "cell line/strain": [ { "text": "human embryonic stem cell H1", "tag": "attribute" } ], "cell type": [ { "text": "human embryonic stem cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002322" ], "tag": "attribute" } ], "genotype": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "human embryonic stem cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002322" ], "tag": "attribute" } ], "title": [ { "text": "hESC-rp2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN12558350", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-08-11T16:06:10.240Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12558350" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12558350{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12558350/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12558350/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12558350" } } }, { "name": "GSM4039968", "accession": "SAMN12607191", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-02T00:00:00Z", "update": "2022-03-31T14:41:08.925Z", "submitted": "2019-08-20T09:11:14.700Z", "characteristics": { "External Id": [ { "text": "SAMN12607191", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2020-07-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-02T03:13:23.110Z" } ], "INSDC secondary accession": [ { "text": "SRS5294209" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5294209" } ], "cell type": [ { "text": "glia", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000125" ], "tag": "attribute" } ], "gender": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "group": [ { "text": "heroin", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "putamen", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001874" ], "tag": "attribute" } ], "subject id": [ { "text": "343", "tag": "attribute" } ], "title": [ { "text": "glia heroin [343]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12607191", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-08-20T09:11:14.700Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12607191" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12607191{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12607191/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12607191/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12607191" } } }, { "name": "GSM4059716", "accession": "SAMN12691850", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-07T00:00:00Z", "update": "2022-03-31T15:10:05.636Z", "submitted": "2019-09-04T12:01:06.740Z", "characteristics": { "External Id": [ { "text": "SAMN12691850", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics and Genome Sciences, Case Western Reserve University" } ], "INSDC first public": [ { "text": "2021-01-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-07T01:51:36.447Z" } ], "INSDC secondary accession": [ { "text": "SRS5344221" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5344221" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HBE_ALI_6wk (DD0760)", "tag": "attribute" } ], "tissue": [ { "text": "Primary Human Bronchial Epithelium", "tag": "attribute" } ], "title": [ { "text": "AH759: HBE_ALI_6wk (DD0760)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN12691850", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12691850", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-04T12:01:06.740Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12691850" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12691850{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12691850/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12691850/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12691850" } } }, { "name": "GSM4078526", "accession": "SAMN12742334", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-17T00:00:00Z", "update": "2022-03-31T15:24:23.253Z", "submitted": "2019-09-13T09:26:10.900Z", "characteristics": { "External Id": [ { "text": "SAMN12742334", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Children's Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2020-11-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-17T02:39:16.677Z" } ], "INSDC secondary accession": [ { "text": "SRS5382781" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5382781" } ], "cell line": [ { "text": "BT12", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001092" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "3", "tag": "attribute" } ], "source_name": [ { "text": "Atypical Teratoid/Rhabdoid Tumor", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1002008" ], "tag": "attribute" } ], "timepoint": [ { "text": "18hours", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000032" ], "tag": "attribute" } ], "title": [ { "text": "BT12 cells, mithramycin 18h_C, ATAC-seq" } ], "treatment": [ { "text": "Mithramycin", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12742334", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-13T09:26:10.900Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12742334" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12742334{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12742334/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12742334/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12742334" } } }, { "name": "GSM4081678", "accession": "SAMN12771474", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-01T00:00:00Z", "update": "2023-05-14T08:05:37.955Z", "submitted": "2019-09-17T09:01:06.610Z", "characteristics": { "External Id": [ { "text": "SAMN12771474", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NIEHS" } ], "INSDC first public": [ { "text": "2022-07-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-01T02:28:03.700Z" } ], "INSDC secondary accession": [ { "text": "SRS5395848" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5395848" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Myometrium", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001296" ], "tag": "attribute" } ], "stage": [ { "text": "38-42 weeks estimated gestational age", "tag": "attribute" } ], "tissue": [ { "text": "myometrial tissue", "tag": "attribute" } ], "title": [ { "text": "Myometrial tissue, subject TP4 (ATAC-Seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12771474", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-09-17T09:01:06.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12771474" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12771474{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12771474/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12771474/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12771474" } } }, { "name": "GSM4083607", "accession": "SAMN12781042", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-10T00:00:00Z", "update": "2022-03-31T15:38:35.727Z", "submitted": "2019-09-18T10:51:11.620Z", "characteristics": { "External Id": [ { "text": "SAMN12781042", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "U1090 - TAGC, INSERM" } ], "INSDC first public": [ { "text": "2020-07-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-10T01:28:17.527Z" } ], "INSDC secondary accession": [ { "text": "SRS5402314" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5402314" } ], "cell type": [ { "text": "late cortical thymic subpopulation", "tag": "attribute" } ], "donor": [ { "text": "148", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "late cortical thymic subpopulation", "tag": "attribute" } ], "title": [ { "text": "TH148_LC_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12781042", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-18T10:51:11.620Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12781042" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12781042{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12781042/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12781042/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12781042" } } }, { "name": "GSM4089132", "accession": "SAMN12818063", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-21T00:00:00Z", "update": "2022-03-31T15:58:36.251Z", "submitted": "2019-09-23T06:41:10.060Z", "characteristics": { "External Id": [ { "text": "SAMN12818063", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Creyghton, Hubrecht Institute" } ], "INSDC first public": [ { "text": "2019-12-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-21T01:40:18.887Z" } ], "INSDC secondary accession": [ { "text": "SRS5420696" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5420696" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human Prefrontal Cortex", "tag": "attribute" } ], "tissue": [ { "text": "Human Prefrontal Cortex", "tag": "attribute" } ], "title": [ { "text": "Human_PrefrontalCortex_NeuNnegative_ATAC_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12818063", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-23T06:41:10.060Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818063" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818063{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818063/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818063/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12818063" } } }, { "name": "GSM4118753", "accession": "SAMN13018542", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-02-14T00:00:00Z", "update": "2022-03-31T16:53:53.548Z", "submitted": "2019-10-11T10:16:05.223Z", "characteristics": { "External Id": [ { "text": "SAMN13018542", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zhang, Developmental Biology, Washington University School of Medicine" } ], "INSDC first public": [ { "text": "2020-02-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-02-14T01:32:20.690Z" } ], "INSDC secondary accession": [ { "text": "SRS5505473" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5505473" } ], "cell type": [ { "text": "human trophoblast stem cell (hTSC)", "tag": "attribute" } ], "derived from": [ { "text": "blastocyst (BT5)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "10 to 20", "tag": "attribute" } ], "source_name": [ { "text": "hTSC", "tag": "attribute" } ], "title": [ { "text": "BT5 hTSC 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13018542", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-11T10:16:05.223Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13018542" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13018542{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13018542/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13018542/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13018542" } } }, { "name": "GSM4118997", "accession": "SAMN13019282", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-01T00:00:00Z", "update": "2022-03-31T16:54:09.665Z", "submitted": "2019-10-11T11:21:11.773Z", "characteristics": { "External Id": [ { "text": "SAMN13019282", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Centre for Genetics and Genomics Versus Arthritis, University of Manchester" } ], "INSDC first public": [ { "text": "2019-11-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-01-07T16:24:06.050Z" } ], "INSDC secondary accession": [ { "text": "SRS5955587" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5955587" } ], "cell type": [ { "text": "Primary CD4+ T-cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary CD4+ T-cells", "tag": "attribute" } ], "stimulation": [ { "text": "4hr CD3/CD28 Dynabeads", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq, Primary CD4+ T-cells, 4hr stimulated, replicates 1-3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13019282", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-11T11:21:11.773Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13019282" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13019282{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13019282/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13019282/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13019282" } } }, { "name": "GSM4130894", "accession": "SAMN13059000", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-24T00:00:00Z", "update": "2022-03-31T17:09:49.812Z", "submitted": "2019-10-18T13:31:07.660Z", "characteristics": { "External Id": [ { "text": "SAMN13059000", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2020-07-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-24T01:23:23.220Z" } ], "INSDC secondary accession": [ { "text": "SRS5543857" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5543857" } ], "disease": [ { "text": "chronic myelogenous leukemia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000339" ], "tag": "attribute" } ], "germ layer": [ { "text": "Mesoderm", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000926" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "bone marrow", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002371" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq_K562-1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13059000", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-18T13:31:07.660Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13059000" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13059000{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13059000/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13059000/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13059000" } } }, { "name": "GSM4138751", "accession": "SAMN13109377", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-23T00:00:00Z", "update": "2022-03-31T17:24:57.796Z", "submitted": "2019-10-24T15:11:13.090Z", "characteristics": { "External Id": [ { "text": "SAMN13109377", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biodata Mining & Discovery Section, Office of Science & Technology, NIAMS" } ], "INSDC first public": [ { "text": "2019-11-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-23T12:37:18.453Z" } ], "INSDC secondary accession": [ { "text": "SRS5569707" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5569707" } ], "cell type": [ { "text": "LDG", "tag": "attribute" } ], "diagnosis": [ { "text": "Lupus", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MONDO_0004670" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human whole blood", "tag": "attribute" } ], "title": [ { "text": "LDG_SLE_01_mat [ATAC-seq]" } ] }, "submittedVia": "JSON_API", "create": "2019-10-24T15:11:13.090Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13109377" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13109377{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13109377/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13109377/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13109377" } } }, { "name": "GSM4139410", "accession": "SAMN13112111", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-03T00:00:00Z", "update": "2022-03-31T17:26:31.566Z", "submitted": "2019-10-25T07:42:10.737Z", "characteristics": { "External Id": [ { "text": "SAMN13112111", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The University of Arizona" } ], "INSDC first public": [ { "text": "2020-06-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-03T01:34:15.180Z" } ], "INSDC secondary accession": [ { "text": "SRS5570677" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5570677" } ], "cell type": [ { "text": "human aortic endothelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002544" ], "tag": "attribute" } ], "donor id": [ { "text": "donor20", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "6 to 10", "tag": "attribute" } ], "source_name": [ { "text": "human aortic endothelial cell_untreated_ATAC-seq", "tag": "attribute" } ], "title": [ { "text": "donor20.atac_notx.rep1" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13112111", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-25T07:42:10.737Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112111" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112111{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112111/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112111/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13112111" } } }, { "name": "GSM4200800", "accession": "SAMN13451172", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-05T00:00:00Z", "update": "2022-03-31T19:22:59.046Z", "submitted": "2019-12-02T17:41:15.907Z", "characteristics": { "External Id": [ { "text": "SAMN13451172", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "LGI, National Cancer Institute, national institutes of health/hhs" } ], "INSDC first public": [ { "text": "2019-12-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-05T20:46:17.707Z" } ], "INSDC secondary accession": [ { "text": "SRS5753884" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5753884" } ], "cell type": [ { "text": "B lymphocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000945" ], "tag": "attribute" } ], "genotype": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "Ramos cell line", "tag": "attribute" } ], "strain": [ { "text": "Burkitt's lymphoma-derived cell line, EBV-negative", "tag": "attribute" } ], "title": [ { "text": "ATAC-Ramos.1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13451172", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-02T17:41:15.907Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13451172" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13451172{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13451172/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13451172/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13451172" } } }, { "name": "GSM4201674", "accession": "SAMN13471392", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-27T00:00:00Z", "update": "2022-03-31T19:31:29.559Z", "submitted": "2019-12-03T11:37:02.743Z", "characteristics": { "External Id": [ { "text": "SAMN13471392", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "POSTECH" } ], "INSDC first public": [ { "text": "2020-09-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-27T02:26:30.557Z" } ], "INSDC secondary accession": [ { "text": "SRS5758011" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5758011" } ], "description": [ { "text": "BMP4, 5 were knocked out in surrounding reconstituted CAF", "tag": "attribute" } ], "genotype": [ { "text": "wild type", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005168" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "7-10", "tag": "attribute" } ], "source_name": [ { "text": "Human bladder tumor organoid", "tag": "attribute" } ], "subtype": [ { "text": "luminal", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000306" ], "tag": "attribute" } ], "tissue": [ { "text": "Bladder tumor", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000294" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-seq from Luminal2/BMP k.o CAF" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13471392", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-03T11:37:02.743Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13471392" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13471392{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13471392/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13471392/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13471392" } } }, { "name": "GSM4210412", "accession": "SAMN13511214", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-02-11T00:00:00Z", "update": "2022-03-31T19:43:35.170Z", "submitted": "2019-12-09T08:13:07.393Z", "characteristics": { "External Id": [ { "text": "SAMN13511214", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pfizer, Oncology Research, Development, & Medical" } ], "INSDC first public": [ { "text": "2020-02-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-02-11T02:00:18.657Z" } ], "INSDC secondary accession": [ { "text": "SRS5783684" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5783684" } ], "cell type": [ { "text": "Naive T lymphocytes", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "96h PF-9927 activated CD3+", "tag": "attribute" } ], "tissue": [ { "text": "peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ] } ], "title": [ { "text": "96h PF-9927 activated CD3+ rep 1" } ], "treatment": [ { "text": "96h PF-9927", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13511214", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-09T08:13:07.393Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13511214" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13511214{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13511214/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13511214/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13511214" } } }, { "name": "GSM4210758", "accession": "SAMN13512667", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-10T00:00:00Z", "update": "2022-03-31T19:43:54.650Z", "submitted": "2019-12-09T10:21:05.780Z", "characteristics": { "External Id": [ { "text": "SAMN13512667", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stem Cell and Regenerative Biology, Harvard University" } ], "INSDC first public": [ { "text": "2019-12-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-10T02:19:34.413Z" } ], "INSDC secondary accession": [ { "text": "SRS5784033" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5784033" } ], "cell line": [ { "text": "HUES 8 hESC line", "tag": "attribute" } ], "cell type": [ { "text": "hPSC-derived poly-hormonal cell", "tag": "attribute" } ], "developmental stage": [ { "text": "Stage 6 week 3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HUES 8 hESC line", "tag": "attribute" } ], "title": [ { "text": "week3_PH_ATAC_rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13512667", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-09T10:21:05.780Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13512667" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13512667{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13512667/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13512667/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13512667" } } }, { "name": "GSM4223598", "accession": "SAMN13616499", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-23T00:00:00Z", "update": "2022-03-31T20:17:30.380Z", "submitted": "2019-12-17T17:33:04.217Z", "characteristics": { "External Id": [ { "text": "SAMN13616499", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "KU Leuven" } ], "INSDC first public": [ { "text": "2020-04-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-23T01:41:19.393Z" } ], "INSDC secondary accession": [ { "text": "SRS5849466" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5849466" } ], "cell line": [ { "text": "MM001", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005724" ], "tag": "attribute" } ], "condition": [ { "text": "TFAP2A_knock-down", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Melanoma cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0000849" ], "tag": "attribute" } ], "tissue type": [ { "text": "Cutaneous melanoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000389" ], "tag": "attribute" } ], "title": [ { "text": "OmniATAC-seq_MM001_TFAP2A_KD" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13616499", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-17T17:33:04.217Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13616499" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13616499{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13616499/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13616499/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13616499" } } }, { "name": "GSM4224432", "accession": "SAMN13624390", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-19T00:00:00Z", "update": "2022-03-31T20:19:48.590Z", "submitted": "2019-12-18T13:36:09.440Z", "characteristics": { "External Id": [ { "text": "SAMN13624390", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Ritchie Laboratory, Epigenetics and Development, Walter and Eliza Hall Institute of Medical Research" } ], "INSDC first public": [ { "text": "2019-12-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-19T04:26:17.977Z" } ], "INSDC secondary accession": [ { "text": "SRS5857002" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5857002" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "lung adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000571" ], "tag": "attribute" } ], "tissue": [ { "text": "mixture of 5 human lung adenocarcinoma cell lines: H2228, H1975, A549, H838 and HCC827", "tag": "attribute" } ], "title": [ { "text": "Lib10:H2228_H1975_A549_H838_HCC827_Mixture_10X_ATACSeq" } ] }, "submittedVia": "JSON_API", "create": "2019-12-18T13:36:09.440Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13624390" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13624390{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13624390/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13624390/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13624390" } } }, { "name": "GSM4238492", "accession": "SAMN13699408", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-02T00:00:00Z", "update": "2022-03-31T20:41:57.183Z", "submitted": "2019-12-30T11:20:06.593Z", "characteristics": { "External Id": [ { "text": "SAMN13699408", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2020-12-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-02T01:49:16.670Z" } ], "INSDC secondary accession": [ { "text": "SRS5922091" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5922091" } ], "biomaterial provider": [ { "text": "Coriell; https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=GM11906", "tag": "attribute" } ], "cell line": [ { "text": "GM11906", "tag": "attribute" } ], "cell type": [ { "text": "lymphoblastoid cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005292" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Coriell cell line", "tag": "attribute" } ], "title": [ { "text": "MERFF-63-S76" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13699408", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-30T11:20:06.593Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13699408" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13699408{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13699408/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13699408/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13699408" } } }, { "name": "GSM4249094", "accession": "SAMN13719297", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-17T00:00:00Z", "update": "2023-05-14T12:24:54.807Z", "submitted": "2020-01-03T15:07:04.840Z", "characteristics": { "External Id": [ { "text": "SAMN13719297", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hoffman Lab, Princess Margaret Cancer Centre, University Health Network" } ], "INSDC first public": [ { "text": "2022-03-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-17T01:23:18.023Z" } ], "INSDC secondary accession": [ { "text": "SRS5939949" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5939949" } ], "cell line": [ { "text": "Caski", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sequencing type": [ { "text": "Paired", "tag": "attribute" } ], "source_name": [ { "text": "Caski", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_Caski" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13719297", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-01-03T15:07:04.840Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13719297" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13719297{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13719297/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13719297/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13719297" } } }, { "name": "GSM4259665", "accession": "SAMN13825206", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-09T00:00:00Z", "update": "2022-03-31T21:22:14.674Z", "submitted": "2020-01-10T14:06:13.537Z", "characteristics": { "External Id": [ { "text": "SAMN13825206", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Translational Research Institute, Adventhealth" } ], "INSDC first public": [ { "text": "2020-06-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-09T02:53:15.660Z" } ], "INSDC secondary accession": [ { "text": "SRS5979195" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5979195" } ], "body type": [ { "text": "apple", "tag": "attribute" } ], "cell type": [ { "text": "adipocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000136" ], "tag": "attribute" } ], "fat depot": [ { "text": "subcutaneous abdominal fat", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "source_name": [ { "text": "subcutaneous abdominal fat", "tag": "attribute" } ], "title": [ { "text": "ATACseq_Sub9_ABD_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13825206", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-01-10T14:06:13.537Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13825206" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13825206{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13825206/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13825206/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13825206" } } }, { "name": "GSM4271834", "accession": "SAMN13862411", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-08-21T00:00:00Z", "update": "2022-03-31T21:33:57.967Z", "submitted": "2020-01-14T19:06:42.113Z", "characteristics": { "External Id": [ { "text": "SAMN13862411", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2020-08-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-08-21T06:23:24.150Z" } ], "INSDC secondary accession": [ { "text": "SRS6001247" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6001247" } ], "age of death": [ { "text": "20", "tag": "attribute" } ], "alcohol toxicology": [ { "text": "negative", "tag": "attribute" } ], "cause of death": [ { "text": "sudden cardiac death", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004278" ], "tag": "attribute" } ], "cell type": [ { "text": "glutamatergic neurons", "tag": "attribute" } ], "gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "primary visual cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002436" ], "tag": "attribute" } ], "tissue": [ { "text": "primary visual cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002436" ], "tag": "attribute" } ], "title": [ { "text": "S2_GLU_PVC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13862411", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-01-14T19:06:42.113Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13862411" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13862411{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13862411/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13862411/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13862411" } } }, { "name": "GSM4287834", "accession": "SAMN13938363", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-03T00:00:00Z", "update": "2023-05-14T13:14:40.514Z", "submitted": "2020-01-28T17:46:11.083Z", "characteristics": { "External Id": [ { "text": "SAMN13938363", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of California, Irvine" } ], "INSDC first public": [ { "text": "2022-09-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-09-03T01:27:26.907Z" } ], "INSDC secondary accession": [ { "text": "SRS6074591" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6074591" } ], "cell line": [ { "text": "143B", "tag": "attribute" } ], "cell type": [ { "text": "Osteosarcoma cell line", "tag": "attribute" } ], "experimental condition": [ { "text": "Non-targeting CRISPR", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "osteosarcoma cell line", "tag": "attribute" } ], "title": [ { "text": "143B CRISPR-VO [ATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN13938363", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-01-28T17:46:11.083Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13938363" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13938363{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13938363/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13938363/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13938363" } } }, { "name": "GSM4298982", "accession": "SAMN14048750", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-01T00:00:00Z", "update": "2022-03-31T22:42:47.887Z", "submitted": "2020-02-06T07:57:06.787Z", "characteristics": { "External Id": [ { "text": "SAMN14048750", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Boston Children's Hospital" } ], "INSDC first public": [ { "text": "2021-02-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-01T02:42:49.743Z" } ], "INSDC secondary accession": [ { "text": "SRS6112123" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6112123" } ], "cell line": [ { "text": "SUIT-2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006495" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SUIT-2 cells", "tag": "attribute" } ], "title": [ { "text": "SUIT-2_Reverse_Adapted_ATAC_clone4" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14048750", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14048750", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-06T07:57:06.787Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14048750" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14048750{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14048750/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14048750/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14048750" } } }, { "name": "GSM4299082", "accession": "SAMN14049740", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-10T00:00:00Z", "update": "2022-03-31T22:42:53.963Z", "submitted": "2020-02-06T09:27:15.463Z", "characteristics": { "External Id": [ { "text": "SAMN14049740", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bioinformatics, Genentech Inc." } ], "INSDC first public": [ { "text": "2020-09-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-10T03:05:16.093Z" } ], "INSDC secondary accession": [ { "text": "SRS6112223" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6112223" } ], "cell line": [ { "text": "lung cancer cell line NCI-H1944", "tag": "attribute" } ], "construct": [ { "text": "Cells transduced with pLenti6.3-SMARCA4-K785R, selected with 8ug/mL blasticidin for 5 days.", "tag": "attribute" } ], "hairpin": [ { "text": "After blasticidin selection, cells were infected with pLKO-shSMARCA2. Cells were selected for 72 h with 3ug/mL puromycin.", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample id": [ { "text": "SAM24358275", "tag": "attribute" } ], "source_name": [ { "text": "NCI-H1944 cells", "tag": "attribute" } ], "title": [ { "text": "H1944_K785R_shSMARCA2_R1 (ATAC-seq)" } ] }, "submittedVia": "JSON_API", "create": "2020-02-06T09:27:15.463Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14049740" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14049740{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14049740/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14049740/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14049740" } } }, { "name": "GSM4308128", "accession": "SAMN14088506", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-02-26T00:00:00Z", "update": "2022-03-31T22:51:33.835Z", "submitted": "2020-02-12T12:26:07.127Z", "characteristics": { "External Id": [ { "text": "SAMN14088506", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Functional Genomics Center Zurich, ETH/University of Zurich" } ], "INSDC first public": [ { "text": "2020-02-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-02-26T02:18:25.117Z" } ], "INSDC secondary accession": [ { "text": "SRS6136550" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6136550" } ], "cell type": [ { "text": "organoids", "tag": "attribute" } ], "genotype": [ { "text": "APC-KO, SMARCA4-KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SMARCA4_CTRL_ATAC-seq", "tag": "attribute" } ], "tissue": [ { "text": "Human small intestine", "tag": "attribute" } ], "title": [ { "text": "SMARCA4_CTRL_atacseq_REP1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14088506", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-12T12:26:07.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14088506" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14088506{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14088506/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14088506/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14088506" } } }, { "name": "GSM4317807", "accession": "SAMN14122096", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-02-18T00:00:00Z", "update": "2022-03-31T22:59:09.039Z", "submitted": "2020-02-17T18:06:04.013Z", "characteristics": { "External Id": [ { "text": "SAMN14122096", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biochemistry & Molecular Genetics, University of Virginia" } ], "INSDC first public": [ { "text": "2020-02-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-02-18T07:54:20.320Z" } ], "INSDC secondary accession": [ { "text": "SRS6156050" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6156050" } ], "cell type": [ { "text": "OVCAR8", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005444" ], "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "10-15", "tag": "attribute" } ], "source_name": [ { "text": "OVCAR8", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005444" ], "tag": "attribute" } ], "title": [ { "text": "Ovarian cancer cell line" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14122096", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-17T18:06:04.013Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14122096" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14122096{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14122096/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14122096/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14122096" } } }, { "name": "GSM4340227", "accession": "SAMN14212260", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-18T00:00:00Z", "update": "2022-03-31T23:27:01.273Z", "submitted": "2020-02-26T10:34:10.940Z", "characteristics": { "External Id": [ { "text": "SAMN14212260", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jing Qu, Institute of Zoology, Chinese Academy of Sciences, State Key Laboratory of Stem Cell and Reproductive Biology" } ], "INSDC first public": [ { "text": "2020-06-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-18T02:27:19.070Z" } ], "INSDC secondary accession": [ { "text": "SRS6218994" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6218994" } ], "cell type": [ { "text": "Neural stem cells", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "p5", "tag": "attribute" } ], "source_name": [ { "text": "Neural stem cells", "tag": "attribute" } ], "title": [ { "text": "ATAC sequencing of hNSCs [ATAC-NSC_rep1]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14212260", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-26T10:34:10.940Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212260" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212260{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212260/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212260/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14212260" } } }, { "name": "GSM4391896", "accession": "SAMN14322350", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-16T00:00:00Z", "update": "2022-04-01T00:00:59.767Z", "submitted": "2020-03-06T17:02:10.410Z", "characteristics": { "External Id": [ { "text": "SAMN14322350", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology Program, Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2021-11-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-16T01:24:41.763Z" } ], "INSDC secondary accession": [ { "text": "SRS6274942" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6274942" } ], "cell line": [ { "text": "JHRCC12", "tag": "attribute" } ], "genotype": [ { "text": "SETD2-deficient", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Clear cell renal cell carcinoma cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000349" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq JHRCC12_SETD2_mut_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14322350", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-06T17:02:10.410Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322350" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322350{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322350/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322350/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14322350" } } }, { "name": "GSM4409138", "accession": "SAMN14367258", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-22T00:00:00Z", "update": "2022-04-01T00:16:03.659Z", "submitted": "2020-03-12T14:07:05.620Z", "characteristics": { "External Id": [ { "text": "SAMN14367258", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Idoyaga Lab, Microbiology & Immunology, Stanford University" } ], "INSDC first public": [ { "text": "2020-09-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-22T03:22:15.560Z" } ], "INSDC secondary accession": [ { "text": "SRS6310516" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6310516" } ], "cell type": [ { "text": "cDC2", "tag": "attribute" } ], "dataset": [ { "text": "1", "tag": "attribute" } ], "donor id": [ { "text": "Donor3", "tag": "attribute" } ], "donor sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sequencing batch": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "peripheral blood mononuclear cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "title": [ { "text": "cDC2_D3_rep2" } ] }, "submittedVia": "JSON_API", "create": "2020-03-12T14:07:05.620Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14367258" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14367258{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14367258/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14367258/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14367258" } } }, { "name": "GSM4425560", "accession": "SAMN14418622", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-16T00:00:00Z", "update": "2022-04-01T00:32:07.072Z", "submitted": "2020-03-20T16:57:13.270Z", "characteristics": { "External Id": [ { "text": "SAMN14418622", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Immunology, UT Southwestern Medical Center" } ], "INSDC first public": [ { "text": "2021-03-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-16T01:40:19.257Z" } ], "INSDC secondary accession": [ { "text": "SRS6349365" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6349365" } ], "cell type": [ { "text": "Human monocyte-derived macrophages", "tag": "attribute" } ], "donor number": [ { "text": "D6", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human monocyte-derived macrophages", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_D6_MDMs_LPS_6h" } ], "treatment": [ { "text": "LPS-6h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14418622", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14418622", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-20T16:57:13.270Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14418622" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14418622{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14418622/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14418622/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14418622" } } }, { "name": "GSM4437172", "accession": "SAMN14469262", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-18T00:00:00Z", "update": "2022-04-01T00:47:05.422Z", "submitted": "2020-03-27T12:57:05.223Z", "characteristics": { "External Id": [ { "text": "SAMN14469262", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The University of Melbourne" } ], "INSDC first public": [ { "text": "2020-05-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-05-18T01:27:30.313Z" } ], "INSDC secondary accession": [ { "text": "SRS6386484" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6386484" } ], "cell type": [ { "text": "human naive induced pluripotent stem cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "Passage 10", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MP_0001914" ], "tag": "attribute" } ], "source_name": [ { "text": "human fibroblasts", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000042" ], "tag": "attribute" } ], "title": [ { "text": "ATAC_P10_NM_REP_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14469262", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-27T12:57:05.223Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14469262" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14469262{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14469262/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14469262/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14469262" } } }, { "name": "GSM4441727", "accession": "SAMN14479871", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-27T00:00:00Z", "update": "2022-04-01T00:50:41.262Z", "submitted": "2020-03-28T18:04:08.613Z", "characteristics": { "External Id": [ { "text": "SAMN14479871", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kundaje Lab, Biomedical Informatics, Stanford Unviersity" } ], "INSDC first public": [ { "text": "2020-07-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-27T01:29:19.127Z" } ], "INSDC secondary accession": [ { "text": "SRS6393568" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6393568" } ], "brain region": [ { "text": "Hippocampus", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002421" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary brain samples acquired post-mortem, Hippocampus", "tag": "attribute" } ], "tissue": [ { "text": "brain", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000955" ], "tag": "attribute" } ], "title": [ { "text": "BulkATAC Control Hippocampus 3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14479871", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-28T18:04:08.613Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14479871" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14479871{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14479871/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14479871/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14479871" } } }, { "name": "GSM4459514", "accession": "SAMN14556325", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-08T00:00:00Z", "update": "2022-04-01T01:15:34.279Z", "submitted": "2020-04-07T22:37:05.873Z", "characteristics": { "External Id": [ { "text": "SAMN14556325", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gertz, University of Utah" } ], "INSDC first public": [ { "text": "2020-04-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-08T03:56:21.507Z" } ], "INSDC secondary accession": [ { "text": "SRS6448669" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6448669" } ], "esr1 genotype": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "lab of origin": [ { "text": "Gertz", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "parental cell line": [ { "text": "T-47D", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001247" ], "tag": "attribute" } ], "source_name": [ { "text": "mammary gland ductal carcinoma", "tag": "attribute" } ], "title": [ { "text": "T47D_WT_clone2_E2_ATACseq" } ], "treatment": [ { "text": "10 nM E2 1hr", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14556325", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-07T22:37:05.873Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14556325" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14556325{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14556325/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14556325/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14556325" } } }, { "name": "GSM4460586", "accession": "SAMN14560635", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-06T00:00:00Z", "update": "2022-04-01T01:16:39.873Z", "submitted": "2020-04-08T15:46:13.443Z", "characteristics": { "External Id": [ { "text": "SAMN14560635", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Warnatz Lab, Department of Rheumatology and clinical immunology, University Medical Center Freiburg" } ], "INSDC first public": [ { "text": "2021-08-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-06T02:12:00.970Z" } ], "INSDC secondary accession": [ { "text": "SRS6451237" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6451237" } ], "cell type": [ { "text": "CD21positive naive B cells", "tag": "attribute" } ], "health status": [ { "text": "CVID patient", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "primary cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002660" ], "tag": "attribute" } ], "title": [ { "text": "CVID3_21pos" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14560635", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14560635", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-08T15:46:13.443Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14560635" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14560635{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14560635/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14560635/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14560635" } } }, { "name": "GSM4463083", "accession": "SAMN14567275", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-19T00:00:00Z", "update": "2022-04-01T01:18:40.559Z", "submitted": "2020-04-09T10:53:08.773Z", "characteristics": { "External Id": [ { "text": "SAMN14567275", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UC San Diego" } ], "INSDC first public": [ { "text": "2021-10-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-19T02:01:39.773Z" } ], "INSDC secondary accession": [ { "text": "SRS6456796" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6456796" } ], "cell line": [ { "text": "Cyt49", "tag": "attribute" } ], "cell type": [ { "text": "differentiated hESCs", "tag": "attribute" } ], "developmental stage": [ { "text": "Late pancreatic progenitor", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cyt49 shPDX1", "tag": "attribute" } ], "title": [ { "text": "Cyt49_PP2_shPDX1.ATAC-Seq.replicate.2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14567275", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-09T10:53:08.773Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14567275" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14567275{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14567275/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14567275/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14567275" } } }, { "name": "GSM4468010", "accession": "SAMN14568362", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-13T00:00:00Z", "update": "2022-04-01T01:19:04.111Z", "submitted": "2020-04-09T14:31:22.437Z", "characteristics": { "External Id": [ { "text": "SAMN14568362", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Janssen R&D LLC" } ], "INSDC first public": [ { "text": "2020-11-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-13T04:07:20.340Z" } ], "INSDC secondary accession": [ { "text": "SRS6457535" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6457535" } ], "cell type": [ { "text": "Fibroblast like Synoviocytes", "tag": "attribute" } ], "diagnosis": [ { "text": "Rheumatoid arthritis", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000685" ], "tag": "attribute" } ], "donor": [ { "text": "1387", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Fibroblast like Synoviocytes", "tag": "attribute" } ], "title": [ { "text": "DMSO_IL1b_1387" } ], "treatment": [ { "text": "DMSO and IL1b", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14568362", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-09T14:31:22.437Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14568362" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14568362{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14568362/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14568362/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14568362" } } }, { "name": "GSM4490600", "accession": "SAMN14668587", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-20T00:00:00Z", "update": "2023-05-18T05:01:25.308Z", "submitted": "2020-04-22T11:21:23.830Z", "characteristics": { "External Id": [ { "text": "SAMN14668587", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "INSERM" } ], "INSDC first public": [ { "text": "2023-04-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-20T01:19:18.140Z" } ], "INSDC secondary accession": [ { "text": "SRS6517719" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6517719" } ], "cell type": [ { "text": "ROSA Kit D816V mast cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "10 to 15", "tag": "attribute" } ], "source_name": [ { "text": "Mast cells", "tag": "attribute" } ], "title": [ { "text": "D816+NAG-2" } ], "treatment": [ { "text": "20 mM NAG (or GlcNAc) for 24h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14668587", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-04-22T11:21:23.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14668587" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14668587{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14668587/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14668587/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14668587" } } }, { "name": "GSM4491145", "accession": "SAMN14671335", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-23T00:00:00Z", "update": "2022-04-01T01:53:50.750Z", "submitted": "2020-04-22T15:56:23.190Z", "characteristics": { "External Id": [ { "text": "SAMN14671335", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NYU Langone Health" } ], "INSDC first public": [ { "text": "2020-04-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-23T03:04:25.603Z" } ], "INSDC secondary accession": [ { "text": "SRS6519905" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6519905" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "B-ALL cell line", "tag": "attribute" } ], "tissue": [ { "text": "bone marrow", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002371" ], "tag": "attribute" } ], "title": [ { "text": "RS411 NT" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14671335", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-22T15:56:23.190Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671335" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671335{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671335/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671335/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14671335" } } }, { "name": "GSM4506445", "accession": "SAMN14777640", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-08-01T00:00:00Z", "update": "2022-04-01T02:32:45.083Z", "submitted": "2020-04-30T10:51:05.743Z", "characteristics": { "External Id": [ { "text": "SAMN14777640", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stephen Dalton, Biochemistry and Molecular Biology, Center for Molecular Medicine, University of Georgia" } ], "INSDC first public": [ { "text": "2020-08-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-08-01T02:40:43.323Z" } ], "INSDC secondary accession": [ { "text": "SRS6572925" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6572925" } ], "cell identity": [ { "text": "Brown adipocytes differentiated from H9ESC derived paraxial mesoderm at differentiation time point day 8", "tag": "attribute" } ], "differentiation method": [ { "text": "Brown adipocytes differentition using defined differentiation medium as described in the protocol section.", "tag": "attribute" } ], "differentiation stage": [ { "text": "BA-Day8", "tag": "attribute" } ], "molecule subtype": [ { "text": "Tn5-transposases-tagged genomic DNA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Derived from human embryonic stem cells (WA09 WiCell, WAe009-A)", "tag": "attribute" } ], "title": [ { "text": "H9ESC_BA_Day8 [ATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14777640", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-30T10:51:05.743Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14777640" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14777640{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14777640/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14777640/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14777640" } } }, { "name": "GSM4558339", "accession": "SAMN14945322", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-01T00:00:00Z", "update": "2022-04-01T03:23:20.187Z", "submitted": "2020-05-18T11:41:11.443Z", "characteristics": { "External Id": [ { "text": "SAMN14945322", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2020-07-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-01T05:02:22.390Z" } ], "INSDC secondary accession": [ { "text": "SRS6674367" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6674367" } ], "cell line": [ { "text": "Human Coronary Artery Smooth Muscle Cells (HCASMC)", "tag": "attribute" } ], "genotype/treatment": [ { "text": "AHR knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HCASMC_ATAC-Seq AHR KD", "tag": "attribute" } ], "tissue": [ { "text": "coronary artery", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001621" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq AHR KD" } ] }, "submittedVia": "JSON_API", "create": "2020-05-18T11:41:11.443Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14945322" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14945322{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14945322/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14945322/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14945322" } } }, { "name": "GSM4564167", "accession": "SAMN14994176", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-31T00:00:00Z", "update": "2022-04-01T03:42:10.692Z", "submitted": "2020-05-21T16:21:08.977Z", "characteristics": { "External Id": [ { "text": "SAMN14994176", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology and Laboratory Medicine, University of North Carolina at Chapel Hill" } ], "INSDC first public": [ { "text": "2020-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-31T11:03:19.547Z" } ], "INSDC secondary accession": [ { "text": "SRS6693637" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6693637" } ], "cell line": [ { "text": "BIN67", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell Line", "tag": "attribute" } ], "title": [ { "text": "BIN67_Control_ATACseq_Rep1" } ], "transfected vector": [ { "text": "Control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14994176", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-21T16:21:08.977Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14994176" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14994176{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14994176/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14994176/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14994176" } } }, { "name": "CTRL-D4-2", "accession": "SAMN15087049", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-09T00:50:39.093Z", "update": "2022-04-01T04:22:30.917Z", "submitted": "2020-06-02T21:23:04.610Z", "characteristics": { "External Id": [ { "text": "SAMN15087049", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University School of Medicine" } ], "INSDC first public": [ { "text": "2020-06-09T00:50:39.093Z" } ], "INSDC last update": [ { "text": "2020-06-09T00:50:39.093Z" } ], "INSDC secondary accession": [ { "text": "SRS6757975" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS6757975" } ], "age": [ { "text": "30-40", "tag": "attribute" } ], "biomaterial provider": [ { "text": "Yang Lab, Stanford Emergency Department", "tag": "attribute" } ], "cell type": [ { "text": "neutrophils", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000775" ], "tag": "attribute" } ], "description": [ { "text": "Healthy untreated neutrophils" } ], "isolate": [ { "text": "D4", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002051" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "tissue": [ { "text": "blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ], "treatment": [ { "text": "Control Donor 4-2", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15087049", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-02T21:23:04.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15087049" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15087049{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15087049/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15087049/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15087049" } } }, { "name": "GSM4589708", "accession": "SAMN15096394", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-01T00:00:00Z", "update": "2022-04-01T04:30:50.156Z", "submitted": "2020-06-03T14:51:05.160Z", "characteristics": { "External Id": [ { "text": "SAMN15096394", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "zhengzhou university" } ], "INSDC first public": [ { "text": "2021-06-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-01T02:38:19.960Z" } ], "INSDC secondary accession": [ { "text": "SRS6767240" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6767240" } ], "cell type": [ { "text": "PB-derived HSC cultured cells", "tag": "attribute" } ], "developmental stage": [ { "text": "polychromatic", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "polychromatic erythroblasts", "tag": "attribute" } ], "title": [ { "text": "HDAC5kd_poly_1 [ATAC-Seq]" } ], "treatment": [ { "text": "HDAC5 knockdown", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15096394", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-03T14:51:05.160Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15096394" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15096394{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15096394/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15096394/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15096394" } } }, { "name": "GSM4618472", "accession": "SAMN15249460", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-20T00:00:00Z", "update": "2022-04-01T05:42:54.210Z", "submitted": "2020-06-16T12:21:06.600Z", "characteristics": { "External Id": [ { "text": "SAMN15249460", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UC San Diego" } ], "INSDC first public": [ { "text": "2021-01-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-20T04:14:30.390Z" } ], "INSDC secondary accession": [ { "text": "SRS6849667" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6849667" } ], "cell type": [ { "text": "differentiated hESCs", "tag": "attribute" } ], "development stage": [ { "text": "Gut tube cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cyt49 Control", "tag": "attribute" } ], "title": [ { "text": "Cyt49_GT.ATAC-Seq.replicate.1.merged" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15249460", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-16T12:21:06.600Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15249460" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15249460{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15249460/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15249460/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15249460" } } }, { "name": "GSM4625362", "accession": "SAMN15313622", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-01T00:00:00Z", "update": "2022-04-01T06:24:30.957Z", "submitted": "2020-06-18T09:11:13.520Z", "characteristics": { "External Id": [ { "text": "SAMN15313622", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "IIHG, University of Iowa" } ], "INSDC first public": [ { "text": "2020-12-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-01T02:05:20.250Z" } ], "INSDC secondary accession": [ { "text": "SRS6864555" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6864555" } ], "cell line": [ { "text": "SW872 liposarcoma cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SW872 liposarcoma cells ATCC", "tag": "attribute" } ], "title": [ { "text": "SW872 CAMTA1 replicate 1 (atacseq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15313622", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-18T09:11:13.520Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15313622" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15313622{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15313622/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15313622/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15313622" } } }, { "name": "GSM4629066", "accession": "SAMN15332213", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-29T00:00:00Z", "update": "2022-04-01T06:33:04.084Z", "submitted": "2020-06-20T12:36:06.280Z", "characteristics": { "External Id": [ { "text": "SAMN15332213", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Rabinovitch, Pediatrics, Stanford University" } ], "INSDC first public": [ { "text": "2021-05-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-29T01:28:17.630Z" } ], "INSDC secondary accession": [ { "text": "SRS6880073" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6880073" } ], "cell type": [ { "text": "Pulmonary artery endothelial cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Pulmonary artery endothelial cells", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_Pulmonary artery endothelial cells - LSS_siKLF_RepA" } ], "treatment": [ { "text": "siRNA targeting KLF2/4", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15332213", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-20T12:36:06.280Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15332213" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15332213{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15332213/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15332213/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15332213" } } }, { "name": "GSM4633142", "accession": "SAMN15345787", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-17T00:00:00Z", "update": "2022-04-01T06:37:50.930Z", "submitted": "2020-06-22T21:56:08.217Z", "characteristics": { "External Id": [ { "text": "SAMN15345787", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Xiling Shen, BME, Duke University" } ], "INSDC first public": [ { "text": "2021-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-17T01:14:17.497Z" } ], "INSDC secondary accession": [ { "text": "SRS6890441" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6890441" } ], "morphology": [ { "text": "epithelial", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HT29", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001193" ], "tag": "attribute" } ], "tissue": [ { "text": "Liver Metastases", "tag": "attribute" } ], "title": [ { "text": "HT29_LM_3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15345787", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-22T21:56:08.217Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15345787" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15345787{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15345787/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15345787/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15345787" } } }, { "name": "GSM4636524", "accession": "SAMN15367235", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-27T00:00:00Z", "update": "2022-04-01T06:47:48.953Z", "submitted": "2020-06-25T10:01:06.273Z", "characteristics": { "External Id": [ { "text": "SAMN15367235", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Applied Bioinformatics, St Jude Children's Research Hosipital" } ], "INSDC first public": [ { "text": "2021-08-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-27T19:15:36.820Z" } ], "INSDC secondary accession": [ { "text": "SRS6905025" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6905025" } ], "cell line": [ { "text": "SEM", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002326" ], "tag": "attribute" } ], "cell type": [ { "text": "Human B Lineage Acute Lymphoblastic Leukemia SEM cell carrying bi-allelic miniAID-mClover3 knockin tags", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SEM cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC-SEM-CTCF-AID_no_IAA Replicate 27" } ], "treatment": [ { "text": "no", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15367235", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-25T10:01:06.273Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15367235" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15367235{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15367235/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15367235/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15367235" } } }, { "name": "GSM4663519", "accession": "SAMN15489500", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-11T00:00:00Z", "update": "2022-04-01T07:38:09.812Z", "submitted": "2020-07-09T07:36:14.327Z", "characteristics": { "External Id": [ { "text": "SAMN15489500", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kundakovic Lab, Biological Sciences, Fordham University" } ], "INSDC first public": [ { "text": "2021-03-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-12T01:26:07.293Z" } ], "INSDC secondary accession": [ { "text": "SRS6974720" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6974720" } ], "age of death": [ { "text": "49", "tag": "attribute" } ], "brain bank tissue source": [ { "text": "HBCC", "tag": "attribute" } ], "dx": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "individual id": [ { "text": "1927", "tag": "attribute" } ], "manner of death": [ { "text": "natural", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "ph": [ { "text": "6.14", "tag": "attribute" } ], "race": [ { "text": "African American", "ontologyTerms": [ "http://purl.obolibrary.org/obo/HANCESTRO_0568" ], "tag": "attribute" } ], "source_name": [ { "text": "FACS-sorted neuronal (NeuN+) nuclei", "tag": "attribute" } ], "tissue": [ { "text": "anterior cingulate cortex (ACC)", "tag": "attribute" } ], "title": [ { "text": "1927_ACC_AP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15489500", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15489500", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-07-09T07:36:14.327Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15489500" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15489500{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15489500/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15489500/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15489500" } } }, { "name": "MDA-MB-231", "accession": "SAMN15815142", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-24T00:00:00Z", "update": "2022-04-01T09:36:21.460Z", "submitted": "2020-08-13T21:17:05.756Z", "characteristics": { "External Id": [ { "text": "SAMN15815142", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Silesian University of Technology" } ], "INSDC first public": [ { "text": "2020-09-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-24T06:58:01.683Z" } ], "INSDC secondary accession": [ { "text": "SRS7377490" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS7377490" } ], "biomaterial provider": [ { "text": "Lajos Pusztai, Yale Cancer Center", "tag": "attribute" } ], "cell line": [ { "text": "MDA-MB-231", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001209" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "tissue": [ { "text": "breast cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000305" ], "tag": "attribute" } ], "title": [ { "text": "Single-cell RNA sequencing on 10X Chromium platform" } ] }, "submittedVia": "JSON_API", "create": "2020-08-13T21:17:05.756Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15815142" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15815142{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15815142/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15815142/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15815142" } } }, { "name": "GSM4728670", "accession": "SAMN15825308", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-31T00:00:00Z", "update": "2022-04-01T09:43:02.308Z", "submitted": "2020-08-15T11:31:13Z", "characteristics": { "External Id": [ { "text": "SAMN15825308", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mayo Clinic" } ], "INSDC first public": [ { "text": "2021-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-31T02:35:24.117Z" } ], "INSDC secondary accession": [ { "text": "SRS7207188" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7207188" } ], "cell line": [ { "text": "451Lu", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002828" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "parental or resistant": [ { "text": "parental", "tag": "attribute" } ], "source_name": [ { "text": "Melanoma cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0000849" ], "tag": "attribute" } ], "title": [ { "text": "ATAC_451Lu_Parental_Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15825308", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-08-15T11:31:13Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825308" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825308{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825308/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825308/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15825308" } } }, { "name": "GSM4729162", "accession": "SAMN15831819", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-31T00:00:00Z", "update": "2022-04-01T09:44:50.616Z", "submitted": "2020-08-17T10:46:12.247Z", "characteristics": { "External Id": [ { "text": "SAMN15831819", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hideo Watanabe, Department of Medicine, Division of Pulmonary, Critical Care and Sleep Medicine, Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2020-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-31T04:16:20.103Z" } ], "INSDC secondary accession": [ { "text": "SRS7210732" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7210732" } ], "cas9 vector": [ { "text": "lentiCas9-Blast", "tag": "attribute" } ], "cell line": [ { "text": "NCI-H82", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002306" ], "tag": "attribute" } ], "cell type": [ { "text": "small cell lung cancer cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "overexpression vector": [ { "text": "pLEX_307-LacZ", "tag": "attribute" } ], "source_name": [ { "text": "small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "title": [ { "text": "LacZ-overexpressed NCI-H82 cells_1 [ATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15831819", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-08-17T10:46:12.247Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15831819" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15831819{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15831819/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15831819/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15831819" } } }, { "name": "GSM4742872", "accession": "SAMN15889178", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-27T00:00:00Z", "update": "2022-04-01T09:59:11.346Z", "submitted": "2020-08-23T17:36:10.020Z", "characteristics": { "External Id": [ { "text": "SAMN15889178", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cardiac Regeneration, Cell Biology, Murdoch Children's Research Institute" } ], "INSDC first public": [ { "text": "2021-09-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-27T01:23:17.930Z" } ], "INSDC secondary accession": [ { "text": "SRS7248803" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7248803" } ], "developmental stage": [ { "text": "adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "diagnosis": [ { "text": "healthy non-cardiovascular disease", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "human left ventricle heart muscle", "tag": "attribute" } ], "tissue": [ { "text": "up to 1g of left ventricular heart muscle", "tag": "attribute" } ], "title": [ { "text": "Adult6 [bulk_ATACseq_human]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15889178", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-08-23T17:36:10.020Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15889178" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15889178{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15889178/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15889178/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15889178" } } }, { "name": "GSM4745490", "accession": "SAMN15904067", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-08-26T00:00:00Z", "update": "2022-04-01T10:04:48.981Z", "submitted": "2020-08-26T02:29:05.253Z", "characteristics": { "External Id": [ { "text": "SAMN15904067", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dermatology, Stanford University" } ], "INSDC first public": [ { "text": "2020-08-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-08-26T16:55:18.523Z" } ], "INSDC secondary accession": [ { "text": "SRS7265772" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7265772" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "protein expression": [ { "text": "ItgA6+ LYPD3+ TACSTD2+ LY6D+/-", "tag": "attribute" } ], "source_name": [ { "text": "human BCC_2", "tag": "attribute" } ], "title": [ { "text": "BCC_2 ATACseq_ItgA6+LYPD3-TACSTD2-LY6D-_rep1" } ] }, "submittedVia": "JSON_API", "create": "2020-08-26T02:29:05.253Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15904067" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15904067{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15904067/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15904067/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15904067" } } }, { "name": "GSM4777218", "accession": "SAMN16118405", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-01T00:00:00Z", "update": "2022-04-01T11:27:42.102Z", "submitted": "2020-09-12T14:56:04.843Z", "characteristics": { "External Id": [ { "text": "SAMN16118405", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "PKU" } ], "INSDC first public": [ { "text": "2021-01-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-01T11:41:49.457Z" } ], "INSDC secondary accession": [ { "text": "SRS7353822" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7353822" } ], "age": [ { "text": "mid-aged", "tag": "attribute" } ], "cell type": [ { "text": "HUVECs", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002451" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HUVECs", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002451" ], "tag": "attribute" } ], "title": [ { "text": "mid-aged rep2 (ATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16118405", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN16118405", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-09-12T14:56:04.843Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16118405" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16118405{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16118405/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16118405/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16118405" } } }, { "name": "GSM4795753", "accession": "SAMN16213474", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-03T00:00:00Z", "update": "2022-04-01T11:58:28.385Z", "submitted": "2020-09-18T17:06:12.193Z", "characteristics": { "External Id": [ { "text": "SAMN16213474", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The Wen Lab, Department of Genome Science, John Curtin School of Medical Research, The Australian National University" } ], "INSDC first public": [ { "text": "2021-06-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-03T03:24:21.630Z" } ], "INSDC secondary accession": [ { "text": "SRS7392759" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7392759" } ], "cell line": [ { "text": "L1236", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "L1236 cell line", "tag": "attribute" } ], "title": [ { "text": "L1236-shH2A.B_rep2 (ATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16213474", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-09-18T17:06:12.193Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16213474" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16213474{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16213474/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16213474/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16213474" } } }, { "name": "GSM4826471", "accession": "SAMN16406501", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-02T00:00:00Z", "update": "2022-04-01T13:01:47.355Z", "submitted": "2020-10-09T13:01:12.427Z", "characteristics": { "External Id": [ { "text": "SAMN16406501", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Weill Cornell Medicine" } ], "INSDC first public": [ { "text": "2021-10-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-02T01:37:20.573Z" } ], "INSDC secondary accession": [ { "text": "SRS7500090" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7500090" } ], "cell type": [ { "text": "Plasma cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000786" ], "tag": "attribute" } ], "facs markers": [ { "text": "CD20+CD44+CD10-CD38+CD27+", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005180" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "tonsil", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002372" ], "tag": "attribute" } ], "tissue": [ { "text": "tonsil", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002372" ], "tag": "attribute" } ], "title": [ { "text": "PC_3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16406501", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-09T13:01:12.427Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16406501" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16406501{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16406501/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16406501/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16406501" } } }, { "name": "GSM4836831", "accession": "SAMN16483327", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-24T00:00:00Z", "update": "2023-05-15T04:04:27.049Z", "submitted": "2020-10-20T07:21:09.307Z", "characteristics": { "External Id": [ { "text": "SAMN16483327", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Azim Surani, Gurdon Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2022-01-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-24T01:31:21.243Z" } ], "INSDC secondary accession": [ { "text": "SRS7540951" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7540951" } ], "cell source": [ { "text": "hESC-derived", "tag": "attribute" } ], "cell type": [ { "text": "Human primordial germ cell-like cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human primordial germ cell-like cells", "tag": "attribute" } ], "title": [ { "text": "ATAC_hPGCLC_d4_r1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16483327", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-10-20T07:21:09.307Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483327" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483327{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483327/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483327/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16483327" } } }, { "name": "GSM4849045", "accession": "SAMN16517672", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-26T00:00:00Z", "update": "2022-04-01T13:31:57.763Z", "submitted": "2020-10-22T15:57:09.210Z", "characteristics": { "External Id": [ { "text": "SAMN16517672", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "WIMM, Oxford University" } ], "INSDC first public": [ { "text": "2021-03-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-26T02:47:18.893Z" } ], "INSDC secondary accession": [ { "text": "SRS7568443" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7568443" } ], "cell type": [ { "text": "Erythroid", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000232" ], "tag": "attribute" } ], "differentiation day": [ { "text": "Day 21", "tag": "attribute" } ], "genotype": [ { "text": "Inversion of C-SNV promoter", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "source_name": [ { "text": "iPSC diffrentiation to Erythroid cells", "tag": "attribute" } ], "title": [ { "text": "ATAC_Ery_iPSC_INV_Clone2_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16517672", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-22T15:57:09.210Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517672" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517672{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517672/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517672/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16517672" } } }, { "name": "GSM4869022", "accession": "SAMN16563029", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-18T00:00:00Z", "update": "2022-04-01T13:42:52.428Z", "submitted": "2020-10-27T10:31:14.050Z", "characteristics": { "External Id": [ { "text": "SAMN16563029", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gallo lab, Biochemistry and Molecular Biology, University of Calgary" } ], "INSDC first public": [ { "text": "2021-08-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-18T01:48:49.710Z" } ], "INSDC secondary accession": [ { "text": "SRS7593979" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7593979" } ], "cell line": [ { "text": "H524", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002296" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H524 cells treated with Dox +/- SCH", "tag": "attribute" } ], "title": [ { "text": "H524_KRAS_Dox_SCH-N1" } ], "treatment": [ { "text": "Dox+SCH", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16563029", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-27T10:31:14.050Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16563029" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16563029{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16563029/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16563029/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16563029" } } }, { "name": "GSM4873402", "accession": "SAMN16595824", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-05T00:00:00Z", "update": "2022-04-01T13:53:20.970Z", "submitted": "2020-10-29T15:33:05.550Z", "characteristics": { "External Id": [ { "text": "SAMN16595824", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zong Lab, Baylor College of Medicine" } ], "INSDC first public": [ { "text": "2021-06-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-05T01:40:18.697Z" } ], "INSDC secondary accession": [ { "text": "SRS7618958" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7618958" } ], "genotype": [ { "text": "ARID1A-KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HPNE", "tag": "attribute" } ], "title": [ { "text": "HPNE_ARID1A_KO_ATAC_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16595824", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-29T15:33:05.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16595824" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16595824{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16595824/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16595824/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16595824" } } }, { "name": "GSM4873756", "accession": "SAMN16597967", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-01T00:00:00Z", "update": "2023-05-18T07:55:39.097Z", "submitted": "2020-10-29T19:41:06.330Z", "characteristics": { "External Id": [ { "text": "SAMN16597967", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dr. Scott Hiebert, Biochemistry, Vanderbilt University" } ], "INSDC first public": [ { "text": "2023-03-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-01T02:57:46.503Z" } ], "INSDC secondary accession": [ { "text": "SRS7620657" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7620657" } ], "cell line": [ { "text": "Kasumi-1", "tag": "attribute" } ], "genotype/variation": [ { "text": "Parental", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Kasumi-1 cells", "tag": "attribute" } ], "title": [ { "text": "Kasumi-1_parental_2 [ATAC-seq]" } ], "treatment": [ { "text": "Untreated", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16597967", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-10-29T19:41:06.330Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16597967" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16597967{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16597967/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16597967/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16597967" } } }, { "name": "GSM4886739", "accession": "SAMN16678000", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-04T00:00:00Z", "update": "2022-04-01T14:09:59.399Z", "submitted": "2020-11-05T15:06:57.910Z", "characteristics": { "External Id": [ { "text": "SAMN16678000", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biotechnology, Institute of Molecular and Cell Biology, University of Tartu" } ], "INSDC first public": [ { "text": "2020-12-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-04T07:16:56.493Z" } ], "INSDC secondary accession": [ { "text": "SRS7660050" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7660050" } ], "cell line": [ { "text": "H9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003045" ], "tag": "attribute" } ], "cell type": [ { "text": "human embryonic stem cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002322" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hESC H9", "tag": "attribute" } ], "title": [ { "text": "hESC_DMSO_ATAC-seq_rep3" } ], "treatment": [ { "text": "DMSO", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN16678000", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-11-05T15:06:57.910Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16678000" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16678000{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16678000/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16678000/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16678000" } } }, { "name": "EpiQC HG001 NA12878", "accession": "SAMN16786364", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-12T00:00:00Z", "update": "2022-04-01T14:47:40.559Z", "submitted": "2020-11-12T17:40:09.267Z", "characteristics": { "External Id": [ { "text": "SAMN16786364", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Weill Cornell Medicine" } ], "INSDC first public": [ { "text": "2020-11-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-12T19:25:29.490Z" } ], "INSDC secondary accession": [ { "text": "SRS7709448" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS7709448" } ], "biomaterial provider": [ { "text": "NIST", "tag": "attribute" } ], "isolate": [ { "text": "NA12878", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000895" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "tissue": [ { "text": "B-Lymphocyte", "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ] }, "submittedVia": "JSON_API", "create": "2020-11-12T17:40:09.267Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16786364" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16786364{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16786364/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16786364/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16786364" } } }, { "name": "GSM4911530", "accession": "SAMN16817051", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-08-28T00:00:00Z", "update": "2023-11-05T11:33:58.501Z", "submitted": "2020-11-17T12:31:16.157Z", "characteristics": { "External Id": [ { "text": "SAMN16817051", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pharmaceutical Sciences, St. Jude Children's Research Hospital" } ], "INSDC first public": [ { "text": "2023-08-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-08-28T01:19:21.773Z" } ], "INSDC secondary accession": [ { "text": "SRS7728303" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7728303" } ], "cancer type": [ { "text": "Human ALL Clinical Sample", "tag": "attribute" } ], "cell type": [ { "text": "primary acute lymphoblastic leukemia cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human ALL Clinical Sample", "tag": "attribute" } ], "title": [ { "text": "ATACseq_3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16817051", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-11-17T12:31:16.157Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16817051" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16817051{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16817051/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16817051/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16817051" } } }, { "name": "GSM4923397", "accession": "SAMN16856004", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-08T00:00:00Z", "update": "2022-04-01T15:22:12.584Z", "submitted": "2020-11-20T20:16:06.360Z", "characteristics": { "External Id": [ { "text": "SAMN16856004", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tyler Jacks, Koch Institute, MIT" } ], "INSDC first public": [ { "text": "2021-09-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-08T05:25:26.967Z" } ], "INSDC secondary accession": [ { "text": "SRS7794678" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7794678" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PDX lung adenocarcinoma", "tag": "attribute" } ], "tissue": [ { "text": "lung adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000571" ], "tag": "attribute" } ], "title": [ { "text": "482 (PDX)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16856004", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-11-20T20:16:06.360Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16856004" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16856004{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16856004/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16856004/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16856004" } } }, { "name": "GSM4953488", "accession": "SAMN16981382", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-03T00:00:00Z", "update": "2022-04-01T16:01:57.448Z", "submitted": "2020-12-02T10:55:04.453Z", "characteristics": { "External Id": [ { "text": "SAMN16981382", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2020-12-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-03T04:36:48.203Z" } ], "INSDC secondary accession": [ { "text": "SRS7822212" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7822212" } ], "disease state": [ { "text": "Tumor", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000616" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient id": [ { "text": "C33", "tag": "attribute" } ], "source_name": [ { "text": "Thyroid tumor", "tag": "attribute" } ], "tissue": [ { "text": "Tumor1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000616" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq F100-C33-T1" } ] }, "submittedVia": "JSON_API", "create": "2020-12-02T10:55:04.453Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16981382" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16981382{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16981382/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16981382/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16981382" } } }, { "name": "GSM4979887", "accession": "SAMN17113198", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-12T00:00:00Z", "update": "2023-05-15T09:36:51.969Z", "submitted": "2020-12-18T11:01:49.410Z", "characteristics": { "External Id": [ { "text": "SAMN17113198", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Vanharanta, MRC Cancer Unit, University of Cambridge" } ], "INSDC first public": [ { "text": "2022-03-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-12T01:23:16.060Z" } ], "INSDC secondary accession": [ { "text": "SRS7898177" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7898177" } ], "cell line": [ { "text": "786-M1A", "tag": "attribute" } ], "construct": [ { "text": "shPAX8-1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ccRCC cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_shPAX8-1_Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17113198", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-12-18T11:01:49.410Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113198" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113198{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113198/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113198/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17113198" } } }, { "name": "GSM4981519", "accession": "SAMN17120381", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-20T00:00:00Z", "update": "2022-04-01T16:40:05.040Z", "submitted": "2020-12-19T15:57:11.037Z", "characteristics": { "External Id": [ { "text": "SAMN17120381", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Manchester" } ], "INSDC first public": [ { "text": "2020-12-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-21T09:07:18.733Z" } ], "INSDC secondary accession": [ { "text": "SRS7901461" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7901461" } ], "disease state": [ { "text": "Rheumatoid Arthritis", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000685" ], "tag": "attribute" } ], "joint": [ { "text": "MCP", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0010789" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample id": [ { "text": "SF_415B", "tag": "attribute" } ], "source_name": [ { "text": "Primary FLS", "tag": "attribute" } ], "title": [ { "text": "SF_415B: ATAC-seq, Primary FLS, unstimulated" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17120381", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17120381", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-19T15:57:11.037Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17120381" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17120381{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17120381/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17120381/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17120381" } } }, { "name": "GSM4982180", "accession": "SAMN17126737", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-09T00:00:00Z", "update": "2022-04-01T16:41:29.851Z", "submitted": "2020-12-21T06:57:10.770Z", "characteristics": { "External Id": [ { "text": "SAMN17126737", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wu Lab, Medical Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2021-06-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-09T02:20:17.020Z" } ], "INSDC secondary accession": [ { "text": "SRS7904684" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7904684" } ], "disease state": [ { "text": "CLL active disease", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "tissue": [ { "text": "blood", "tag": "attribute" } ], "title": [ { "text": "CLL6_4: RIC/Ibrutinib relapse patient 6 timepoint 4" } ], "treatment": [ { "text": "Ibrutinib 21 months", "tag": "attribute" } ], "wbc": [ { "text": "12", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17126737", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-21T06:57:10.770Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17126737" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17126737{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17126737/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17126737/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17126737" } } }, { "name": "GSM4983567", "accession": "SAMN17131558", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-21T00:00:00Z", "update": "2022-04-01T16:43:20.545Z", "submitted": "2020-12-21T15:31:08.800Z", "characteristics": { "External Id": [ { "text": "SAMN17131558", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gallo Lab, Cumming School of Medicine, University of Calgary" } ], "INSDC first public": [ { "text": "2021-10-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-21T01:29:00.143Z" } ], "INSDC secondary accession": [ { "text": "SRS7906659" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7906659" } ], "diagnosis": [ { "text": "Recurrent glioblastoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "patient-derived pediatric glioblastoma", "tag": "attribute" } ], "tissue": [ { "text": "glioblastoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000519" ], "tag": "attribute" } ], "title": [ { "text": "pCGY2937_recurrent" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17131558", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-21T15:31:08.800Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17131558" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17131558{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17131558/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17131558/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17131558" } } }, { "name": "GSM4988707", "accession": "SAMN17153028", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-21T00:00:00Z", "update": "2023-05-15T10:03:01.205Z", "submitted": "2020-12-24T12:43:04.787Z", "characteristics": { "External Id": [ { "text": "SAMN17153028", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular tools, Immunology, Genetics and Pathology, uppsala university" } ], "INSDC first public": [ { "text": "2022-03-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-21T01:18:49.077Z" } ], "INSDC secondary accession": [ { "text": "SRS7931643" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7931643" } ], "cell type": [ { "text": "glioblastoma stem cells", "tag": "attribute" } ], "growth protocol": [ { "text": "Established and sustained in serum-free medium", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "glioblastoma stem cells", "tag": "attribute" } ], "tissue": [ { "text": "brain", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000955" ], "tag": "attribute" } ], "title": [ { "text": "Hs, U3263MG-1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17153028", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-12-24T12:43:04.787Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17153028" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17153028{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17153028/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17153028/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17153028" } } }, { "name": "DV1846", "accession": "SAMN17225421", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-06T00:00:00Z", "update": "2022-04-01T17:11:30.187Z", "submitted": "2021-01-06T08:40:08.127Z", "characteristics": { "External Id": [ { "text": "SAMN17225421", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Universite de Paris" } ], "INSDC first public": [ { "text": "2021-01-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-06T09:02:08.387Z" } ], "INSDC secondary accession": [ { "text": "SRS7976975" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS7976975" } ], "age": [ { "text": "67", "tag": "attribute" } ], "biomaterial provider": [ { "text": "Prof. Niels Voigt, Institute of Pharmacology and Toxicology, University Medical Center Göttingen, Georg-August University Göttingen, Robert-Koch-Straße 42a, 37075 Göttingen, Germany", "tag": "attribute" } ], "disease": [ { "text": "Mitral Valve Insufficiency", "tag": "attribute" } ], "disease_stage": [ { "text": "III", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002217" ], "tag": "attribute" } ], "isolate": [ { "text": "DV1846", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006565" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "tissue": [ { "text": "Mitral Valve", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002135" ], "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17225421", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-06T08:40:08.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17225421" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17225421{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17225421/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17225421/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17225421" } } }, { "name": "GSM5008026", "accession": "SAMN17228531", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-08T00:00:00Z", "update": "2023-05-15T11:25:03.495Z", "submitted": "2021-01-06T13:16:05.610Z", "characteristics": { "External Id": [ { "text": "SAMN17228531", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Bioengineering, University of California, San Diego" } ], "INSDC first public": [ { "text": "2022-06-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-08T01:28:21.720Z" } ], "INSDC secondary accession": [ { "text": "SRS7980194" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7980194" } ], "cell type": [ { "text": "hiPSC-derived erythroid cells", "tag": "attribute" } ], "knockdown": [ { "text": "ARID1B-KD", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "oxygen status": [ { "text": "hypoxia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1001793" ], "tag": "attribute" } ], "source_name": [ { "text": "hiPSC-derived erythroid cells from human non-CMS cells with ARID1B-KD", "tag": "attribute" } ], "title": [ { "text": "ATACSeq_ARID1BKD_iPSCErythroid_Hypoxia-rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17228531", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-01-06T13:16:05.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17228531" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17228531{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17228531/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17228531/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17228531" } } }, { "name": "GSM5008356", "accession": "SAMN17243154", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-13T00:00:00Z", "update": "2022-04-01T17:13:16.983Z", "submitted": "2021-01-06T16:56:15.297Z", "characteristics": { "External Id": [ { "text": "SAMN17243154", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mortazavi, Developmental and Cellular Biology, University of California, Irvine" } ], "INSDC first public": [ { "text": "2021-02-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-13T02:18:33.610Z" } ], "INSDC secondary accession": [ { "text": "SRS7982066" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7982066" } ], "day of differentiation": [ { "text": "Day 5", "tag": "attribute" } ], "differentiation": [ { "text": "Definitive Endoderm", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0005439" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Differentiation of H1 - Human Embryonic Stem cells into Definitive Endoderm Cells", "tag": "attribute" } ], "title": [ { "text": "human_DE_Day5_Rep1_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17243154", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17243154", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-06T16:56:15.297Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17243154" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17243154{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17243154/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17243154/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17243154" } } }, { "name": "GSM5012393", "accession": "SAMN17274720", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-25T00:00:00Z", "update": "2022-04-01T17:32:41.812Z", "submitted": "2021-01-10T13:41:12.110Z", "characteristics": { "External Id": [ { "text": "SAMN17274720", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Applied Bioinformatics, St Jude Children's Research Hospital" } ], "INSDC first public": [ { "text": "2021-11-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-25T01:54:20.260Z" } ], "INSDC secondary accession": [ { "text": "SRS8000085" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8000085" } ], "cell line": [ { "text": "SKNAS", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "cell line derived from xenograft tumor", "tag": "attribute" } ], "title": [ { "text": "SKNAS-Vel-01" } ], "treatment": [ { "text": "xenografts were treated with vehicle.", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17274720", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-10T13:41:12.110Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17274720" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17274720{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17274720/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17274720/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17274720" } } }, { "name": "GSM5024021", "accession": "SAMN17367676", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-03T00:00:00Z", "update": "2023-05-15T12:19:08.642Z", "submitted": "2021-01-17T12:51:12.400Z", "characteristics": { "External Id": [ { "text": "SAMN17367676", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham" } ], "INSDC first public": [ { "text": "2022-08-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-03T01:40:18.847Z" } ], "INSDC secondary accession": [ { "text": "SRS8042930" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8042930" } ], "cell line": [ { "text": "Miapaca2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "LDHA inhibitor resistant", "tag": "attribute" } ], "source_name": [ { "text": "Miapaca2 cell line", "tag": "attribute" } ], "title": [ { "text": "Resistant-untreated replicate 1 (ATAC-seq)" } ], "treatment": [ { "text": "untreated", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17367676", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-01-17T12:51:12.400Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17367676" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17367676{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17367676/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17367676/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17367676" } } }, { "name": "GSM5029759", "accession": "SAMN17493294", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-13T00:00:00Z", "update": "2023-05-15T12:44:04.253Z", "submitted": "2021-01-22T09:14:20.753Z", "characteristics": { "External Id": [ { "text": "SAMN17493294", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Guangdong Provincial People's Hospital" } ], "INSDC first public": [ { "text": "2022-05-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-13T01:46:18.537Z" } ], "INSDC secondary accession": [ { "text": "SRS8094888" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8094888" } ], "condition": [ { "text": "dilated cardiomyopathy", "tag": "attribute" } ], "method": [ { "text": "ATAC-Seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007045" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "heart tissue", "tag": "attribute" } ], "tissue": [ { "text": "heart", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000948" ], "tag": "attribute" } ], "title": [ { "text": "DCM-9_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17493294", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-01-22T09:14:20.753Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493294" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493294{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493294/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493294/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17493294" } } }, { "name": "GSM5047887", "accession": "SAMN17610226", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-17T00:00:00Z", "update": "2022-04-01T18:58:22.822Z", "submitted": "2021-01-27T16:01:13.070Z", "characteristics": { "External Id": [ { "text": "SAMN17610226", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of California San Diego" } ], "INSDC first public": [ { "text": "2021-02-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-17T02:53:18.660Z" } ], "INSDC secondary accession": [ { "text": "SRS8137495" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8137495" } ], "cause of death": [ { "text": "cerebral vascular accident", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000712" ], "tag": "attribute" } ], "donor sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "race": [ { "text": "asian", "ontologyTerms": [ "http://purl.obolibrary.org/obo/HANCESTRO_0008" ], "tag": "attribute" } ], "sample preparation": [ { "text": "flash-frozen tissue", "tag": "attribute" } ], "sample type": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "source_name": [ { "text": "stomach", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000945" ], "tag": "attribute" } ], "title": [ { "text": "stomach_SM-JF1O3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17610226", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17610226", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-27T16:01:13.070Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17610226" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17610226{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17610226/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17610226/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17610226" } } }, { "name": "GSM5048465", "accession": "SAMN17615474", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-04T00:00:00Z", "update": "2022-04-01T19:00:08.563Z", "submitted": "2021-01-28T11:05:07.720Z", "characteristics": { "External Id": [ { "text": "SAMN17615474", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "McGill University Health Centre" } ], "INSDC first public": [ { "text": "2021-09-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-04T03:59:16.830Z" } ], "INSDC secondary accession": [ { "text": "SRS8142090" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8142090" } ], "active ingredient": [ { "text": "Emtricitabine, Tenofovir_DF", "tag": "attribute" } ], "age": [ { "text": "42", "tag": "attribute" } ], "art start year": [ { "text": "2016", "tag": "attribute" } ], "average tagmented library size": [ { "text": "992", "tag": "attribute" } ], "bal sampling date": [ { "text": "2019/10/31", "tag": "attribute" } ], "cd4 count": [ { "text": "208", "tag": "attribute" } ], "cigarette smoker": [ { "text": "no", "tag": "attribute" } ], "ethnicity": [ { "text": "Asian", "ontologyTerms": [ "http://purl.obolibrary.org/obo/HANCESTRO_0008" ], "tag": "attribute" } ], "fragments in clean bam": [ { "text": "38937371", "tag": "attribute" } ], "lane": [ { "text": "1,2", "tag": "attribute" } ], "mtb challenged": [ { "text": "yes", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "prescription drugs": [ { "text": "Truvada", "tag": "attribute" } ], "quantiferon tb reagent": [ { "text": "no", "tag": "attribute" } ], "recreational drugs": [ { "text": "no", "tag": "attribute" } ], "sequencing run": [ { "text": "6", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "sexually transmitted infections": [ { "text": "Chlamydia – 2017", "tag": "attribute" } ], "source_name": [ { "text": "bronchoalveolar lavage", "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq Pre-exposure prophylaxis sample 34, Alveolar macrophage, Mycobacterium tuberculosis challenged library" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17615474", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-28T11:05:07.720Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17615474" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17615474{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17615474/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17615474/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17615474" } } }, { "name": "GSM5051508", "accession": "SAMN17715038", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-17T00:00:00Z", "update": "2022-04-01T19:30:55.731Z", "submitted": "2021-01-31T15:06:04.590Z", "characteristics": { "External Id": [ { "text": "SAMN17715038", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Greenleaf lab, Stanford University" } ], "INSDC first public": [ { "text": "2021-09-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-17T01:36:41.740Z" } ], "INSDC secondary accession": [ { "text": "SRS8158077" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8158077" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Tonsil_scATAC-seq", "tag": "attribute" } ], "subject status": [ { "text": "children and adults undergoing routine tonsillectomy", "tag": "attribute" } ], "tissue": [ { "text": "tonsil", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002372" ], "tag": "attribute" } ], "title": [ { "text": "Tonsil 7 scATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17715038", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-31T15:06:04.590Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17715038" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17715038{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17715038/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17715038/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17715038" } } }, { "name": "GSM5058586", "accession": "SAMN17730112", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-01T00:00:00Z", "update": "2023-05-15T13:33:03.816Z", "submitted": "2021-02-01T15:06:09.133Z", "characteristics": { "External Id": [ { "text": "SAMN17730112", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Capellini, Human Evolutionary Biology, Harvard University" } ], "INSDC first public": [ { "text": "2022-02-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-01T01:47:25.013Z" } ], "INSDC secondary accession": [ { "text": "SRS8168863" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8168863" } ], "cell type": [ { "text": "chondrocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000138" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "reagent": [ { "text": "tn5 transposase", "tag": "attribute" } ], "source_name": [ { "text": "Human Pubis E53-54", "tag": "attribute" } ], "tissue": [ { "text": "Pubis", "tag": "attribute" } ], "title": [ { "text": "Pubis" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17730112", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-02-01T15:06:09.133Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730112" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730112{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730112/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730112/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17730112" } } }, { "name": "GSM5058792", "accession": "SAMN17730295", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-10T00:00:00Z", "update": "2023-05-15T13:33:09.495Z", "submitted": "2021-02-01T16:41:05.167Z", "characteristics": { "External Id": [ { "text": "SAMN17730295", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Omics Sciences, IRCCS San Raffaele Scientific Institute" } ], "INSDC first public": [ { "text": "2022-05-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-10T01:38:32.630Z" } ], "INSDC secondary accession": [ { "text": "SRS8169908" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8169908" } ], "cell type": [ { "text": "MiaPaCa2 wild-type cell line", "tag": "attribute" } ], "growth protocol": [ { "text": "DMEM supplemented with 10% Fetal Bovine Serum, 2mM L-Glutamine and 1% Pen/Strep", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Pancreatic Ductal Adenocarcinoma (PDAC) cell line", "tag": "attribute" } ], "title": [ { "text": "MiaPaCa2_ATAC_rep2" } ], "treatment": [ { "text": "Bulk cell line, untreated", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17730295", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-02-01T16:41:05.167Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730295" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730295{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730295/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730295/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17730295" } } }, { "name": "GSM5066035", "accession": "SAMN17799927", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-10T00:00:00Z", "update": "2022-04-01T19:41:11.114Z", "submitted": "2021-02-04T16:31:06.870Z", "characteristics": { "External Id": [ { "text": "SAMN17799927", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Human Carcinogenesis, Center for Cancer Research, National Institutes of Health" } ], "INSDC first public": [ { "text": "2021-02-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-10T03:31:20.960Z" } ], "INSDC secondary accession": [ { "text": "SRS8198935" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8198935" } ], "cell subtype": [ { "text": "CD8+ T cell", "tag": "attribute" } ], "cell type": [ { "text": "blood cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000081" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "mock-treated CD8 T cell", "tag": "attribute" } ], "title": [ { "text": "mock-treated CD8 T cell -rep2" } ], "treatment1": [ { "text": "CD2/CD3/CD28 activated", "tag": "attribute" } ], "treatment2": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17799927", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-04T16:31:06.870Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17799927" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17799927{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17799927/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17799927/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17799927" } } }, { "name": "GSM5098141", "accession": "SAMN18016329", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-07T00:00:00Z", "update": "2023-05-15T15:38:33.501Z", "submitted": "2021-02-20T14:56:07.450Z", "characteristics": { "External Id": [ { "text": "SAMN18016329", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chromatin biology lab, Biological sciences, Korea Advanced Institute of Science and Technology" } ], "INSDC first public": [ { "text": "2022-05-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-07T08:10:24.547Z" } ], "INSDC secondary accession": [ { "text": "SRS8295518" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8295518" } ], "cell line": [ { "text": "BT549", "tag": "attribute" } ], "cell type": [ { "text": "Triple negative breast cancer B", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Triple negative breast cancer B cell", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_BT549_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18016329", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-02-20T14:56:07.450Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18016329" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18016329{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18016329/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18016329/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18016329" } } }, { "name": "GSM5103028", "accession": "SAMN18040609", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-24T00:00:00Z", "update": "2022-04-01T20:41:59.843Z", "submitted": "2021-02-23T16:56:04.873Z", "characteristics": { "External Id": [ { "text": "SAMN18040609", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pulmonary and Critical Care, University of Colorado Anschutz" } ], "INSDC first public": [ { "text": "2021-02-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-24T05:30:19.603Z" } ], "INSDC secondary accession": [ { "text": "SRS8309957" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8309957" } ], "cell line": [ { "text": "BEAS-2B", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001089" ], "tag": "attribute" } ], "cell type": [ { "text": "airway epithelial cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002368" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BEAS-2B airway epithelial cells", "tag": "attribute" } ], "title": [ { "text": "Beas-2B_120WSP-2_ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18040609", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-23T16:56:04.873Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18040609" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18040609{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18040609/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18040609/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18040609" } } }, { "name": "GSM5104202", "accession": "SAMN18042132", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-30T00:00:00Z", "update": "2022-04-01T20:43:10.691Z", "submitted": "2021-02-23T21:23:09.150Z", "characteristics": { "External Id": [ { "text": "SAMN18042132", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Greenleaf, Genetics, Stanford University" } ], "INSDC first public": [ { "text": "2021-04-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-30T06:10:22.047Z" } ], "INSDC secondary accession": [ { "text": "SRS8311776" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8311776" } ], "cell line": [ { "text": "NCIH1437", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002254" ], "tag": "attribute" } ], "growth media": [ { "text": "RPMI; 10% FBS; 1% pen-strep", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source": [ { "text": "human derived (ATCC)", "tag": "attribute" } ], "source_name": [ { "text": "Immortalized cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000002" ], "tag": "attribute" } ], "tissue/cell type": [ { "text": "lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001071" ], "tag": "attribute" } ], "title": [ { "text": "bATAC-Human_H1437_KEAP1_Rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18042132", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-23T21:23:09.150Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18042132" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18042132{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18042132/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18042132/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18042132" } } }, { "name": "GSM5106085", "accession": "SAMN18054121", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-25T00:00:00Z", "update": "2022-04-01T20:45:57.314Z", "submitted": "2021-02-24T22:16:04.120Z", "characteristics": { "External Id": [ { "text": "SAMN18054121", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Fudan University" } ], "INSDC first public": [ { "text": "2021-02-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-25T06:32:02.310Z" } ], "INSDC secondary accession": [ { "text": "SRS8317690" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8317690" } ], "age": [ { "text": "64", "tag": "attribute" } ], "diagnosis": [ { "text": "Esophageal squamous cell carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005922" ], "tag": "attribute" } ], "histological grade": [ { "text": "2", "tag": "attribute" } ], "lymph node metastasis": [ { "text": "No", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient": [ { "text": "3", "tag": "attribute" } ], "smoking": [ { "text": "Ever-smoker", "tag": "attribute" } ], "source_name": [ { "text": "Tumor tissue from patient 3 (ATAC-seq)", "tag": "attribute" } ], "stage": [ { "text": "IIb", "tag": "attribute" } ], "tissue": [ { "text": "Tumor tissue", "tag": "attribute" } ], "title": [ { "text": "ATACT3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18054121", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN18054121", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-24T22:16:04.120Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18054121" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18054121{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18054121/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18054121/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18054121" } } }, { "name": "GSM5117457", "accession": "SAMN18095761", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-04T00:00:00Z", "update": "2022-04-01T21:01:16.574Z", "submitted": "2021-03-01T13:59:08.127Z", "characteristics": { "External Id": [ { "text": "SAMN18095761", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Boise and Vertino Labs, Hematology and Medical Oncology, Emory University" } ], "INSDC first public": [ { "text": "2021-03-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-04T01:45:22.397Z" } ], "INSDC secondary accession": [ { "text": "SRS8343260" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8343260" } ], "cryopreserved": [ { "text": "FALSE", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009639" ], "tag": "attribute" } ], "markers": [ { "text": "CD138+CD38+PI-", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "multiple myeloma patient bone marrow aspirates", "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq 1557-fresh" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18095761", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN18095761", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-01T13:59:08.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18095761" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18095761{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18095761/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18095761/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18095761" } } }, { "name": "GSM5133614", "accession": "SAMN18132928", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-04T00:00:00Z", "update": "2022-04-01T21:12:41.280Z", "submitted": "2021-03-03T19:07:04.800Z", "characteristics": { "External Id": [ { "text": "SAMN18132928", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NYU Langone Medical Center" } ], "INSDC first public": [ { "text": "2021-03-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-04T08:02:20.087Z" } ], "INSDC secondary accession": [ { "text": "SRS8375145" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8375145" } ], "cell line": [ { "text": "ARPE-19", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006271" ], "tag": "attribute" } ], "cell type": [ { "text": "retinal pigment epithelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002586" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Retinal pigment epithelial cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC ARPE19 rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18132928", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN18132928", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-03T19:07:04.800Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132928" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132928{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132928/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132928/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18132928" } } }, { "name": "GSM5171165", "accession": "SAMN18290280", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-07T00:00:00Z", "update": "2023-05-18T10:57:24.005Z", "submitted": "2021-03-12T16:26:05.483Z", "characteristics": { "External Id": [ { "text": "SAMN18290280", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biomedical Sciences, Cedars-Sinai Medical Center" } ], "INSDC first public": [ { "text": "2023-03-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-08T17:08:41.453Z" } ], "INSDC secondary accession": [ { "text": "SRS8454778" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8454778" } ], "age": [ { "text": "22", "tag": "attribute" } ], "gender identity": [ { "text": "trans-male", "tag": "attribute" } ], "hormone therapy": [ { "text": "Testosterone", "tag": "attribute" } ], "menstrual status": [ { "text": "menstruation seized", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "subcutaneous mastectomy (gender affirmation surgery)", "tag": "attribute" } ], "tissue": [ { "text": "mammary tissue", "tag": "attribute" } ], "title": [ { "text": "TM-1956 (ATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18290280", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-03-12T16:26:05.483Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18290280" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18290280{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18290280/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18290280/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18290280" } } }, { "name": "Butyrate18_rep2_ATAC", "accession": "SAMN18350771", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-01T00:52:14.787Z", "update": "2022-04-01T22:27:32.087Z", "submitted": "2021-03-18T15:05:05.430Z", "characteristics": { "External Id": [ { "text": "SAMN18350771", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford" } ], "INSDC first public": [ { "text": "2021-04-01T00:52:14.787Z" } ], "INSDC last update": [ { "text": "2021-04-01T00:52:14.787Z" } ], "INSDC secondary accession": [ { "text": "SRS8490184" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS8490184" } ], "biomaterial provider": [ { "text": "Ami Bhatt", "tag": "attribute" } ], "isolate": [ { "text": "HCT116", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002824" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "2", "tag": "attribute" } ], "sample type": [ { "text": "18h", "tag": "attribute" } ], "tissue": [ { "text": "colon cancer cell line", "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ], "treatment": [ { "text": "Butyrate", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_17968" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18350771", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-18T15:05:05.430Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18350771" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18350771{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18350771/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18350771/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18350771" } } }, { "name": "GSM5227197", "accession": "SAMN18632249", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-05T00:00:00Z", "update": "2022-04-01T23:44:01.768Z", "submitted": "2021-04-06T10:46:07.587Z", "characteristics": { "External Id": [ { "text": "SAMN18632249", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Oregon Health and Science University" } ], "INSDC first public": [ { "text": "2021-11-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-05T01:49:17.843Z" } ], "INSDC secondary accession": [ { "text": "SRS8643812" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8643812" } ], "gleason score": [ { "text": "4+4", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Prostate adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000673" ], "tag": "attribute" } ], "title": [ { "text": "Sample 15 Prostate Tumor" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18632249", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-06T10:46:07.587Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18632249" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18632249{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18632249/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18632249/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18632249" } } }, { "name": "GSM5227755", "accession": "SAMN18640584", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-28T00:00:00Z", "update": "2022-04-01T23:49:56.605Z", "submitted": "2021-04-06T16:46:05.590Z", "characteristics": { "External Id": [ { "text": "SAMN18640584", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology, University of Michigan" } ], "INSDC first public": [ { "text": "2021-10-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-28T01:45:40.140Z" } ], "INSDC secondary accession": [ { "text": "SRS8648930" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8648930" } ], "cancer type": [ { "text": "prostate cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001663" ], "tag": "attribute" } ], "cell line": [ { "text": "VCaP", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007752" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "VCaP", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007752" ], "tag": "attribute" } ], "title": [ { "text": "VCaP_AU_R2_8h (ATAC-seq)" } ], "treatment": [ { "text": "AU-15330", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18640584", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-06T16:46:05.590Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18640584" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18640584{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18640584/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18640584/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18640584" } } }, { "name": "GSM5240129", "accession": "SAMN18737268", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-15T00:00:00Z", "update": "2022-04-02T00:40:13.071Z", "submitted": "2021-04-13T18:21:08.550Z", "characteristics": { "External Id": [ { "text": "SAMN18737268", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "White Lab, Cancer Biology & Genetics, Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2021-04-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-15T03:32:19.237Z" } ], "INSDC secondary accession": [ { "text": "SRS8698852" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8698852" } ], "cell type": [ { "text": "melanocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000148" ], "tag": "attribute" } ], "genotype": [ { "text": "KO of RB1, TP53 and P16; BRAFV600E and ATAD2 expression", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hPSC-derived melanocytes", "tag": "attribute" } ], "title": [ { "text": "Sample_MEL_3xKO_ATAD2_dox_rep2" } ], "treatment": [ { "text": "doxycycline", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_50845" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18737268", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-13T18:21:08.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18737268" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18737268{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18737268/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18737268/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18737268" } } }, { "name": "GSM5240737", "accession": "SAMN18740689", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-12T00:00:00Z", "update": "2022-04-02T00:43:07.207Z", "submitted": "2021-04-14T10:01:10.637Z", "characteristics": { "External Id": [ { "text": "SAMN18740689", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Biochemistry, University of Oxford" } ], "INSDC first public": [ { "text": "2021-10-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-12T01:48:47.217Z" } ], "INSDC secondary accession": [ { "text": "SRS8701788" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8701788" } ], "cell line": [ { "text": "Hep3B", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002205" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Hepatocellular Carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000182" ], "tag": "attribute" } ], "title": [ { "text": "24hr_ATAC-seq_rep2" } ], "treatment": [ { "text": "24hr IFNγ", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18740689", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-14T10:01:10.637Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18740689" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18740689{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18740689/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18740689/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18740689" } } }, { "name": "ENCODE biosample ENCBS705MSB", "accession": "SAMN18814096", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-20T00:00:00Z", "update": "2022-04-02T01:20:08.761Z", "submitted": "2021-04-20T17:46:07.130Z", "characteristics": { "External Id": [ { "text": "SAMN18814096", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ENCODE" } ], "INSDC first public": [ { "text": "2021-04-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-22T19:01:17.897Z" } ], "INSDC secondary accession": [ { "text": "SRS8756197" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8756197" } ], "age": [ { "text": "53 year", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000036" ], "tag": "attribute" } ], "cell line": [ { "text": "K562", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002067" ], "tag": "attribute" } ], "description": [ { "text": "Homo sapiens K562 cell line treated with 0.5 uM JQ1 for 48 hours, preserved by flash-freezing" } ], "dev stage": [ { "text": "adult", "tag": "attribute" } ], "donor id": [ { "text": "ENCDO000AAD", "tag": "attribute" } ], "health state": [ { "text": "chronic myelogenous leukemia (CML)", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000339" ], "tag": "attribute" } ], "lab": [ { "text": "Will Greenleaf, Stanford", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CLO_0000031" ], "tag": "attribute" } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "source": [ { "text": "ATCC", "tag": "attribute" } ], "title": [ { "text": "ENCODE biosample ENCBS705MSB: ATAC-seq on human cell line K562" } ], "treatments": [ { "text": "treatment_term_id: CHEBI:137116; treatment_term_name: JQ1; treatment_type: chemical; duration: 48; duration_units: hour;", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18814096", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-20T17:46:07.130Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18814096" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18814096{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18814096/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18814096/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18814096" } } }, { "name": "GSM5258442", "accession": "SAMN18823532", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-15T00:00:00Z", "update": "2023-05-16T04:32:31.250Z", "submitted": "2021-04-21T16:11:13.613Z", "characteristics": { "External Id": [ { "text": "SAMN18823532", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pattabiraman lab, Molecular and Systems Biology, Geisel School of Medicine at Dartmouth" } ], "INSDC first public": [ { "text": "2022-02-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-15T01:28:24.990Z" } ], "INSDC secondary accession": [ { "text": "SRS8749687" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8749687" } ], "cell line": [ { "text": "SUM149PT_M2", "tag": "attribute" } ], "cell line origin": [ { "text": "SUM149PT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001240" ], "tag": "attribute" } ], "cell type": [ { "text": "ER-/PR- IBC", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Clone M2", "tag": "attribute" } ], "title": [ { "text": "Clone M2 replicate 1 (ATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18823532", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-04-21T16:11:13.613Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18823532" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18823532{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18823532/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18823532/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18823532" } } }, { "name": "GSM5282149", "accession": "SAMN19014258", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-22T00:00:00Z", "update": "2023-05-16T08:39:00.666Z", "submitted": "2021-05-04T18:49:06.663Z", "characteristics": { "External Id": [ { "text": "SAMN19014258", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Faryabi, Pathology, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-02-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-22T02:39:21.683Z" } ], "INSDC secondary accession": [ { "text": "SRS8861722" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8861722" } ], "cell line": [ { "text": "Jurkat E6-1 cell line", "tag": "attribute" } ], "cell type": [ { "text": "T-ALL cell line", "tag": "attribute" } ], "lentiviral transduction": [ { "text": "Cas9 and TCF1-targeting sgRNA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Jurkat E6-1 cell line", "tag": "attribute" } ], "title": [ { "text": "JurkatCas9_TCF1g5_ATACseq_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19014258", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-05-04T18:49:06.663Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014258" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014258{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014258/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014258/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19014258" } } }, { "name": "GSM5281753", "accession": "SAMN19014861", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-22T00:00:00Z", "update": "2023-05-16T08:39:55.150Z", "submitted": "2021-05-04T18:52:05.270Z", "characteristics": { "External Id": [ { "text": "SAMN19014861", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Faryabi, Pathology, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-02-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-22T02:39:27.123Z" } ], "INSDC secondary accession": [ { "text": "SRS8873321" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8873321" } ], "cell line": [ { "text": "DND41 cell line", "tag": "attribute" } ], "cell type": [ { "text": "T-ALL cell line", "tag": "attribute" } ], "lentiviral transduction": [ { "text": "Cas9 and LEF1+TCF1-targeting sgRNA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DND41 cell line", "tag": "attribute" } ], "title": [ { "text": "DND41Cas9_LEF1_TCF1_KO_d6_ATAC_rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19014861", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-05-04T18:52:05.270Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014861" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014861{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014861/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014861/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19014861" } } }, { "name": "GSM5283092", "accession": "SAMN19024211", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-22T00:00:00Z", "update": "2022-04-02T02:50:52.483Z", "submitted": "2021-05-05T14:06:07.427Z", "characteristics": { "External Id": [ { "text": "SAMN19024211", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Baxter Laboratories, Stanford University" } ], "INSDC first public": [ { "text": "2021-05-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-22T02:23:22.723Z" } ], "INSDC secondary accession": [ { "text": "SRS8871463" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8871463" } ], "cell type": [ { "text": "human lung fibroblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002553" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "human fibroblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000042" ], "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq Fibroblast rep2" } ], "treatment": [ { "text": "no dnAP-1 (control)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19024211", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-05T14:06:07.427Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19024211" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19024211{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19024211/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19024211/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19024211" } } }, { "name": "GSM5290704", "accession": "SAMN19108920", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-12T00:00:00Z", "update": "2022-04-02T03:10:26.696Z", "submitted": "2021-05-11T14:12:13.383Z", "characteristics": { "External Id": [ { "text": "SAMN19108920", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Peter MacCallum Cancer Centre" } ], "INSDC first public": [ { "text": "2021-05-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-13T05:50:36.360Z" } ], "INSDC secondary accession": [ { "text": "SRS8955695" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8955695" } ], "cell line": [ { "text": "MM1.S", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005724" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Multiple Myeloma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001378" ], "tag": "attribute" } ], "timepoint": [ { "text": "2 hours", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_5417" ], "tag": "attribute" } ], "title": [ { "text": "ATACseq_MM1S_A241_2hours" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19108920", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-11T14:12:13.383Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19108920" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19108920{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19108920/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19108920/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19108920" } } }, { "name": "GSM5292864", "accession": "SAMN19128585", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-13T00:00:00Z", "update": "2022-04-02T03:14:21.367Z", "submitted": "2021-05-12T22:11:09.153Z", "characteristics": { "External Id": [ { "text": "SAMN19128585", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Neurobiology and Behavior, University of California Irvine" } ], "INSDC first public": [ { "text": "2021-05-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-13T07:34:26.637Z" } ], "INSDC secondary accession": [ { "text": "SRS8955119" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8955119" } ], "age": [ { "text": "90", "tag": "attribute" } ], "brain region": [ { "text": "FC", "tag": "attribute" } ], "diagnosis": [ { "text": "AD", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003140" ], "tag": "attribute" } ], "isolation": [ { "text": "unbiased total nuclei isolation", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "pmi": [ { "text": "3.75", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "AD brain", "tag": "attribute" } ], "title": [ { "text": "Sample-40 (snATAC-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19128585", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-12T22:11:09.153Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19128585" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19128585{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19128585/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19128585/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19128585" } } }, { "name": "GSM5341063", "accession": "SAMN19337104", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-26T00:00:00Z", "update": "2022-04-02T04:10:39.157Z", "submitted": "2021-05-25T16:55:07.530Z", "characteristics": { "External Id": [ { "text": "SAMN19337104", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Harvard" } ], "INSDC first public": [ { "text": "2021-05-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-26T04:25:16.493Z" } ], "INSDC secondary accession": [ { "text": "SRS9064291" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9064291" } ], "cell line": [ { "text": "WI-38", "tag": "attribute" } ], "extract protocol": [ { "text": "Cells were trypsinized, washed and pelleted. Cell concentration was determined and 100,000 cells were carried forward per reaction", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population doublings": [ { "text": "64", "tag": "attribute" } ], "source_name": [ { "text": "WI-38", "tag": "attribute" } ], "time course": [ { "text": "RS timecourse", "tag": "attribute" } ], "time point/day": [ { "text": "TP4", "tag": "attribute" } ], "title": [ { "text": "RS_atac_hTERT_TP4_C" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19337104", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-25T16:55:07.530Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19337104" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19337104{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19337104/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19337104/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19337104" } } }, { "name": "GSM5349918", "accession": "SAMN19471087", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-08T00:00:00Z", "update": "2022-07-11T00:12:11.753Z", "submitted": "2021-05-31T16:42:06.027Z", "characteristics": { "External Id": [ { "text": "SAMN19471087", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wei Chen's lab, Department of Biology, Southern University of Science and Technology" } ], "INSDC first public": [ { "text": "2022-07-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-08T02:08:23.983Z" } ], "INSDC secondary accession": [ { "text": "SRS9103962" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9103962" } ], "cell line": [ { "text": "786-O", "tag": "attribute" } ], "cell type": [ { "text": "renal cell carcinoma (RCC) cell line", "tag": "attribute" } ], "genotype/variation": [ { "text": "DPF3a overexpression", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "786-O cells", "tag": "attribute" } ], "title": [ { "text": "786-O_DPF3a_ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19471087", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-31T16:42:06.027Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19471087" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19471087{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19471087/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19471087/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19471087" } } }, { "name": "GSM5365284", "accession": "SAMN19609147", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-10T00:00:00Z", "update": "2022-07-01T11:36:59.022Z", "submitted": "2021-06-08T18:54:05.933Z", "characteristics": { "External Id": [ { "text": "SAMN19609147", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "pediatric oncology, Dana Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2022-06-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-10T01:58:21.860Z" } ], "INSDC secondary accession": [ { "text": "SRS9161782" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9161782" } ], "cell line": [ { "text": "NALM-6", "tag": "attribute" } ], "library strategy": [ { "text": "scATAC-seq", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "B-cell precursor leukemia cell line NALM-6", "tag": "attribute" } ], "title": [ { "text": "NALM-6_CARTtreated_24h_sc0001 [H10_S176]" } ], "treatment": [ { "text": "CAR T-cells", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19609147", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-08T18:54:05.933Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19609147" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19609147{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19609147/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19609147/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19609147" } } }, { "name": "GSM5366623", "accession": "SAMN19644723", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-28T00:00:00Z", "update": "2022-04-02T05:35:26.872Z", "submitted": "2021-06-09T14:46:07.333Z", "characteristics": { "External Id": [ { "text": "SAMN19644723", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2021-09-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-28T03:45:16.560Z" } ], "INSDC secondary accession": [ { "text": "SRS9166729" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9166729" } ], "cell cycle phase": [ { "text": "early S", "tag": "attribute" } ], "cell type": [ { "text": "RPE", "tag": "attribute" } ], "genotype/variation": [ { "text": "Control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Retinal Pigmented Epithelial", "tag": "attribute" } ], "title": [ { "text": "Ctrl.ATAC.ES.rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19644723", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-09T14:46:07.333Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19644723" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19644723{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19644723/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19644723/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19644723" } } }, { "name": "GSM5368884", "accession": "SAMN19656030", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-11T00:00:00Z", "update": "2022-04-02T05:40:02.774Z", "submitted": "2021-06-10T11:26:08.627Z", "characteristics": { "External Id": [ { "text": "SAMN19656030", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tianjin Medical University" } ], "INSDC first public": [ { "text": "2021-06-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-11T02:57:16.660Z" } ], "INSDC secondary accession": [ { "text": "SRS9176512" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9176512" } ], "cell type": [ { "text": "myeloma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001378" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "LP-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003055" ], "tag": "attribute" } ], "tissue": [ { "text": "cell strain", "tag": "attribute" } ], "title": [ { "text": "s-2 LP-1 WT" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19656030", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-10T11:26:08.627Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19656030" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19656030{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19656030/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19656030/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19656030" } } }, { "name": "GSM5387836", "accession": "SAMN19731419", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-17T00:00:00Z", "update": "2022-04-02T06:02:43.608Z", "submitted": "2021-06-16T14:31:07.693Z", "characteristics": { "External Id": [ { "text": "SAMN19731419", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Radiation Oncology, University of California, San Francisco" } ], "INSDC first public": [ { "text": "2021-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-17T14:22:18.307Z" } ], "INSDC secondary accession": [ { "text": "SRS9227690" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9227690" } ], "cell line": [ { "text": "C4-2B", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006365" ], "tag": "attribute" } ], "cell type": [ { "text": "castration resistant prostate cancer", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "castration resistant prostate cancer", "tag": "attribute" } ], "title": [ { "text": "C42B sgKIF4A rep1 [ATAC-Seq]" } ], "treatment": [ { "text": "sgKIF4A", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19731419", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-16T14:31:07.693Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19731419" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19731419{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19731419/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19731419/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19731419" } } }, { "name": "GSM5399620", "accession": "SAMN19909850", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-29T01:14:39Z", "update": "2022-07-16T11:37:51.913Z", "submitted": "2022-04-29T01:14:39Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-29", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-29", "tag": "attribute" } ], "External Id": [ { "text": "SAMN19909850", "tag": "Namespace:BioSample" }, { "text": "GSM5399620", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-29T01:14:39Z" } ], "INSDC last update": [ { "text": "2022-04-29T01:14:39Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS9291835" } ], "Submitter Id": [ { "text": "GSM5399620" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "cancer cell line", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "22Rv1", "tag": "attribute" } ], "title": [ { "text": "22Rv1_ATAC_48hr_Rep3" } ], "treatment": [ { "text": "48hr MYCi - 10 µM", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19909850", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-29T01:14:39Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909850" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909850{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909850/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909850/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19909850" } } }, { "name": "GSM5403571", "accession": "SAMN19915273", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-29T00:00:00Z", "update": "2022-04-02T06:57:12.820Z", "submitted": "2021-06-28T08:58:03.203Z", "characteristics": { "External Id": [ { "text": "SAMN19915273", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Guangzhou Institute of Biomedicine and Health,Chinese Academy of Sciences" } ], "INSDC first public": [ { "text": "2021-06-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-29T05:33:21.883Z" } ], "INSDC secondary accession": [ { "text": "SRS9286552" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9286552" } ], "cell type": [ { "text": "fibroblast-induced cardiomyocyte", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "fibroblast-induced cardiomyocyte", "tag": "attribute" } ], "title": [ { "text": "5F_D14 ATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19915273", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-28T08:58:03.203Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19915273" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19915273{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19915273/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19915273/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19915273" } } }, { "name": "GSM5404717", "accession": "SAMN19921366", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-18T00:00:00Z", "update": "2022-08-19T00:14:19.908Z", "submitted": "2021-06-28T18:13:18.857Z", "characteristics": { "External Id": [ { "text": "SAMN19921366", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genomics and Immunoregulation, LIMES (Life and Medical Sciences Center Genomics and Immunoregulation)" } ], "INSDC first public": [ { "text": "2022-08-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-18T01:25:32.627Z" } ], "INSDC secondary accession": [ { "text": "SRS9289742" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9289742" } ], "cell line": [ { "text": "BxPC-3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "2", "tag": "attribute" } ], "source_name": [ { "text": "Pancreatic cancer", "tag": "attribute" } ], "time point": [ { "text": "ctrl", "tag": "attribute" } ], "tissue": [ { "text": "Pancreatic cancer", "tag": "attribute" } ], "title": [ { "text": "B_C_2_ATAC" } ], "treatment": [ { "text": "C", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19921366", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-06-28T18:13:18.857Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19921366" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19921366{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19921366/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19921366/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19921366" } } }, { "name": "GSM5406010", "accession": "SAMN19923247", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-30T00:00:00Z", "update": "2022-04-02T07:00:59.506Z", "submitted": "2021-06-28T18:54:28.150Z", "characteristics": { "External Id": [ { "text": "SAMN19923247", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute of Oncology Research IOR" } ], "INSDC first public": [ { "text": "2022-01-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-30T01:41:15.313Z" } ], "INSDC secondary accession": [ { "text": "SRS9291013" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9291013" } ], "cell type": [ { "text": "DMS-53", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002165" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ATAQ-Seq material from SCLC samples treated 0 or 4h with a dna binding drug", "tag": "attribute" } ], "title": [ { "text": "ATAQ-PM1183 R1" } ], "treatment": [ { "text": "treated with biotinilated PM01183 50nM for 4 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19923247", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-28T18:54:28.150Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19923247" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19923247{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19923247/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19923247/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19923247" } } }, { "name": "GSM5417463", "accession": "SAMN20057201", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-07-07T00:00:00Z", "update": "2022-04-02T07:41:30.239Z", "submitted": "2021-07-04T13:11:14.973Z", "characteristics": { "External Id": [ { "text": "SAMN20057201", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The Ohio State University" } ], "INSDC first public": [ { "text": "2021-07-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-07-07T03:07:16.230Z" } ], "INSDC secondary accession": [ { "text": "SRS9396243" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9396243" } ], "cell line": [ { "text": "MOLM13-RES", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Bone marrow, AML", "tag": "attribute" } ], "title": [ { "text": "MOLM13-RES cells, V3" } ], "treatment cohort": [ { "text": "Vehicle", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000732" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20057201", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-04T13:11:14.973Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20057201" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20057201{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20057201/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20057201/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20057201" } } }, { "name": "GSM5421204", "accession": "SAMN20085346", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-09T00:00:00Z", "update": "2022-04-02T07:46:30.720Z", "submitted": "2021-07-06T16:35:04.247Z", "characteristics": { "External Id": [ { "text": "SAMN20085346", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Systems Pharmacology and Translational Therapeutics,Institute for Immunology, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-03-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-09T01:57:16.260Z" } ], "INSDC secondary accession": [ { "text": "SRS9411559" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9411559" } ], "age": [ { "text": "62", "tag": "attribute" } ], "cell subset": [ { "text": "CD8_EM1", "tag": "attribute" } ], "cell type": [ { "text": "CD8", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000625" ], "tag": "attribute" } ], "donor id": [ { "text": "ND473", "tag": "attribute" } ], "donor type": [ { "text": "Older", "tag": "attribute" } ], "library preparation group": [ { "text": "3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample acquisition location": [ { "text": "UPenn", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "PBMC", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "title": [ { "text": "A_S8085" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20085346", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-06T16:35:04.247Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20085346" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20085346{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20085346/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20085346/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20085346" } } }, { "name": "GSM5429605", "accession": "SAMN20111665", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-17T00:00:00Z", "update": "2022-08-17T23:13:42.204Z", "submitted": "2021-07-07T17:56:07.387Z", "characteristics": { "External Id": [ { "text": "SAMN20111665", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MEMORIAL SLOAN KETTERING CANCER CTR" } ], "INSDC first public": [ { "text": "2022-08-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-17T01:39:40.223Z" } ], "INSDC secondary accession": [ { "text": "SRS9422506" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9422506" } ], "cell type": [ { "text": "human MPNST tumor-derived cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "prc2 status": [ { "text": "loss", "tag": "attribute" } ], "source_name": [ { "text": "human malignant peripheral nerve sheath tumor cells", "tag": "attribute" } ], "suz12": [ { "text": "Knockout", "tag": "attribute" } ], "title": [ { "text": "M3_sgSUZ12_rep2" } ], "treatment": [ { "text": "PBS", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20111665", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-07-07T17:56:07.387Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20111665" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20111665{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20111665/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20111665/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20111665" } } }, { "name": "GSM5454897", "accession": "SAMN20247328", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-05T00:00:00Z", "update": "2022-04-02T08:45:04.826Z", "submitted": "2021-07-15T14:18:47.870Z", "characteristics": { "External Id": [ { "text": "SAMN20247328", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institut universitaire de pathologie, Département de Pathologie Expérimentale, CHUV" } ], "INSDC first public": [ { "text": "2022-03-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-05T02:30:33.193Z" } ], "INSDC secondary accession": [ { "text": "SRS9503590" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9503590" } ], "cell line": [ { "text": "SU-CCS-1 (RRID:CVCL_B470)", "tag": "attribute" } ], "cell type": [ { "text": "Derived from the pleural effusion of a 16 year old Caucasian girl with a heel CCS tumor", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "title": [ { "text": "SUCCS1_wt_ATAC_1" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20247328", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-15T14:18:47.870Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20247328" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20247328{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20247328/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20247328/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20247328" } } }, { "name": "GSM5471933", "accession": "SAMN20407858", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-30T00:00:00Z", "update": "2022-04-02T09:29:44.502Z", "submitted": "2021-07-26T15:16:06.537Z", "characteristics": { "External Id": [ { "text": "SAMN20407858", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Fudan University" } ], "INSDC first public": [ { "text": "2021-09-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-30T05:03:44.280Z" } ], "INSDC secondary accession": [ { "text": "SRS9594019" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9594019" } ], "cell type": [ { "text": "colorectal adenocarcinoma cell lines", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SPT5-dTAG DLD1", "tag": "attribute" } ], "title": [ { "text": "ATAC_Spt5_Control_rep2_DLD1" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20407858", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-26T15:16:06.537Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20407858" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20407858{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20407858/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20407858/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20407858" } } }, { "name": "GSM5474462", "accession": "SAMN20427565", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-12T01:37:48Z", "update": "2022-07-16T01:12:41.711Z", "submitted": "2022-04-12T01:37:48Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-12", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-12", "tag": "attribute" } ], "External Id": [ { "text": "GSM5474462", "tag": "Namespace:BioSample" }, { "text": "SAMN20427565", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-12T01:37:48Z" } ], "INSDC last update": [ { "text": "2022-04-12T01:37:48Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS9601537" } ], "Submitter Id": [ { "text": "GSM5474462" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "Adipose-Derived Stem Cells", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "adipose", "tag": "attribute" } ], "time point": [ { "text": "8hour", "tag": "attribute" } ], "title": [ { "text": "8h rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20427565", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-12T01:37:48Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20427565" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20427565{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20427565/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20427565/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20427565" } } }, { "name": "GSM5493536", "accession": "SAMN20511706", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-11T00:00:00Z", "update": "2022-08-11T23:11:21.918Z", "submitted": "2021-07-31T11:11:04.377Z", "characteristics": { "External Id": [ { "text": "SAMN20511706", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Lammerding lab, Molecular Biology and Genetics, Cornell University" } ], "INSDC first public": [ { "text": "2022-08-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-11T01:25:02.640Z" } ], "INSDC secondary accession": [ { "text": "SRS9651916" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9651916" } ], "cell line": [ { "text": "HT1080", "tag": "attribute" } ], "collagen matrix concentration": [ { "text": "1.7 mg/mL of rat tail type-I collagen (Corning)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "fibrosarcoma cell", "tag": "attribute" } ], "title": [ { "text": "High concentration rep 4" } ], "treatment": [ { "text": "MMP inhibitor GM6001 (Millipore, 20 μM)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20511706", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-07-31T11:11:04.377Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20511706" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20511706{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20511706/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20511706/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20511706" } } }, { "name": "GSM5520147", "accession": "SAMN20835385", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-18T00:00:00Z", "update": "2022-04-02T12:25:19.058Z", "submitted": "2021-08-17T11:26:55.013Z", "characteristics": { "External Id": [ { "text": "SAMN20835385", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chinese Academy of Sciences" } ], "INSDC first public": [ { "text": "2021-08-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-18T02:35:38.887Z" } ], "INSDC secondary accession": [ { "text": "SRS9807550" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9807550" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "normal pituitary tissues", "tag": "attribute" } ], "tissue": [ { "text": "normal pituitary tissues", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq_N2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20835385", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-08-17T11:26:55.013Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20835385" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20835385{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20835385/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20835385/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20835385" } } }, { "name": "GSM5530255", "accession": "SAMN20867065", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-04T00:00:00Z", "update": "2023-05-18T17:16:35.550Z", "submitted": "2021-08-20T09:43:03.350Z", "characteristics": { "External Id": [ { "text": "SAMN20867065", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Charité - Universitätsmedizin Berlin" } ], "INSDC first public": [ { "text": "2023-04-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-04T01:33:56.060Z" } ], "INSDC secondary accession": [ { "text": "SRS9846436" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9846436" } ], "cell type": [ { "text": "WAT-derived mesenchymal stromal cell", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "WAT MSC", "tag": "attribute" } ], "title": [ { "text": "WAT_atac_rep3" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-08-20T09:43:03.350Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867065" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867065{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867065/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867065/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20867065" } } }, { "name": "GSM5538081", "accession": "SAMN20990758", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-28T00:00:00Z", "update": "2022-08-02T00:43:07.643Z", "submitted": "2021-08-26T12:17:17.787Z", "characteristics": { "External Id": [ { "text": "SAMN20990758", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Aaron Zorn, Developmental Biology, Cincinnati Children's Hospital Medical Center" } ], "INSDC first public": [ { "text": "2022-07-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-28T01:40:34.147Z" } ], "INSDC secondary accession": [ { "text": "SRS9930072" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9930072" } ], "developmental stage": [ { "text": "Day 1 mesendoderm", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Induced pluripotent stem cells", "tag": "attribute" } ], "title": [ { "text": "DE DAY1 - ATAC Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20990758", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-08-26T12:17:17.787Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20990758" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20990758{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20990758/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20990758/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20990758" } } }, { "name": "GSM5553089", "accession": "SAMN21171249", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-31T00:00:00Z", "update": "2022-04-03T23:30:05.621Z", "submitted": "2021-09-01T14:11:14.377Z", "characteristics": { "External Id": [ { "text": "SAMN21171249", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Vancouver Prostate Centre" } ], "INSDC first public": [ { "text": "2022-03-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-31T02:37:21.457Z" } ], "INSDC secondary accession": [ { "text": "SRS9992184" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9992184" } ], "cell type": [ { "text": "ENZ-resistant CRPC-NE", "tag": "attribute" } ], "disease state": [ { "text": "AR positive, Neuro Endocrine like", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "shrna": [ { "text": "shASCL1", "tag": "attribute" } ], "source_name": [ { "text": "42D Prostate cancer cell line generated from mouse xenograft of LNCaP", "tag": "attribute" } ], "title": [ { "text": "42D-ENZR-shASCL1-ATAC" } ], "treatment": [ { "text": "Enzalutamide", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_68534" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21171249", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-09-01T14:11:14.377Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21171249" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21171249{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21171249/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21171249/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21171249" } } }, { "name": "GSM5571602", "accession": "SAMN21369091", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-11T00:00:00Z", "update": "2022-04-02T17:11:29.038Z", "submitted": "2021-09-09T13:26:15.550Z", "characteristics": { "External Id": [ { "text": "SAMN21369091", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Weill Cornell Medicine" } ], "INSDC first public": [ { "text": "2021-09-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-13T05:52:16.737Z" } ], "INSDC secondary accession": [ { "text": "SRS10103432" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10103432" } ], "cell line": [ { "text": "SUDH4", "tag": "attribute" } ], "crispri knock down": [ { "text": "Non-targeting Control", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SUDH4", "tag": "attribute" } ], "title": [ { "text": "SUDH4_Control_rep1 [ATAC-seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21369091", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-09-09T13:26:15.550Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21369091" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21369091{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21369091/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21369091/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21369091" } } }, { "name": "GSM5582116", "accession": "SAMN21445322", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-30T00:00:00Z", "update": "2023-05-18T18:00:16.223Z", "submitted": "2021-09-15T17:26:07.650Z", "characteristics": { "External Id": [ { "text": "SAMN21445322", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "POB, NCI" } ], "INSDC first public": [ { "text": "2023-03-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-30T01:26:21.750Z" } ], "INSDC secondary accession": [ { "text": "SRS10176200" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10176200" } ], "cell type": [ { "text": "Neuroblastoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "IMR32 Cells", "tag": "attribute" } ], "title": [ { "text": "IMR32_1_siCtrl_r1" } ], "transfection": [ { "text": "siCtrl", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-09-15T17:26:07.650Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21445322" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21445322{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21445322/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21445322/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21445322" } } }, { "name": "GSM5585605", "accession": "SAMN21501776", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-31T00:00:00Z", "update": "2022-04-02T18:40:18.760Z", "submitted": "2021-09-18T11:37:05.973Z", "characteristics": { "External Id": [ { "text": "SAMN21501776", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "REHLAB, BIOLOGICAL STRUCTURE, UNIVERSITY OF WASHINGTON" } ], "INSDC first public": [ { "text": "2021-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-31T04:52:27.117Z" } ], "INSDC secondary accession": [ { "text": "SRS10225818" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10225818" } ], "culture": [ { "text": "4DIV", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "fetal retal", "tag": "attribute" } ], "title": [ { "text": "FD74 + 4DIV" } ], "treatment": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21501776", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-09-18T11:37:05.973Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21501776" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21501776{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21501776/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21501776/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21501776" } } }, { "name": "GSM5589395", "accession": "SAMN21523907", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-23T00:00:00Z", "update": "2022-04-02T19:00:45.653Z", "submitted": "2021-09-20T13:08:07.570Z", "characteristics": { "External Id": [ { "text": "SAMN21523907", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of California San Diego" } ], "INSDC first public": [ { "text": "2021-09-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-23T05:05:18.213Z" } ], "INSDC secondary accession": [ { "text": "SRS10261108" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10261108" } ], "biosample": [ { "text": "flash-frozen tissue", "tag": "attribute" } ], "case of death": [ { "text": "cerebral vascular accident", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000712" ], "tag": "attribute" } ], "donor sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "race": [ { "text": "asian", "ontologyTerms": [ "http://purl.obolibrary.org/obo/HANCESTRO_0008" ], "tag": "attribute" } ], "sample type": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "source_name": [ { "text": "skin non sun exposed", "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq skin_SM-IOBHT" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21523907", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-09-20T13:08:07.570Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21523907" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21523907{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21523907/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21523907/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21523907" } } }, { "name": "GSM5638904", "accession": "SAMN22404978", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-05T00:00:00Z", "update": "2022-04-02T23:35:04.216Z", "submitted": "2021-10-19T11:36:04.163Z", "characteristics": { "External Id": [ { "text": "SAMN22404978", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Liverool" } ], "INSDC first public": [ { "text": "2022-03-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-05T02:35:39.327Z" } ], "INSDC secondary accession": [ { "text": "SRS10635079" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10635079" } ], "cell line": [ { "text": "HeLa", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001185" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HeLa_VH298", "tag": "attribute" } ], "title": [ { "text": "VH298_rep2" } ], "treatment": [ { "text": "100 µM VH298 for 24 hs", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22404978", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-10-19T11:36:04.163Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22404978" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22404978{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22404978/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22404978/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22404978" } } }, { "name": "GSM5656777", "accession": "SAMN22569474", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-13T00:00:00Z", "update": "2023-05-18T19:13:44.903Z", "submitted": "2021-10-26T11:59:03.046Z", "characteristics": { "External Id": [ { "text": "SAMN22569474", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2023-03-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-13T14:59:34.764Z" } ], "INSDC secondary accession": [ { "text": "SRS10722073" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10722073" } ], "Sex": [ { "text": "female", "tag": "attribute" } ], "cell line": [ { "text": "RPE-1", "tag": "attribute" } ], "cell type": [ { "text": "hTERT-immortalized retinal pigment epithelial cell line", "tag": "attribute" } ], "genotype": [ { "text": "p53 KO LMB2OE", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Retina (female)", "tag": "attribute" } ], "title": [ { "text": "RPE-1 p53KO LMB2OE + Reversine 3" } ], "treatment": [ { "text": "Reversine 0.5 uM 48 hours before splitting, long-term", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-10-26T11:59:03.046Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22569474" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22569474{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22569474/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22569474/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22569474" } } }, { "name": "GSM5663912", "accession": "SAMN22820375", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-23T00:00:00Z", "update": "2022-10-25T05:15:18.873Z", "submitted": "2021-11-01T12:01:06.433Z", "characteristics": { "External Id": [ { "text": "SAMN22820375", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Ryan Lab, Pathology, University of Michigan Medical School" } ], "INSDC first public": [ { "text": "2022-10-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-10-23T02:22:51.247Z" } ], "INSDC secondary accession": [ { "text": "SRS10820855" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10820855" } ], "cell line": [ { "text": "Karpas422", "tag": "attribute" } ], "cell type": [ { "text": "Diffuse large B-cell lymphoma cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Karpas422 cell line", "tag": "attribute" } ], "title": [ { "text": "Karpas422_ATAC-Seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22820375", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-11-01T12:01:06.433Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22820375" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22820375{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22820375/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22820375/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22820375" } } }, { "name": "GSM5667134", "accession": "SAMN22841654", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-04T00:00:00Z", "update": "2022-04-03T01:59:21.703Z", "submitted": "2021-11-02T17:35:03.357Z", "characteristics": { "External Id": [ { "text": "SAMN22841654", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "molecular biomedicine, University of Sydney" } ], "INSDC first public": [ { "text": "2021-11-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-04T17:59:18.123Z" } ], "INSDC secondary accession": [ { "text": "SRS10847427" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10847427" } ], "group": [ { "text": "Transdifferentiating", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human brain pericytes", "tag": "attribute" } ], "time": [ { "text": "10 min", "tag": "attribute" } ], "title": [ { "text": "[ATAC-Seq] Human brain pericytes_T10" } ], "treatment": [ { "text": "N2 medium", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22841654", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-02T17:35:03.357Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22841654" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22841654{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22841654/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22841654/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22841654" } } }, { "name": "GSM5681658", "accession": "SAMN22985832", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-24T00:00:00Z", "update": "2022-04-03T02:41:14.526Z", "submitted": "2021-11-08T15:10:05.483Z", "characteristics": { "External Id": [ { "text": "SAMN22985832", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Public Health Genomics, University of Virginia" } ], "INSDC first public": [ { "text": "2022-01-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-24T21:36:06.379Z" } ], "INSDC secondary accession": [ { "text": "SRS10996230" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10996230" } ], "age": [ { "text": "57", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "source_name": [ { "text": "Coronary artery", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001621" ], "tag": "attribute" } ], "tissue": [ { "text": "Coronary artery (LAD)", "tag": "attribute" } ], "title": [ { "text": "068 Coronary artery bulk ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22985832", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-08T15:10:05.483Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22985832" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22985832{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22985832/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22985832/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22985832" } } }, { "name": "GSM5684379", "accession": "SAMN23012531", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-16T00:00:00Z", "update": "2022-04-03T02:51:23.272Z", "submitted": "2021-11-09T21:51:03.283Z", "characteristics": { "External Id": [ { "text": "SAMN23012531", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Human Genetics and Genomics, Department of Biomedical Sciences, Korea University College of Medicine" } ], "INSDC first public": [ { "text": "2021-12-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-16T03:06:21.647Z" } ], "INSDC secondary accession": [ { "text": "SRS11024597" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11024597" } ], "cell line": [ { "text": "SKBR3", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001236" ], "tag": "attribute" } ], "cell type": [ { "text": "HER2 positive", "tag": "attribute" }, { "text": "Breast cancer cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002885" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SKBR3", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001236" ], "tag": "attribute" } ], "title": [ { "text": "SKBR3_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23012531", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-09T21:51:03.283Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23012531" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23012531{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23012531/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23012531/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23012531" } } }, { "name": "GSM5729779", "accession": "SAMN23958106", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-10T00:00:00Z", "update": "2023-05-18T21:10:21.406Z", "submitted": "2021-12-12T13:08:03.720Z", "characteristics": { "External Id": [ { "text": "SAMN23958106", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hodges Lab, Department of Molecular & Cellular Biology, Baylor College of Medicine" } ], "INSDC first public": [ { "text": "2023-01-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-01-10T14:36:05.100Z" } ], "INSDC secondary accession": [ { "text": "SRS11292362" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11292362" } ], "cell line": [ { "text": "THP-1 cells", "tag": "attribute" } ], "marker": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "THP-1 cells", "tag": "attribute" } ], "title": [ { "text": "ATAC_THP1_BRM014-72h_rep2" } ], "treatment": [ { "text": "BRM014 for 72 h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23958106", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-12-12T13:08:03.720Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23958106" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23958106{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23958106/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23958106/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23958106" } } }, { "name": "GSM5739030", "accession": "SAMN24146407", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-18T00:50:13.233Z", "update": "2022-04-03T06:15:21.470Z", "submitted": "2021-12-16T23:15:05.713Z", "characteristics": { "External Id": [ { "text": "SAMN24146407", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jyoban Hospital" } ], "INSDC first public": [ { "text": "2021-12-18T00:50:13.233Z" } ], "INSDC last update": [ { "text": "2021-12-18T00:50:13.233Z" } ], "INSDC secondary accession": [ { "text": "SRS11332959" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11332959" } ], "cell line": [ { "text": "HaCat", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002056" ], "tag": "attribute" } ], "genotype": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Keratinocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000312" ], "tag": "attribute" } ], "title": [ { "text": "WT.m2" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24146407", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-12-16T23:15:05.713Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24146407" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24146407{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24146407/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24146407/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24146407" } } }, { "name": "GSM5742999", "accession": "SAMN24247613", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-03T03:02:19Z", "update": "2022-08-04T07:17:37.909Z", "submitted": "2022-08-03T03:02:19Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-08-03", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-08-03", "tag": "attribute" } ], "External Id": [ { "text": "SAMN24247613", "tag": "Namespace:BioSample" }, { "text": "GSM5742999", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-08-03T03:02:19Z" } ], "INSDC last update": [ { "text": "2022-08-03T03:02:19Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS11354440" } ], "Submitter Id": [ { "text": "GSM5742999" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "H9 (primed, and naive hPSCs) and Sigma (primed hPSCs, naive hPSCs, day 30 ASECRiAV conversion (trophobast stem cells and extraembryonic mesoderm cells)", "tag": "attribute" } ], "cell type": [ { "text": "mix of human naive pluripotent stem cells (H9 and Sigma), primed pluripotent stem cells (H9 and Sigma), trophoblast stem cells (Sigma) and extraembryonic mesoderm cells (Sigma), all samples were pooled in one.", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primed and naive hPSCs, hTSCs and EXMCs.", "tag": "attribute" } ], "title": [ { "text": "Naive_primed_D30ASECRiAV_10XscATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24247613", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-03T03:02:19Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24247613" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24247613{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24247613/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24247613/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24247613" } } }, { "name": "GSM5745675", "accession": "SAMN24273174", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-16T00:00:00Z", "update": "2022-07-22T21:10:40.434Z", "submitted": "2021-12-21T10:53:18.060Z", "characteristics": { "External Id": [ { "text": "SAMN24273174", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Medicine, University of California, San Diego (UCSD)" } ], "INSDC first public": [ { "text": "2022-07-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-16T01:33:21.450Z" } ], "INSDC secondary accession": [ { "text": "SRS11363636" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11363636" } ], "chip antibody": [ { "text": "none", "tag": "attribute" } ], "differentiation time": [ { "text": "day07", "tag": "attribute" } ], "genotype": [ { "text": "H9 MLC2v:H2B", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "perturbation": [ { "text": "wild type", "tag": "attribute" } ], "source_name": [ { "text": "ES derived cardiac progenitor cells", "tag": "attribute" } ], "tissue": [ { "text": "ES derived cardiac progenitor cells", "tag": "attribute" } ], "title": [ { "text": "day07.ATAC.Rep2" } ] }, "submittedVia": "JSON_API", "create": "2021-12-21T10:53:18.060Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273174" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273174{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273174/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273174/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24273174" } } }, { "name": "GSM5747971", "accession": "SAMN24320442", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-15T00:00:00Z", "update": "2022-07-22T21:11:38.939Z", "submitted": "2021-12-22T17:03:03.640Z", "characteristics": { "External Id": [ { "text": "SAMN24320442", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of California, San Diego" } ], "INSDC first public": [ { "text": "2022-07-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-15T21:36:17.416Z" } ], "INSDC secondary accession": [ { "text": "SRS11385063" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11385063" } ], "Stage": [ { "text": "mesoderm", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hPSC-derived mesoderm cells", "tag": "attribute" } ], "title": [ { "text": "mesoderm R1" } ] }, "submittedVia": "JSON_API", "create": "2021-12-22T17:03:03.640Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24320442" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24320442{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24320442/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24320442/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24320442" } } }, { "name": "GSM5764467", "accession": "SAMN24497338", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-31T00:00:00Z", "update": "2022-06-30T19:55:56.220Z", "submitted": "2021-12-29T13:57:10.623Z", "characteristics": { "External Id": [ { "text": "SAMN24497338", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Translational Research Institute, Adventhealth" } ], "INSDC first public": [ { "text": "2022-05-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-31T13:56:15.161Z" } ], "INSDC secondary accession": [ { "text": "SRS11444762" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11444762" } ], "antibody": [ { "text": "none", "tag": "attribute" } ], "cell type": [ { "text": "hASCs", "tag": "attribute" } ], "method": [ { "text": "ATAC-seq", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "subcutaneous abdominal ASC", "tag": "attribute" } ], "title": [ { "text": "hs_Sub1_ATAC-seq_abd_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24497338", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-12-29T13:57:10.623Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24497338" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24497338{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24497338/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24497338/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24497338" } } }, { "name": "GSM5765307", "accession": "SAMN24501934", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-17T00:00:00Z", "update": "2022-07-01T21:52:48.611Z", "submitted": "2021-12-29T21:51:02.887Z", "characteristics": { "External Id": [ { "text": "SAMN24501934", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute of MIT and Harvard, Harvard Medical School, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2022-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-17T02:08:20.403Z" } ], "INSDC secondary accession": [ { "text": "SRS11448403" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11448403" } ], "cell line": [ { "text": "AC7", "tag": "attribute" } ], "chip antibody": [ { "text": "N/A", "tag": "attribute" } ], "experimental condition": [ { "text": "lentivirus: full lengh GFP", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "cancer cell line", "tag": "attribute" } ], "title": [ { "text": "ATACseq.AC7.SMARCE1.KO.ATAC.GFP.Rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24501934", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-12-29T21:51:02.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24501934" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24501934{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24501934/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24501934/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24501934" } } }, { "name": "GSM5777984", "accession": "SAMN24726646", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-06T00:00:00Z", "update": "2022-04-11T01:13:36.153Z", "submitted": "2022-01-07T17:52:03.640Z", "characteristics": { "External Id": [ { "text": "SAMN24726646", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "AstraZeneca" } ], "INSDC first public": [ { "text": "2022-04-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-04-06T10:25:08.307Z" } ], "INSDC secondary accession": [ { "text": "SRS11546301" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11546301" } ], "cell line": [ { "text": "H1975", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002271" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell Line", "tag": "attribute" } ], "title": [ { "text": "H1975_osi_DTP_AZD5153_combo-2 [ATAC-seq]" } ], "treatment": [ { "text": "osimertinib DTPs + AZD5153", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24726646", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-01-07T17:52:03.640Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24726646" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24726646{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24726646/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24726646/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24726646" } } }, { "name": "GSM5791930", "accession": "SAMN24776737", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-26T01:29:38Z", "update": "2022-07-16T10:32:11.822Z", "submitted": "2022-04-26T01:29:38Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-26", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-26", "tag": "attribute" } ], "External Id": [ { "text": "SAMN24776737", "tag": "Namespace:BioSample" }, { "text": "GSM5791930", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-26T01:29:38Z" } ], "INSDC last update": [ { "text": "2022-04-26T01:29:38Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS11691835" } ], "Submitter Id": [ { "text": "GSM5791930" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "condition": [ { "text": "experimental control - ATAC performed on genomic DNA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "affected", "tag": "attribute" } ], "source_name": [ { "text": "human lymphoblastoid cell line", "tag": "attribute" } ], "title": [ { "text": "Case3_gDNA_LCL_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24776737", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-26T01:29:38Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776737" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776737{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776737/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776737/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24776737" } } }, { "name": "GSM5799846", "accession": "SAMN24812211", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-01T00:52:26.197Z", "update": "2023-05-18T23:01:41.577Z", "submitted": "2022-01-10T18:24:03.830Z", "characteristics": { "External Id": [ { "text": "SAMN24812211", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Boston Children's Hospital" } ], "INSDC first public": [ { "text": "2023-01-01T00:52:26.197Z" } ], "INSDC last update": [ { "text": "2023-01-01T00:52:26.197Z" } ], "INSDC secondary accession": [ { "text": "SRS11589951" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11589951" } ], "cell line": [ { "text": "AsPC-1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "shRNA": [ { "text": "shOAT #1", "tag": "attribute" } ], "source_name": [ { "text": "AsPC-1 cells", "tag": "attribute" } ], "title": [ { "text": "AsPC-1_shOAT #1_ATAC_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24812211", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-01-10T18:24:03.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24812211" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24812211{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24812211/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24812211/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24812211" } } }, { "name": "GSM5821109", "accession": "SAMN25042836", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-16T01:23:54Z", "update": "2022-09-18T23:30:45.758Z", "submitted": "2022-09-16T01:23:54Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-09-16", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-16", "tag": "attribute" } ], "External Id": [ { "text": "SAMN25042836", "tag": "Namespace:BioSample" }, { "text": "GSM5821109", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-09-16T01:23:54Z" } ], "INSDC last update": [ { "text": "2022-09-16T01:23:54Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS11691910" } ], "Submitter Id": [ { "text": "GSM5821109" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "ESC H9 derived fibroblasts H9F", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "iCM fibroblasts", "tag": "attribute" } ], "title": [ { "text": "Day14 TBX 20 Replicate 1 [ATAC-Seq]" } ], "treatment": [ { "text": "MGT + TBX20", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25042836", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-16T01:23:54Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25042836" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25042836{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25042836/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25042836/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25042836" } } }, { "name": "GSM5823628", "accession": "SAMN25068126", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-21T00:50:12.193Z", "update": "2022-04-03T09:19:40.430Z", "submitted": "2022-01-18T13:58:03.513Z", "characteristics": { "External Id": [ { "text": "SAMN25068126", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Weill Cornell Medicine" } ], "INSDC first public": [ { "text": "2022-01-21T00:50:12.193Z" } ], "INSDC last update": [ { "text": "2022-01-21T00:50:12.193Z" } ], "INSDC secondary accession": [ { "text": "SRS11703500" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11703500" } ], "biopsy site": [ { "text": "lymph node", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000029" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "primary site": [ { "text": "Prostate", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002367" ], "tag": "attribute" } ], "sample type": [ { "text": "prostate cancer PDX", "tag": "attribute" } ], "source_name": [ { "text": "prostate cancer PDX", "tag": "attribute" } ], "title": [ { "text": "PDX01a" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25068126", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-01-18T13:58:03.513Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25068126" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25068126{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25068126/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25068126/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25068126" } } }, { "name": "GSM5833760", "accession": "SAMN25242903", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-19T00:00:00Z", "update": "2022-07-22T21:40:10.796Z", "submitted": "2022-01-25T11:51:08.793Z", "characteristics": { "External Id": [ { "text": "SAMN25242903", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hematology/Oncology, Dana-Farber Cancer Institute/Boston Children's hospital" } ], "INSDC first public": [ { "text": "2022-07-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-19T17:22:17.355Z" } ], "INSDC secondary accession": [ { "text": "SRS11761203" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11761203" } ], "cell line": [ { "text": "HUDEP2", "tag": "attribute" } ], "cell type": [ { "text": "immortalized human erythroid progenitor cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HUDEP2 cells", "tag": "attribute" } ], "title": [ { "text": "B9_DMSO_4h" } ], "treatment": [ { "text": "treated with DMSO by 4h", "tag": "attribute" } ] }, "submittedVia": "JSON_API", "create": "2022-01-25T11:51:08.793Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25242903" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25242903{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25242903/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25242903/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25242903" } } }, { "name": "GSM5835119", "accession": "SAMN25246648", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-11T03:12:36Z", "update": "2022-08-11T23:31:18.606Z", "submitted": "2022-08-11T03:12:36Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-08-11", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-08-11", "tag": "attribute" } ], "External Id": [ { "text": "SAMN25246648", "tag": "Namespace:BioSample" }, { "text": "GSM5835119", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-08-11T03:12:36Z" } ], "INSDC last update": [ { "text": "2022-08-11T03:12:36Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS11762686" } ], "Submitter Id": [ { "text": "GSM5835119" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "human foreskin fibroblasts (hFFs)", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "control", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hFFs, siC", "tag": "attribute" } ], "title": [ { "text": "hFFs, siC, rep1" } ], "treatment": [ { "text": "untreated", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25246648", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-11T03:12:36Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25246648" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25246648{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25246648/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25246648/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25246648" } } }, { "name": "GSM5835526", "accession": "SAMN25248181", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-25T00:50:10.977Z", "update": "2022-04-03T09:57:03.679Z", "submitted": "2022-01-25T18:10:04.703Z", "characteristics": { "External Id": [ { "text": "SAMN25248181", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Surgery, Weill Cornell Medical College" } ], "INSDC first public": [ { "text": "2022-02-25T00:50:10.977Z" } ], "INSDC last update": [ { "text": "2022-02-25T00:50:10.977Z" } ], "INSDC secondary accession": [ { "text": "SRS11764876" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11764876" } ], "cell line": [ { "text": "A375", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002103" ], "tag": "attribute" } ], "cell type": [ { "text": "Melanoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000756" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "A375", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002103" ], "tag": "attribute" } ], "title": [ { "text": "K9M_2" } ], "transfection": [ { "text": "mScarlet-H3.3(K9M)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25248181", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-01-25T18:10:04.703Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25248181" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25248181{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25248181/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25248181/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25248181" } } }, { "name": "GSM5837798", "accession": "SAMN25280644", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-28T00:00:00Z", "update": "2022-08-02T00:48:38.163Z", "submitted": "2022-01-26T11:42:03.326Z", "characteristics": { "External Id": [ { "text": "SAMN25280644", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Washington University in St. Louis" } ], "INSDC first public": [ { "text": "2022-07-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-28T14:36:17.812Z" } ], "INSDC secondary accession": [ { "text": "SRS11775201" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11775201" } ], "Sex": [ { "text": "male", "tag": "attribute" } ], "age": [ { "text": "78", "tag": "attribute" } ], "egfr": [ { "text": "73", "tag": "attribute" } ], "global glomerulosclerosis": [ { "text": "Mild, 10 - 25%", "tag": "attribute" } ], "ifta": [ { "text": "26-50%", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "race": [ { "text": "Non-hispanic White", "tag": "attribute" } ], "source_name": [ { "text": "Human Kidney Cortex - DN4", "tag": "attribute" } ], "title": [ { "text": "DN4_snATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25280644", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-01-26T11:42:03.326Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25280644" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25280644{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25280644/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25280644/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25280644" } } }, { "name": "Fig3g-ND5-2-dead-DddA6-read1-rep2", "accession": "SAMN26024431", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-25T00:41:28.377Z", "update": "2022-04-03T12:07:27.776Z", "submitted": "2022-02-17T13:06:10.637Z", "characteristics": { "External Id": [ { "text": "SAMN26024431", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute" } ], "INSDC first public": [ { "text": "2022-03-25T00:41:28.377Z" } ], "INSDC last update": [ { "text": "2022-03-25T00:41:28.377Z" } ], "INSDC secondary accession": [ { "text": "SRS12044605" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS12044605" } ], "biomaterial provider": [ { "text": "ATCC", "tag": "attribute" } ], "cell line": [ { "text": "HEK293T", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001184" ], "tag": "attribute" } ], "description": [ { "text": "HTS data of cells treated with genome editing agent" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "title": [ { "text": "Human sample from Homo sapiens" } ], "treatment": [ { "text": "Fig3g-ND5-2-dead-DddA6-read1-rep2", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26024431", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-02-17T13:06:10.637Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26024431" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26024431{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26024431/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26024431/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26024431" } } }, { "name": "GSM5906758", "accession": "SAMN26086460", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-06T01:35:14Z", "update": "2022-09-06T23:36:56.048Z", "submitted": "2022-09-06T01:35:14Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-09-06", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-06", "tag": "attribute" } ], "External Id": [ { "text": "GSM5906758", "tag": "Namespace:BioSample" }, { "text": "SAMN26086460", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-09-06T01:35:14Z" } ], "INSDC last update": [ { "text": "2022-09-06T01:35:14Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12047223" } ], "Submitter Id": [ { "text": "GSM5906758" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "donor id": [ { "text": "P1, P3, P4, N1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "primary NK cells", "tag": "attribute" } ], "tissue": [ { "text": "Peripheral Blood", "tag": "attribute" } ], "title": [ { "text": "ATAC_CMVpos1_CMVpos3_CMVpos4_CMVneg1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26086460", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-06T01:35:14Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26086460" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26086460{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26086460/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26086460/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26086460" } } }, { "name": "GSM5915187", "accession": "SAMN26226108", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-27T00:50:12.080Z", "update": "2022-04-03T12:36:14.576Z", "submitted": "2022-02-24T11:59:02.650Z", "characteristics": { "External Id": [ { "text": "SAMN26226108", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Pathology, The University of Michigan" } ], "INSDC first public": [ { "text": "2022-02-27T00:50:12.080Z" } ], "INSDC last update": [ { "text": "2022-02-27T00:50:12.080Z" } ], "INSDC secondary accession": [ { "text": "SRS12094965" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12094965" } ], "drug treatment": [ { "text": "500nM dTag-13 treated OCI-AML3 NPM1c-degron2 cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "OCI-AML3 NPM1c degron2 cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC-Seq OCI-AML3 NPM1c degron2 cell line treated with 500nM dTag-13 rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26226108", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-02-24T11:59:02.650Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26226108" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26226108{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26226108/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26226108/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26226108" } } }, { "name": "GSM5917241", "accession": "SAMN26245495", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-28T00:50:15.830Z", "update": "2022-09-29T00:43:28.810Z", "submitted": "2022-02-25T07:56:04.527Z", "characteristics": { "External Id": [ { "text": "SAMN26245495", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Lu Wang, Biochemistry and Molecular Genetics, Northwestern University" } ], "INSDC first public": [ { "text": "2022-09-28T00:50:15.830Z" } ], "INSDC last update": [ { "text": "2022-09-28T00:50:15.830Z" } ], "INSDC secondary accession": [ { "text": "SRS12104569" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12104569" } ], "cell type": [ { "text": "small cell lung cancer", "tag": "attribute" } ], "genotype": [ { "text": "C11orf53 depleted cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "Low passages (6-10)", "tag": "attribute" } ], "source_name": [ { "text": "NCI-H526", "tag": "attribute" } ], "strain": [ { "text": "ATAC_sgC11orf53-2", "tag": "attribute" } ], "title": [ { "text": "ATAC_sgC11orf53-2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26245495", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-02-25T07:56:04.527Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245495" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245495{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245495/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245495/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26245495" } } }, { "name": "GSM5942327", "accession": "SAMN26543158", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-01T00:59:23.550Z", "update": "2022-04-04T00:00:54.596Z", "submitted": "2022-03-09T16:01:04.527Z", "characteristics": { "External Id": [ { "text": "SAMN26543158", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Université Libre de Bruxelles" } ], "INSDC first public": [ { "text": "2022-04-01T00:59:23.550Z" } ], "INSDC last update": [ { "text": "2022-04-01T00:59:23.550Z" } ], "INSDC secondary accession": [ { "text": "SRS12228003" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12228003" } ], "cell type": [ { "text": "Monocytes CD14+", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0001054" ], "tag": "attribute" } ], "disease state": [ { "text": "Covid19: Acute infection", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PBMC", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "title": [ { "text": "AGER012", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26543158", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-03-09T16:01:04.527Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26543158" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26543158{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26543158/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26543158/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26543158" } } }, { "name": "GSM5964147", "accession": "SAMN26853186", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-05T01:43:35Z", "update": "2022-10-06T01:44:23.642Z", "submitted": "2022-10-05T01:43:35Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-10-05", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-10-05", "tag": "attribute" } ], "External Id": [ { "text": "SAMN26853186", "tag": "Namespace:BioSample" }, { "text": "GSM5964147", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-10-05T01:43:35Z" } ], "INSDC last update": [ { "text": "2022-10-05T01:43:35Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12424853" } ], "Submitter Id": [ { "text": "GSM5964147" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Smooth Muscle Cell", "tag": "attribute" } ], "tissue": [ { "text": "ascending aorta", "tag": "attribute" } ], "title": [ { "text": "Smooth muscle cell - D80_Quiescent" } ], "treatment": [ { "text": "Quiescent", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26853186", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-05T01:43:35Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26853186" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26853186{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26853186/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26853186/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26853186" } } }, { "name": "GSM6037591", "accession": "SAMN27505541", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-16T00:50:24.150Z", "update": "2022-07-01T22:36:09.070Z", "submitted": "2022-04-10T15:14:03.487Z", "characteristics": { "External Id": [ { "text": "SAMN27505541", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-06-16T00:50:24.150Z" } ], "INSDC last update": [ { "text": "2022-06-16T00:50:24.150Z" } ], "INSDC secondary accession": [ { "text": "SRS12559918" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12559918" } ], "age": [ { "text": "65 years old", "tag": "attribute" } ], "gender": [ { "text": "female", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "race": [ { "text": "White", "tag": "attribute" } ], "source_name": [ { "text": "Kidney", "tag": "attribute" } ], "tissue": [ { "text": "Kidney", "tag": "attribute" } ], "title": [ { "text": "Human-Kidney-snATAC-seq Sample 4, snATAC-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN27505541", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-10T15:14:03.487Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27505541" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27505541{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27505541/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27505541/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN27505541" } } }, { "name": "GSM6051710", "accession": "SAMN27673430", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-08T00:00:00Z", "update": "2022-08-09T14:15:08.877Z", "submitted": "2022-04-20T13:31:05.050Z", "characteristics": { "External Id": [ { "text": "SAMN27673430", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pulmonary and Critical Care, National Jewish Health" } ], "INSDC first public": [ { "text": "2022-08-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-08T22:53:20.457Z" } ], "INSDC secondary accession": [ { "text": "SRS12688360" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12688360" } ], "cell type": [ { "text": "small airway epithelial cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Sm2 small airway epithelial cells", "tag": "attribute" } ], "title": [ { "text": "Sm2-Ctrl1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN27673430", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-04-20T13:31:05.050Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27673430" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27673430{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27673430/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27673430/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN27673430" } } }, { "name": "GSM6108542", "accession": "SAMN28103025", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-24T00:00:00Z", "update": "2022-06-30T21:38:34.071Z", "submitted": "2022-05-05T15:44:09.300Z", "characteristics": { "External Id": [ { "text": "SAMN28103025", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Research, Hospital for Special Surgery" } ], "INSDC first public": [ { "text": "2022-05-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-24T21:36:31.114Z" } ], "INSDC secondary accession": [ { "text": "SRS12909528" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12909528" } ], "cell type": [ { "text": "pDC", "tag": "attribute" } ], "genotype": [ { "text": "Healthy Donor", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "blood", "tag": "attribute" } ], "tissue": [ { "text": "blood", "tag": "attribute" } ], "title": [ { "text": "pDC,CXCL4,6h,Donor1" } ], "treatment": [ { "text": "CXCL4", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28103025", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-05-05T15:44:09.300Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28103025" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28103025{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28103025/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28103025/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28103025" } } }, { "name": "GSM6124079", "accession": "SAMN28160998", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-06T00:50:33.957Z", "update": "2022-07-01T13:48:46.244Z", "submitted": "2022-05-09T11:08:04.340Z", "characteristics": { "External Id": [ { "text": "SAMN28160998", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UNIVERSITY HOSPITAL REGENSBURG" } ], "INSDC first public": [ { "text": "2022-06-06T00:50:33.957Z" } ], "INSDC last update": [ { "text": "2022-06-06T00:50:33.957Z" } ], "INSDC secondary accession": [ { "text": "SRS12949306" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12949306" } ], "cell line": [ { "text": "PANC1", "tag": "attribute" } ], "condition": [ { "text": "100 TNF", "tag": "attribute" } ], "knockdown": [ { "text": "siSIK3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PANC1 cell line", "tag": "attribute" } ], "timepoint": [ { "text": "24h", "tag": "attribute" } ], "title": [ { "text": "BW10s4_PANC1_R1_4-SIK3-100-24h1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28160998", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-05-09T11:08:04.340Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28160998" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28160998{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28160998/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28160998/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28160998" } } }, { "name": "GSM6126063", "accession": "SAMN28175412", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-31T00:00:00Z", "update": "2023-07-25T21:35:08.173Z", "submitted": "2022-05-10T11:03:02.990Z", "characteristics": { "External Id": [ { "text": "SAMN28175412", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wellcome - MRC Cambridge Stem Cell Institute" } ], "INSDC first public": [ { "text": "2022-08-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-31T07:36:04.783Z" } ], "INSDC secondary accession": [ { "text": "SRS12956112" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12956112" } ], "cell line": [ { "text": "SHSY5Y", "tag": "attribute" } ], "cell type": [ { "text": "neuroblastoma cell line", "tag": "attribute" } ], "genotype": [ { "text": "ASCL1 KO2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SHSY5Y", "tag": "attribute" } ], "title": [ { "text": "SHSY5Y_ASCL1_KO2_rep4" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28175412", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-05-10T11:03:02.990Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28175412" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28175412{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28175412/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28175412/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28175412" } } }, { "name": "GSM6131579", "accession": "SAMN28188743", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-08T00:00:00Z", "update": "2022-07-01T13:49:37.095Z", "submitted": "2022-05-11T07:27:04.493Z", "characteristics": { "External Id": [ { "text": "SAMN28188743", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Erb Lab, Chemistry, The Scripps Research Institute" } ], "INSDC first public": [ { "text": "2022-06-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-08T21:36:19.005Z" } ], "INSDC secondary accession": [ { "text": "SRS12964931" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12964931" } ], "agent": [ { "text": "dTAG-13 (500 nM)", "tag": "attribute" } ], "cell line": [ { "text": "BE(2)-C", "tag": "attribute" } ], "cell type": [ { "text": "Neuroblastoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BE(2)-C", "tag": "attribute" } ], "time point": [ { "text": "24 h", "tag": "attribute" } ], "title": [ { "text": "BE2C-HDAC2-dTAG, ATAC-seq, dTAG-13 (500 nM), 24 h, biol rep 3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28188743", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-05-11T07:27:04.493Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28188743" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28188743{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28188743/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28188743/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28188743" } } }, { "name": "GSM6133911", "accession": "SAMN28203109", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-28T01:43:14Z", "update": "2022-09-29T01:11:17.592Z", "submitted": "2022-09-28T01:43:14Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-09-28", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-28", "tag": "attribute" } ], "External Id": [ { "text": "GSM6133911", "tag": "Namespace:BioSample" }, { "text": "SAMN28203109", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-09-28T01:43:14Z" } ], "INSDC last update": [ { "text": "2022-09-28T01:43:14Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12974199" } ], "Submitter Id": [ { "text": "GSM6133911" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "SK-N-BE(2)C", "tag": "attribute" } ], "cell type": [ { "text": "neuroblastoma", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "SNHG1 knockout", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SK-N-BE(2)C", "tag": "attribute" } ], "title": [ { "text": "SK-N-BE(2)C cells, sgSNHG1 rep1 (ATAC-seq)" } ], "treatment": [ { "text": "SNHG1 gRNA", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28203109", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-28T01:43:14Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28203109" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28203109{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28203109/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28203109/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28203109" } } }, { "name": "GSM6156966", "accession": "SAMN28451483", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-01T00:00:00Z", "update": "2023-05-19T16:33:22.550Z", "submitted": "2022-05-16T13:13:05.273Z", "characteristics": { "External Id": [ { "text": "SAMN28451483", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chris Scharer, Microbiology and Immunology, Emory University" } ], "INSDC first public": [ { "text": "2023-03-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-01T17:21:31.678Z" } ], "INSDC secondary accession": [ { "text": "SRS13020599" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13020599" } ], "cell type": [ { "text": "FCRL5 positive HA- IgD neg B cell", "tag": "attribute" } ], "days post influenza pr8 infection": [ { "text": "7", "tag": "attribute" } ], "donor id": [ { "text": "69", "tag": "attribute" } ], "h1 tetramer": [ { "text": "negative", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sorting markers": [ { "text": "IgDneg CD38 lo/med CD19+ CD3 neg CD4 neg", "tag": "attribute" } ], "source_name": [ { "text": "FCRL5 positive HA- IgD neg B cell", "tag": "attribute" } ], "tissue": [ { "text": "PBMC", "tag": "attribute" } ], "title": [ { "text": "ATAC_p69_d7_Tbet_agg" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28451483", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-05-16T13:13:05.273Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28451483" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28451483{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28451483/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28451483/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28451483" } } }, { "name": "GSM6176311", "accession": "SAMN28591123", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-12-13T00:00:00Z", "update": "2022-12-15T00:53:16.490Z", "submitted": "2022-05-22T20:25:03.660Z", "characteristics": { "External Id": [ { "text": "SAMN28591123", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics and Genome Sciences, Case Western Reserve University" } ], "INSDC first public": [ { "text": "2022-12-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-12-13T13:25:06.108Z" } ], "INSDC secondary accession": [ { "text": "SRS13135196" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13135196" } ], "cell line": [ { "text": "16HBE14o-", "tag": "attribute" } ], "cell type": [ { "text": "human bronchial epithelial cells", "tag": "attribute" } ], "genotype": [ { "text": "ins-35kb #16", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "16HBE14o-", "tag": "attribute" } ], "title": [ { "text": "16HBE14o- ins-35kb #16 rep 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28591123", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-05-22T20:25:03.660Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28591123" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28591123{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28591123/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28591123/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28591123" } } }, { "name": "GSM6213336", "accession": "SAMN28861861", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-06-04T00:00:00Z", "update": "2023-06-06T01:24:06.847Z", "submitted": "2022-06-03T16:40:04.423Z", "characteristics": { "External Id": [ { "text": "SAMN28861861", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NIEHS" } ], "INSDC first public": [ { "text": "2023-06-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-06-04T00:56:43.723Z" } ], "INSDC secondary accession": [ { "text": "SRS13298123" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13298123" } ], "cell type": [ { "text": "Primary human endometrial stromal cells", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "hormone treatment": [ { "text": "EPC", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sirna treatment": [ { "text": "siNT", "tag": "attribute" } ], "source_name": [ { "text": "Primary human endometrial stromal cells", "tag": "attribute" } ], "title": [ { "text": "P1-siNT-Dec-ATAC" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-06-03T16:40:04.423Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28861861" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28861861{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28861861/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28861861/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28861861" } } }, { "name": "GSM6229668", "accession": "SAMN28956647", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-20T00:00:00Z", "update": "2023-05-19T22:03:58.015Z", "submitted": "2022-06-10T08:15:10.890Z", "characteristics": { "External Id": [ { "text": "SAMN28956647", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Health Data Science Unit, Medical Faculty, University Heidelberg" } ], "INSDC first public": [ { "text": "2023-02-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-02-20T07:36:55.583Z" } ], "INSDC secondary accession": [ { "text": "SRS13361856" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13361856" } ], "cell line": [ { "text": "C20", "tag": "attribute" } ], "infection": [ { "text": "HIVGKO reporter virus", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population": [ { "text": "eGFP-mKO2+ (Latently infected)", "tag": "attribute" } ], "source_name": [ { "text": "Microglia", "tag": "attribute" } ], "title": [ { "text": "Microglia eGFP-mKO2+ (Latent) rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28956647", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-06-10T08:15:10.890Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28956647" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28956647{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28956647/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28956647/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28956647" } } }, { "name": "GSM6268807", "accession": "SAMN29379479", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-19T00:00:00Z", "update": "2022-07-22T22:15:15.454Z", "submitted": "2022-06-27T16:52:03.680Z", "characteristics": { "External Id": [ { "text": "SAMN29379479", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genomics, Bioinformatics, The Wistar Institute" } ], "INSDC first public": [ { "text": "2022-07-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-19T14:37:44.324Z" } ], "INSDC secondary accession": [ { "text": "SRS13601803" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13601803" } ], "cell line": [ { "text": "U87T cell line", "tag": "attribute" } ], "genotype": [ { "text": "ATRX_KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "U87T cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC: ATRX KO, Etoposide treated, replicate 1" } ], "treatment": [ { "text": "Etoposide", "tag": "attribute" } ] }, "submittedVia": "JSON_API", "create": "2022-06-27T16:52:03.680Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29379479" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29379479{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29379479/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29379479/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29379479" } } }, { "name": "GSM6284669", "accession": "SAMN29471218", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-31T01:47:27Z", "update": "2022-08-31T23:47:21.374Z", "submitted": "2022-08-31T01:47:27Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-08-31", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-08-31", "tag": "attribute" } ], "External Id": [ { "text": "SAMN29471218", "tag": "Namespace:BioSample" }, { "text": "GSM6284669", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-08-31T01:47:27Z" } ], "INSDC last update": [ { "text": "2022-08-31T01:47:27Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS13647269" } ], "Submitter Id": [ { "text": "GSM6284669" } ], "age": [ { "text": "72 y/o", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Healthy epidermis", "tag": "attribute" } ], "tissue": [ { "text": "Healthy epidermis", "tag": "attribute" } ], "title": [ { "text": "Epidermis_multiome_S1_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29471218", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-31T01:47:27Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29471218" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29471218{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29471218/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29471218/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29471218" } } }, { "name": "GSM6326105", "accession": "SAMN29635247", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-27T00:00:00Z", "update": "2022-08-28T23:30:19.417Z", "submitted": "2022-07-11T16:57:13.257Z", "characteristics": { "External Id": [ { "text": "SAMN29635247", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Michael Snyder, Genetics, Stanford University" } ], "INSDC first public": [ { "text": "2022-08-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-27T01:52:20.223Z" } ], "INSDC secondary accession": [ { "text": "SRS13782656" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13782656" } ], "Stage": [ { "text": "Polyp", "tag": "attribute" } ], "donor": [ { "text": "A015", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "colon", "tag": "attribute" } ], "tissue": [ { "text": "colon", "tag": "attribute" } ], "title": [ { "text": "A015C004 [ATAC-Seq]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29635247", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-07-11T16:57:13.257Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29635247" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29635247{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29635247/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29635247/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29635247" } } }, { "name": "GSM6339602", "accession": "SAMN29758246", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-03T00:00:00Z", "update": "2023-05-20T09:15:25.509Z", "submitted": "2022-07-14T17:33:03.116Z", "characteristics": { "External Id": [ { "text": "SAMN29758246", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "General Surgery, Indiana University School of Medicine" } ], "INSDC first public": [ { "text": "2023-05-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-03T12:44:07.227Z" } ], "INSDC secondary accession": [ { "text": "SRS13888348" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13888348" } ], "cell line": [ { "text": "skeltal muscle stem cells", "tag": "attribute" } ], "cell type": [ { "text": "stem cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Skeletal muscle", "tag": "attribute" } ], "tissue": [ { "text": "Skeletal muscle", "tag": "attribute" } ], "title": [ { "text": "human muscle stem cells -2 ATAC-seq" } ], "treatment": [ { "text": "in culture", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-07-14T17:33:03.116Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29758246" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29758246{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29758246/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29758246/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29758246" } } }, { "name": "HD22", "accession": "SAMN29765851", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-20T00:50:30.930Z", "update": "2023-05-20T09:17:25.873Z", "submitted": "2022-07-15T09:09:04Z", "characteristics": { "External Id": [ { "text": "SAMN29765851", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University Clinic Freiburg" } ], "INSDC first public": [ { "text": "2023-02-20T00:50:30.930Z" } ], "INSDC last update": [ { "text": "2023-02-20T00:50:30.930Z" } ], "INSDC secondary accession": [ { "text": "SRS13893206" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS13893206" } ], "age": [ { "text": "47", "tag": "attribute" } ], "assembly": [ { "text": "GRCh38/hg38", "tag": "attribute" } ], "biomaterial_provider": [ { "text": "AG Grimbacher, Breisacher Strasse 115, 79106 Freiburg", "tag": "attribute" } ], "design_description": [ { "text": "B cells were resuspended in lysis buffer and incubated with a transposase reaction mix. After subsequent DNA purification, samples were sent to CEMM in Vienna for further processing. Files are trimmed and aligned to hg38 using Bowtie2.", "tag": "attribute" } ], "filename": [ { "text": "HD22_stim_naive_Bcell.bam", "tag": "attribute" } ], "filetype": [ { "text": "bam", "tag": "attribute" } ], "instrument_model": [ { "text": "Illumina HiSeq 4000", "tag": "attribute" } ], "isolate": [ { "text": "B cells were resuspended in lysis buffer and incubated with a transposase reaction mix. After subsequent DNA purification, samples were sent to CEMM in Vienna for further processing.", "tag": "attribute" } ], "library_ID": [ { "text": "49", "tag": "attribute" } ], "library_layout": [ { "text": "paired", "tag": "attribute" } ], "library_selection": [ { "text": "other", "tag": "attribute" } ], "library_source": [ { "text": "GENOMIC", "tag": "attribute" } ], "library_strategy": [ { "text": "ATAC-seq", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "platform": [ { "text": "ILLUMINA", "tag": "attribute" } ], "sex": [ { "text": "female", "tag": "attribute" } ], "tissue": [ { "text": "blood", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq of adult healthy control_22", "tag": "attribute" }, { "text": "Human sample from Homo sapiens" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29765851", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-07-15T09:09:04Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29765851" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29765851{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29765851/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29765851/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29765851" } } }, { "name": "GSM6383015", "accession": "SAMN29937875", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-28T00:50:14.653Z", "update": "2022-08-02T01:09:25.355Z", "submitted": "2022-07-25T11:04:40.770Z", "characteristics": { "External Id": [ { "text": "SAMN29937875", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zhanjiang Institute of Clinical Medicine, Central People's Hospital of Zhanjiang" } ], "INSDC first public": [ { "text": "2022-07-28T00:50:14.653Z" } ], "INSDC last update": [ { "text": "2022-07-28T00:50:14.653Z" } ], "INSDC secondary accession": [ { "text": "SRS14285948" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14285948" } ], "cell type": [ { "text": "Peripheral blood mononuclear cells", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Peripheral blood", "tag": "attribute" } ], "tissue": [ { "text": "Peripheral blood", "tag": "attribute" } ], "title": [ { "text": "CPY-2_ATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29937875", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-07-25T11:04:40.770Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29937875" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29937875{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29937875/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29937875/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29937875" } } }, { "name": "GSM6407483", "accession": "SAMN30002429", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-23T00:00:00Z", "update": "2022-09-26T00:39:24.554Z", "submitted": "2022-07-27T16:05:05.363Z", "characteristics": { "External Id": [ { "text": "SAMN30002429", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "St. Jude Children's Research Hospital" } ], "INSDC first public": [ { "text": "2022-09-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-09-23T08:17:06.817Z" } ], "INSDC secondary accession": [ { "text": "SRS14329351" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14329351" } ], "cell type": [ { "text": "Medulloblastoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Medulloblastoma", "tag": "attribute" } ], "title": [ { "text": "Icb1487" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30002429", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-07-27T16:05:05.363Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30002429" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30002429{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30002429/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30002429/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30002429" } } }, { "name": "GSM6431135", "accession": "SAMN30128311", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-40894", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-03T13:32:32Z", "update": "2022-11-04T06:30:54.240Z", "submitted": "2022-11-03T13:32:32Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-11-03", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-11-03", "tag": "attribute" } ], "External Id": [ { "text": "SAMN30128311", "tag": "Namespace:BioSample" }, { "text": "GSM6431135", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-11-03T13:32:32Z" } ], "INSDC last update": [ { "text": "2022-11-03T13:32:32Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS14439042" } ], "Submitter Id": [ { "text": "GSM6431135" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "TeloHAEC", "tag": "attribute" } ], "cell type": [ { "text": "Endothelial", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "parental", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Vascular", "tag": "attribute" } ], "tissue": [ { "text": "Vascular", "tag": "attribute" } ], "title": [ { "text": "TeloHAEC, ctrl, 0.1" } ], "treatment": [ { "text": "normal growth medium", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30128311", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-11-03T13:32:32Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30128311" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30128311{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30128311/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30128311/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30128311" } } }, { "name": "GSM6443424", "accession": "SAMN30244111", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-13T00:50:18.600Z", "update": "2022-08-15T00:18:29.675Z", "submitted": "2022-08-10T17:02:04.210Z", "characteristics": { "External Id": [ { "text": "SAMN30244111", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Illinois at Urbana Champaign" } ], "INSDC first public": [ { "text": "2022-08-13T00:50:18.600Z" } ], "INSDC last update": [ { "text": "2022-08-13T00:50:18.600Z" } ], "INSDC secondary accession": [ { "text": "SRS14610298" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14610298" } ], "cell line": [ { "text": "Primary Human HSCs", "tag": "attribute" } ], "cell type": [ { "text": "Hepatic Stellate Cells", "tag": "attribute" } ], "ecm compositions": [ { "text": "Fibronectin, Laminin", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary Human HSCs", "tag": "attribute" } ], "substrate stiffness": [ { "text": "1kPa", "tag": "attribute" } ], "time": [ { "text": "72 hours", "tag": "attribute" } ], "title": [ { "text": "FNLN01_01_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30244111", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-10T17:02:04.210Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30244111" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30244111{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30244111/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30244111/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30244111" } } }, { "name": "GSM6447645", "accession": "SAMN30262167", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-04T00:00:00Z", "update": "2022-11-08T09:26:05.289Z", "submitted": "2022-08-11T11:46:11.673Z", "characteristics": { "External Id": [ { "text": "SAMN30262167", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for Cancer and Genomic Sciences, University of Birmingham" } ], "INSDC first public": [ { "text": "2022-11-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-11-04T14:36:35.582Z" } ], "INSDC secondary accession": [ { "text": "SRS14614406" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14614406" } ], "cell type": [ { "text": "Leukemic Blast", "tag": "attribute" } ], "disease": [ { "text": "Acute Myeloid Leukemia", "tag": "attribute" } ], "genotype": [ { "text": "CEBPA double mutant", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Leukemic Blast", "tag": "attribute" } ], "title": [ { "text": "ID216-Blast" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30262167", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-11T11:46:11.673Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30262167" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30262167{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30262167/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30262167/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30262167" } } }, { "name": "GSM6448782", "accession": "SAMN30273402", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-04T00:00:00Z", "update": "2022-11-08T09:26:15.966Z", "submitted": "2022-08-11T16:12:03.463Z", "characteristics": { "External Id": [ { "text": "SAMN30273402", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for Cancer and Genomic Sciences, University of Birmingham" } ], "INSDC first public": [ { "text": "2022-11-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-11-04T14:38:10.618Z" } ], "INSDC secondary accession": [ { "text": "SRS14620045" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14620045" } ], "cell type": [ { "text": "CD34+ AML cells", "tag": "attribute" } ], "disease": [ { "text": "Acute Myeloid Leukemia", "tag": "attribute" } ], "genotype": [ { "text": "CEBPA double mutant", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CD34+ AML cells", "tag": "attribute" } ], "title": [ { "text": "2240_ATACseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30273402", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-11T16:12:03.463Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30273402" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30273402{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30273402/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30273402/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30273402" } } }, { "name": "GSM6502904", "accession": "SAMN30445145", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-25T00:00:00Z", "update": "2022-08-25T23:20:45.778Z", "submitted": "2022-08-22T16:11:11.150Z", "characteristics": { "External Id": [ { "text": "SAMN30445145", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Icahn school of medicine at mount sinai" } ], "INSDC first public": [ { "text": "2022-08-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-25T02:06:40.053Z" } ], "INSDC secondary accession": [ { "text": "SRS14744524" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14744524" } ], "Sex": [ { "text": "male", "tag": "attribute" } ], "age of_death": [ { "text": "34", "tag": "attribute" } ], "brain region": [ { "text": "MDT", "tag": "attribute" } ], "group": [ { "text": "neuron", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Mediodorsal Thalamus", "tag": "attribute" } ], "tissue": [ { "text": "Midbrain", "tag": "attribute" } ], "title": [ { "text": "BB5_MDT_N_ATAC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30445145", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-22T16:11:11.150Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30445145" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30445145{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30445145/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30445145/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30445145" } } }, { "name": "GSM6509501", "accession": "SAMN30522784", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-02T00:50:17.420Z", "update": "2022-09-04T23:27:59.856Z", "submitted": "2022-08-26T12:26:03.793Z", "characteristics": { "External Id": [ { "text": "SAMN30522784", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Robert Lafyatis, Department of Medicine, University of Pittsburgh" } ], "INSDC first public": [ { "text": "2022-09-02T00:50:17.420Z" } ], "INSDC last update": [ { "text": "2022-09-02T00:50:17.420Z" } ], "INSDC secondary accession": [ { "text": "SRS14808442" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14808442" } ], "Sex": [ { "text": "female", "tag": "attribute" } ], "age": [ { "text": "64", "tag": "attribute" } ], "disease status": [ { "text": "normal control", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patientcorecode": [ { "text": "2019-098-CORE", "tag": "attribute" } ], "source_name": [ { "text": "Lung", "tag": "attribute" } ], "tissue": [ { "text": "Lung", "tag": "attribute" } ], "title": [ { "text": "SC316 2019-098-CORE" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30522784", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-26T12:26:03.793Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30522784" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30522784{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30522784/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30522784/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30522784" } } }, { "name": "GSM6519836", "accession": "SAMN30566529", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-12T00:00:00Z", "update": "2022-09-13T23:23:16.397Z", "submitted": "2022-08-29T18:49:08.916Z", "characteristics": { "External Id": [ { "text": "SAMN30566529", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gastroenterology, Ospedale San Raffaele" } ], "INSDC first public": [ { "text": "2022-09-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-09-12T14:37:23.749Z" } ], "INSDC secondary accession": [ { "text": "SRS14875547" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14875547" } ], "cell type": [ { "text": "NPCs", "tag": "attribute" } ], "genotype": [ { "text": "SETBP1 I871I", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NPCs", "tag": "attribute" } ], "title": [ { "text": "NPCs I871I ATAC #3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30566529", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-29T18:49:08.916Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30566529" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30566529{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30566529/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30566529/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30566529" } } }, { "name": "GSM6544311", "accession": "SAMN30685543", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-03T00:50:13.960Z", "update": "2022-11-04T01:18:35.278Z", "submitted": "2022-09-06T10:30:14.290Z", "characteristics": { "External Id": [ { "text": "SAMN30685543", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Epigenetics Laboratory, Francis Crick Institute" } ], "INSDC first public": [ { "text": "2022-11-03T00:50:13.960Z" } ], "INSDC last update": [ { "text": "2022-11-03T00:50:13.960Z" } ], "INSDC secondary accession": [ { "text": "SRS14997969" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14997969" } ], "cell line": [ { "text": "PDX MEFX 2090", "tag": "attribute" } ], "genotype": [ { "text": "TNP2 KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PDX MEFX 2090", "tag": "attribute" } ], "stress": [ { "text": "glutamine deprivation", "tag": "attribute" } ], "title": [ { "text": "Stress TNP2 biological replicate 1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30685543", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-06T10:30:14.290Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30685543" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30685543{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30685543/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30685543/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30685543" } } }, { "name": "GSM6577345", "accession": "SAMN30827487", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-07-12T00:00:00Z", "update": "2023-07-15T10:21:54.449Z", "submitted": "2022-09-13T13:12:07.497Z", "characteristics": { "External Id": [ { "text": "SAMN30827487", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Epigenetic Etiology of Human Disease Laboratory, Molecular Pharmacology & Experimental Therapeutics, Mayo Clinic" } ], "INSDC first public": [ { "text": "2023-07-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-07-12T17:41:23.470Z" } ], "INSDC secondary accession": [ { "text": "SRS15094765" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15094765" } ], "cell line": [ { "text": "RPTEC", "tag": "attribute" } ], "cell type": [ { "text": "Human renal epithelial cells", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RPTEC", "tag": "attribute" } ], "title": [ { "text": "RPTEC cells, ATAC, WT, rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30827487", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-13T13:12:07.497Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30827487" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30827487{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30827487/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30827487/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30827487" } } }, { "name": "GSM6592074", "accession": "SAMN30926673", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-40894", "taxId": 9606, "status": "PUBLIC", "release": "2022-12-22T01:20:38Z", "update": "2022-12-23T01:20:42.588Z", "submitted": "2022-12-22T01:20:38Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-12-22", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-12-22", "tag": "attribute" } ], "External Id": [ { "text": "GSM6592074", "tag": "Namespace:BioSample" }, { "text": "SAMN30926673", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-12-22T01:20:38Z" } ], "INSDC last update": [ { "text": "2022-12-22T01:20:38Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS15164589" } ], "Submitter Id": [ { "text": "GSM6592074" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "H1", "tag": "attribute" } ], "cell type": [ { "text": "hESCs", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "blastocyst", "tag": "attribute" } ], "tissue": [ { "text": "blastocyst", "tag": "attribute" } ], "title": [ { "text": "H1-ATAC-seq-2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30926673", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-12-22T01:20:38Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30926673" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30926673{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30926673/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30926673/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30926673" } } }, { "name": "GSM6602070", "accession": "SAMN31028474", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-08T00:00:00Z", "update": "2023-05-20T17:03:22.067Z", "submitted": "2022-09-26T23:05:04.380Z", "characteristics": { "External Id": [ { "text": "SAMN31028474", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics, Cell Biology and Development, University of Minnesota" } ], "INSDC first public": [ { "text": "2023-02-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-02-08T13:52:26.239Z" } ], "INSDC secondary accession": [ { "text": "SRS15247472" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15247472" } ], "cell line": [ { "text": "LHCN-M2 (PMID: 17559502)", "tag": "attribute" } ], "cell type": [ { "text": "immortalized human myoblast", "tag": "attribute" } ], "lentiviral _transduction": [ { "text": "FUGW-rtTA and pSAM2-DUXB", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "cell line", "tag": "attribute" } ], "tissue": [ { "text": "cell line", "tag": "attribute" } ], "title": [ { "text": "ATAC-seq of LHCN-M2 cells with inducible DUXB treated with doxycycline for 12 hrs replicate 2" } ], "treatment": [ { "text": "200 ng/mL doxycycline for 12 hrs", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31028474", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-26T23:05:04.380Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31028474" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31028474{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31028474/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31028474/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31028474" } } }, { "name": "GSM6605054", "accession": "SAMN31065847", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-30T00:50:25.277Z", "update": "2023-05-20T17:09:29.821Z", "submitted": "2022-09-28T14:04:05.117Z", "characteristics": { "External Id": [ { "text": "SAMN31065847", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "City Of Hope" } ], "INSDC first public": [ { "text": "2023-03-30T00:50:25.277Z" } ], "INSDC last update": [ { "text": "2023-03-30T00:50:25.277Z" } ], "INSDC secondary accession": [ { "text": "SRS15266705" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15266705" } ], "cell type": [ { "text": "Resistant (R) cells", "tag": "attribute" } ], "disease state": [ { "text": "CML", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CML patient blood leukapheresis", "tag": "attribute" } ], "tissue": [ { "text": "CML patient blood leukapheresis", "tag": "attribute" } ], "title": [ { "text": "49276_DR-1" } ], "treatment": [ { "text": "Treated with imatinib for 8 days", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-28T14:04:05.117Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31065847" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31065847{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31065847/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31065847/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31065847" } } }, { "name": "GSM6614123", "accession": "SAMN31137568", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-03T00:50:34.880Z", "update": "2023-05-20T17:46:36.253Z", "submitted": "2022-10-03T11:45:08.490Z", "characteristics": { "External Id": [ { "text": "SAMN31137568", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Joseph Bass, Medicine, NORTHWESTERN UNIVERSITY" } ], "INSDC first public": [ { "text": "2023-04-03T00:50:34.880Z" } ], "INSDC last update": [ { "text": "2023-04-03T00:50:34.880Z" } ], "INSDC secondary accession": [ { "text": "SRS15307306" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15307306" } ], "genotype": [ { "text": "Donor 7", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "pancreatic islet", "tag": "attribute" } ], "tissue": [ { "text": "pancreatic islet", "tag": "attribute" } ], "title": [ { "text": "CT24-4 [bulk ATAC-seq]" } ], "treatment": [ { "text": "24 hours post-synchronization", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-03T11:45:08.490Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31137568" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31137568{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31137568/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31137568/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31137568" } } }, { "name": "hBMSC", "accession": "SAMN31169508", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-08T00:00:00Z", "update": "2023-05-20T18:00:52.381Z", "submitted": "2022-10-05T17:24:03.476Z", "characteristics": { "External Id": [ { "text": "SAMN31169508", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Texas Southwestern Medical Center" } ], "INSDC first public": [ { "text": "2023-05-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-08T18:15:01.818Z" } ], "INSDC secondary accession": [ { "text": "SRS15333454" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS15333454" } ], "cell_type": [ { "text": "bone marrow stromal cells", "tag": "attribute" } ], "description": [ { "text": "Human primary bone marrow stromal cells (bone marrow derived mesenchymal stem cells) were obtained from Lonza (PT-2501)" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "tissue": [ { "text": "bone marrow", "tag": "attribute" } ], "title": [ { "text": "Human primray bone marrow stromal cells" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31169508", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-05T17:24:03.476Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31169508" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31169508{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31169508/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31169508/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31169508" } } }, { "name": "GSM6631068", "accession": "SAMN31247208", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-18T00:50:12.520Z", "update": "2023-05-20T19:58:10.778Z", "submitted": "2022-10-11T23:15:10.890Z", "characteristics": { "External Id": [ { "text": "SAMN31247208", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Azim Surani, Gurdon Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2023-01-18T00:50:12.520Z" } ], "INSDC last update": [ { "text": "2023-01-18T00:50:12.520Z" } ], "INSDC secondary accession": [ { "text": "SRS15374793" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15374793" } ], "Sex": [ { "text": "male", "tag": "attribute" } ], "cell type": [ { "text": "Primordial germ cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Gonad", "tag": "attribute" } ], "tissue": [ { "text": "Gonad", "tag": "attribute" } ], "title": [ { "text": "ATAC_hPGC_wk7_M_r1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31247208", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-11T23:15:10.890Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247208" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247208{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247208/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247208/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31247208" } } }, { "name": "GSM6645065", "accession": "SAMN31313810", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-20T00:50:21.400Z", "update": "2022-10-25T06:32:36.750Z", "submitted": "2022-10-17T10:28:04.567Z", "characteristics": { "External Id": [ { "text": "SAMN31313810", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "IMBA" } ], "INSDC first public": [ { "text": "2022-10-20T00:50:21.400Z" } ], "INSDC last update": [ { "text": "2022-10-20T00:50:21.400Z" } ], "INSDC secondary accession": [ { "text": "SRS15430693" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15430693" } ], "cell line": [ { "text": "H9", "tag": "attribute" } ], "cell type": [ { "text": "SOX2::EGFP+", "tag": "attribute" } ], "developmental stage": [ { "text": "D60", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "brain organoids", "tag": "attribute" } ], "tissue": [ { "text": "brain organoids", "tag": "attribute" } ], "title": [ { "text": "sox2_D60_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31313810", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-17T10:28:04.567Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31313810" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31313810{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31313810/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31313810/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31313810" } } }, { "name": "GSM6697165", "accession": "SAMN31526619", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-01T00:00:00Z", "update": "2023-05-20T23:24:27.811Z", "submitted": "2022-10-30T22:34:03.923Z", "characteristics": { "External Id": [ { "text": "SAMN31526619", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Circular RNAs in Cancer Laboratory, College of Medicine and Public Health, Flinders University" } ], "INSDC first public": [ { "text": "2023-05-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-01T11:10:33.608Z" } ], "INSDC secondary accession": [ { "text": "SRS15586145" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15586145" } ], "cell line": [ { "text": "HL-60", "tag": "attribute" } ], "cell type": [ { "text": "cell line", "tag": "attribute" } ], "kit": [ { "text": "Active Motif ATAC-Seq kit", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HL-60", "tag": "attribute" } ], "title": [ { "text": "HL-60, pMIG (EV)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31526619", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-30T22:34:03.923Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31526619" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31526619{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31526619/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31526619/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31526619" } } }, { "name": "GSM6774885", "accession": "SAMN31972300", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-08T00:00:00Z", "update": "2023-05-21T03:29:43.126Z", "submitted": "2022-12-01T11:33:03.033Z", "characteristics": { "External Id": [ { "text": "SAMN31972300", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "QIMR Berghofer" } ], "INSDC first public": [ { "text": "2023-03-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-08T21:50:28.208Z" } ], "INSDC secondary accession": [ { "text": "SRS15930168" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15930168" } ], "cell line": [ { "text": "K5plusK19plus", "tag": "attribute" } ], "cell type": [ { "text": "Mammary epithelial", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Breast", "tag": "attribute" } ], "tissue": [ { "text": "Breast", "tag": "attribute" } ], "title": [ { "text": "K5plusK19plus-replicate 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31972300", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-12-01T11:33:03.033Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31972300" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31972300{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31972300/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31972300/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31972300" } } }, { "name": "GSM6965460", "accession": "SAMN32889638", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-29T00:50:10.527Z", "update": "2023-05-22T00:24:18.792Z", "submitted": "2023-01-24T12:18:04.790Z", "characteristics": { "External Id": [ { "text": "SAMN32889638", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dick Lab, University Health Network" } ], "INSDC first public": [ { "text": "2023-01-29T00:50:10.527Z" } ], "INSDC last update": [ { "text": "2023-01-29T00:50:10.527Z" } ], "INSDC secondary accession": [ { "text": "SRS16563594" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16563594" } ], "cell line": [ { "text": "U937", "tag": "attribute" } ], "cell type": [ { "text": "Adult acute monocytic leukemia", "tag": "attribute" } ], "genotype": [ { "text": "KDM6A and KDM6B knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Blood", "tag": "attribute" } ], "tissue": [ { "text": "Blood", "tag": "attribute" } ], "title": [ { "text": "U937 cells, shKDM6A+6B, ATAC-seq Replicate 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN32889638", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-01-24T12:18:04.790Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32889638" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32889638{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32889638/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32889638/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN32889638" } } }, { "name": "GSM7017469", "accession": "SAMN32991376", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-06T00:50:23.103Z", "update": "2023-05-22T05:16:26.465Z", "submitted": "2023-02-01T07:58:04.227Z", "characteristics": { "External Id": [ { "text": "SAMN32991376", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Reproductive Medicine Center, The Seventh Affiliated Hospital, Sun Yat-sen University" } ], "INSDC first public": [ { "text": "2023-02-06T00:50:23.103Z" } ], "INSDC last update": [ { "text": "2023-02-06T00:50:23.103Z" } ], "INSDC secondary accession": [ { "text": "SRS16647744" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16647744" } ], "cell type": [ { "text": "stromal cells", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Endometrium", "tag": "attribute" } ], "tissue": [ { "text": "Endometrium", "tag": "attribute" } ], "title": [ { "text": "ESC, lentivirus-CIP2A, 1 μM P4 + 0.25 mM db-cAMP" } ], "treatment": [ { "text": "Lentivirus-CIP2A, 1 micorM P4 + 0.25 mM db-cAMP", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN32991376", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-02-01T07:58:04.227Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32991376" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32991376{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32991376/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32991376/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN32991376" } } }, { "name": "GSM7018202", "accession": "SAMN33006350", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-01T00:00:00Z", "update": "2023-05-22T05:20:04.841Z", "submitted": "2023-02-01T11:04:04.130Z", "characteristics": { "External Id": [ { "text": "SAMN33006350", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UGent" } ], "INSDC first public": [ { "text": "2023-02-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-02-02T11:43:10.170Z" } ], "INSDC secondary accession": [ { "text": "SRS16648816" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16648816" } ], "cell line": [ { "text": "SH-EP", "tag": "attribute" } ], "cell type": [ { "text": "neuroblast", "tag": "attribute" } ], "genotype": [ { "text": "wild type", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "bone marrow", "tag": "attribute" } ], "tissue": [ { "text": "bone marrow", "tag": "attribute" } ], "title": [ { "text": "SHEP" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-02-01T11:04:04.130Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33006350" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33006350{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33006350/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33006350/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33006350" } } }, { "name": "GSM7031593", "accession": "SAMN33229061", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-14T00:00:00Z", "update": "2023-05-22T17:03:37.078Z", "submitted": "2023-02-09T16:19:05.590Z", "characteristics": { "External Id": [ { "text": "SAMN33229061", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Bioengineering, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2023-02-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-02-14T20:59:59.560Z" } ], "INSDC secondary accession": [ { "text": "SRS16721750" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16721750" } ], "cell line": [ { "text": "FS4", "tag": "attribute" } ], "cell type": [ { "text": "Melanoma cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "FS4", "tag": "attribute" } ], "title": [ { "text": "2_ATAC_AK356_8hr_invading, biol rep 1" } ], "treatment": [ { "text": "invading, 8 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN33229061", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-02-09T16:19:05.590Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33229061" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33229061{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33229061/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33229061/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33229061" } } }, { "name": "GSM7070564", "accession": "SAMN33483290", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-01T00:51:01.877Z", "update": "2023-05-23T06:07:46.674Z", "submitted": "2023-02-28T13:07:03.430Z", "characteristics": { "External Id": [ { "text": "SAMN33483290", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zhanjiang Institute of Clinical Medicine, Central People's Hospital of Zhanjiang" } ], "INSDC first public": [ { "text": "2023-04-01T00:51:01.877Z" } ], "INSDC last update": [ { "text": "2023-04-01T00:51:01.877Z" } ], "INSDC secondary accession": [ { "text": "SRS16910388" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16910388" } ], "cell type": [ { "text": "Human umbilical cord mesenchymal stem cells", "tag": "attribute" } ], "genotype": [ { "text": "Ctrl knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human umbilical cord", "tag": "attribute" } ], "tissue": [ { "text": "Human umbilical cord", "tag": "attribute" } ], "title": [ { "text": "ATACseq_siCtrl" } ], "treatment": [ { "text": "siRNA", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN33483290", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-02-28T13:07:03.430Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483290" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483290{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483290/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483290/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33483290" } } }, { "name": "GSM7070991", "accession": "SAMN33483302", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-13T00:50:16.653Z", "update": "2023-05-23T06:07:47.683Z", "submitted": "2023-02-28T13:10:03.447Z", "characteristics": { "External Id": [ { "text": "SAMN33483302", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genome Organization and Regulation, Max Planck Insitute for Multidisciplinary Sciences" } ], "INSDC first public": [ { "text": "2023-04-13T00:50:16.653Z" } ], "INSDC last update": [ { "text": "2023-04-13T00:50:16.653Z" } ], "INSDC secondary accession": [ { "text": "SRS16910380" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16910380" } ], "cell line": [ { "text": "HCT-116", "tag": "attribute" } ], "cell type": [ { "text": "human colon cancer cells", "tag": "attribute" } ], "genotype": [ { "text": "MED14-dTAG", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Epithelial Tumor Colon", "tag": "attribute" } ], "tissue": [ { "text": "Epithelial Tumor Colon", "tag": "attribute" } ], "title": [ { "text": "ATAC dTAG_3" } ], "treatment": [ { "text": "dTAG", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-02-28T13:10:03.447Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483302" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483302{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483302/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33483302/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33483302" } } }, { "name": "GSM7103572", "accession": "SAMN33798205", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-06-01T00:00:00Z", "update": "2023-06-06T03:41:24.557Z", "submitted": "2023-03-17T17:13:03.337Z", "characteristics": { "External Id": [ { "text": "SAMN33798205", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Knaus, Institute for Chemistry and Biochemistry, Freie Universität Berlin" } ], "INSDC first public": [ { "text": "2023-06-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-06-02T02:55:44.100Z" } ], "INSDC secondary accession": [ { "text": "SRS17071778" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17071778" } ], "cell line": [ { "text": "HUAEC", "tag": "attribute" } ], "cell type": [ { "text": "Endothelial", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Umbilical artery", "tag": "attribute" } ], "tissue": [ { "text": "Umbilical artery", "tag": "attribute" } ], "title": [ { "text": "stat-bmp9_rep2" } ], "treatment": [ { "text": "BMP9", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-03-17T17:13:03.337Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33798205" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33798205{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33798205/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33798205/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33798205" } } }, { "name": "GSM7108078", "accession": "SAMN33832125", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-12T00:00:00Z", "update": "2023-05-24T10:27:29.932Z", "submitted": "2023-03-20T20:13:03.650Z", "characteristics": { "External Id": [ { "text": "SAMN33832125", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cedars Sinai Medical Center" } ], "INSDC first public": [ { "text": "2023-05-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-12T21:33:22.293Z" } ], "INSDC secondary accession": [ { "text": "SRS17099664" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17099664" } ], "cell line": [ { "text": "FT282", "tag": "attribute" } ], "cell type": [ { "text": "Fallopian Tube Secretory Epithelium", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell Line", "tag": "attribute" } ], "tissue": [ { "text": "Cell Line", "tag": "attribute" } ], "title": [ { "text": "AT-FT282-2" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-03-20T20:13:03.650Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33832125" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33832125{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33832125/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33832125/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33832125" } } }, { "name": "TITR_c-Jun", "accession": "SAMN33874701", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-23T00:00:00Z", "update": "2023-05-24T12:00:33.751Z", "submitted": "2023-03-23T21:23:04.917Z", "characteristics": { "External Id": [ { "text": "SAMN33874701", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Southern medical university" } ], "INSDC first public": [ { "text": "2023-03-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-23T21:35:24.420Z" } ], "INSDC secondary accession": [ { "text": "SRS17125128" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS17125128" } ], "age": [ { "text": "54", "tag": "attribute" } ], "biomaterial_provider": [ { "text": "Department of General Surgery, Division of Hepatobiliopancreatic Surgery, Nanfang Hospital, Southern Medical University", "tag": "attribute" } ], "isolate": [ { "text": "liver11", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "tag": "attribute" } ], "tissue": [ { "text": "liver", "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-03-23T21:23:04.917Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33874701" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33874701{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33874701/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33874701/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33874701" } } }, { "name": "GSM7118812", "accession": "SAMN33941752", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-19T00:00:00Z", "update": "2023-05-24T14:35:01.377Z", "submitted": "2023-03-27T20:08:03.720Z", "characteristics": { "External Id": [ { "text": "SAMN33941752", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MD Anderson Cancer Center" } ], "INSDC first public": [ { "text": "2023-04-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-19T10:29:13.055Z" } ], "INSDC secondary accession": [ { "text": "SRS17151502" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17151502" } ], "cell line": [ { "text": "MV4-11", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MV4-11", "tag": "attribute" } ], "title": [ { "text": "MV4-11 500 nM VTP2" } ], "treatment": [ { "text": "500 nM VTP50469", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-03-27T20:08:03.720Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33941752" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33941752{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33941752/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33941752/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33941752" } } }, { "name": "GSM7119498", "accession": "SAMN33948782", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-31T00:52:12.013Z", "update": "2023-05-24T14:52:01.213Z", "submitted": "2023-03-28T14:06:44.760Z", "characteristics": { "External Id": [ { "text": "SAMN33948782", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The First Affiliated Hospital of Chongqing Medical University" } ], "INSDC first public": [ { "text": "2023-03-31T00:52:12.013Z" } ], "INSDC last update": [ { "text": "2023-03-31T00:52:12.013Z" } ], "INSDC secondary accession": [ { "text": "SRS17157382" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17157382" } ], "age": [ { "text": "9 post-conceptional weeks", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "fetal eye", "tag": "attribute" } ], "tissue": [ { "text": "fetal eye", "tag": "attribute" } ], "title": [ { "text": "PCW9 [scATACseq]" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-03-28T14:06:44.760Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33948782" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33948782{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33948782/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN33948782/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN33948782" } } }, { "name": "GSM7213594", "accession": "SAMN34298236", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-30T00:00:00Z", "update": "2023-06-01T19:17:57.157Z", "submitted": "2023-04-21T19:08:04.950Z", "characteristics": { "External Id": [ { "text": "SAMN34298236", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Joanna Wysocka, Chemical and Systems Biology, Stanford University" } ], "INSDC first public": [ { "text": "2023-05-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-30T09:57:40.670Z" } ], "INSDC secondary accession": [ { "text": "SRS17391718" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17391718" } ], "cell line": [ { "text": "H9", "tag": "attribute" } ], "cell type": [ { "text": "Human cranial neural crest cells", "tag": "attribute" } ], "clone": [ { "text": "c14", "tag": "attribute" } ], "genotype": [ { "text": "ALX1FV ALX4-", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H9", "tag": "attribute" } ], "time": [ { "text": "long-term", "tag": "attribute" } ], "title": [ { "text": "ALX1FV ALX4-, long-term dTAG, rep2" } ], "treatment": [ { "text": "dTAGV-1 (500 nM)", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-04-21T19:08:04.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34298236" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34298236{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34298236/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34298236/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN34298236" } } }, { "name": "GSM7256894", "accession": "SAMN34441476", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-02T00:00:00Z", "update": "2023-05-25T09:14:11.400Z", "submitted": "2023-04-29T16:50:09.210Z", "characteristics": { "External Id": [ { "text": "SAMN34441476", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Washington University School of Medicine" } ], "INSDC first public": [ { "text": "2023-05-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-03T10:41:14.917Z" } ], "INSDC secondary accession": [ { "text": "SRS17472793" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17472793" } ], "cell line": [ { "text": "Primary", "tag": "attribute" } ], "cell type": [ { "text": "CD19-directed human CAR T cells containing CD28", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Engineered T cells", "tag": "attribute" } ], "time": [ { "text": "Day 17", "tag": "attribute" } ], "title": [ { "text": "CD28 CAR, day 17, biol rep 2, ATACseq" } ], "treatment": [ { "text": "Co-culture with Nalm6 cells", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN34441476", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-04-29T16:50:09.210Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34441476" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34441476{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34441476/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34441476/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN34441476" } } }, { "name": "GSM7594334", "accession": "SAMN36407488", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-07-12T00:50:15.627Z", "update": "2023-07-17T18:05:55.364Z", "submitted": "2023-07-11T14:55:05.593Z", "characteristics": { "External Id": [ { "text": "SAMN36407488", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SOLID TUMOR THORACIC, MSKCC" } ], "INSDC first public": [ { "text": "2023-07-12T00:50:15.627Z" } ], "INSDC last update": [ { "text": "2023-07-12T11:46:30.893Z" } ], "INSDC secondary accession": [ { "text": "SRS18258213" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS18258213" } ], "cell line": [ { "text": "22PC", "tag": "attribute" } ], "cell type": [ { "text": "Prostate adenocarcinoma", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "genotype": [ { "text": "RB1 KO", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Prostate", "tag": "attribute" } ], "tissue": [ { "text": "Prostate", "tag": "attribute" } ], "title": [ { "text": "22PC-RB1-r2" } ], "treatment": [ { "text": "Untreated", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN36407488", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-07-11T14:55:05.593Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN36407488" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN36407488{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN36407488/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN36407488/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN36407488" } } }, { "name": "SAMD00011704", "accession": "SAMD00011704", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2014-10-10T09:30:45Z", "update": "2022-03-29T07:24:20.566Z", "submitted": "2014-10-29T11:14:58.806Z", "characteristics": { "External Id": [ { "text": "SAMD00011704", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Functional Genomics, Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo" } ], "INSDC first public": [ { "text": "2014-10-10T09:30:45Z" } ], "INSDC last update": [ { "text": "2014-11-12T03:29:26Z" } ], "INSDC secondary accession": [ { "text": "DRS014803" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS014803" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample comment": [ { "text": "H2126 lung adenocarcinoma cell lines; ChIPseq; anti-H3K27ac (ab4729 GR104852-1, abcam);", "tag": "attribute" } ], "sample name": [ { "text": "DRS014803", "tag": "attribute" } ], "title": [ { "text": "H2126 lung adenocarcinoma cell lines; ChIPseq; anti-H3K27ac (ab4729 GR104852-1, abcam);" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00011704", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-10-29T11:14:58.806Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00011704" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00011704{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00011704/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00011704/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00011704" } } }, { "name": "SAMD00013207", "accession": "SAMD00013207", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2014-07-23T00:00:00Z", "update": "2022-03-29T05:49:27.778Z", "submitted": "2014-07-31T17:20:54.300Z", "characteristics": { "External Id": [ { "text": "SAMD00013207", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Functional Genomics, Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo" } ], "INSDC first public": [ { "text": "2014-07-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2014-11-12T03:29:32Z" } ], "INSDC secondary accession": [ { "text": "DRS012991" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS012991" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample comment": [ { "text": "ChIP seq library. HEK293 cell line, H3K27me3 IP", "tag": "attribute" } ], "sample name": [ { "text": "DRS012991", "tag": "attribute" } ], "title": [ { "text": "HEK293 H3K27me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00013207", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-07-31T17:20:54.300Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00013207" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00013207{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00013207/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00013207/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00013207" } } }, { "name": "SAMD00043224", "accession": "SAMD00043224", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-02-23T09:56:35Z", "update": "2022-03-29T16:21:27.423Z", "submitted": "2016-02-22T09:05:25.330Z", "characteristics": { "External Id": [ { "text": "SAMD00043224", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Sato Lab, Center for AIDS Research, International Research Center for Medical Sciences (IRCMS), Kumamoto University" } ], "INSDC first public": [ { "text": "2016-02-23T09:56:35Z" } ], "INSDC last update": [ { "text": "2016-02-22T19:56:35Z" } ], "INSDC secondary accession": [ { "text": "DRS023623" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS023623" } ], "cell line": [ { "text": "ED cells", "tag": "attribute" } ], "cell type": [ { "text": "T cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000084" ], "tag": "attribute" } ], "collection date": [ { "text": "2015-03-10", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "biological replicate 1", "tag": "attribute" } ], "sample name": [ { "text": "009_ED_ChIP_H3K9ac_1", "tag": "attribute" } ], "title": [ { "text": "H3K9ac1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00043224", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-02-22T09:05:25.330Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00043224" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00043224{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00043224/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00043224/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00043224" } } }, { "name": "SAMD00055696", "accession": "SAMD00055696", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-06-06T00:00:00Z", "update": "2023-11-03T22:19:54.525Z", "submitted": "2018-06-06T14:05:18.957Z", "characteristics": { "External Id": [ { "text": "SAMD00055696", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Radiation Research Center for Frontier Science Facilities for Gene Technology, Research Institute for Radiation Biology and Medicine, Hiroshima University" } ], "INSDC first public": [ { "text": "2018-06-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-10-29T03:17:15.317Z" } ], "INSDC secondary accession": [ { "text": "DRS063764" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS063764" } ], "cell line": [ { "text": "HB1119", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample name": [ { "text": "0017_HB1119-fanChIP-H3K4me2", "tag": "attribute" } ], "title": [ { "text": "HB1119-fanChIP-H3K4me2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMD00055696", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00055696", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2018-06-06T14:05:18.957Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00055696" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00055696{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00055696/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00055696/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00055696" } } }, { "name": "SAMD00144947", "accession": "SAMD00144947", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-19T00:00:00Z", "update": "2022-03-31T01:03:46.637Z", "submitted": "2018-10-20T01:00:49.196Z", "characteristics": { "External Id": [ { "text": "SAMD00144947", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Sashida Lab, International Research Center for Medical Sciences, Kumamoto University" } ], "INSDC first public": [ { "text": "2018-10-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-10-18T20:48:03Z" } ], "INSDC secondary accession": [ { "text": "DRS077422" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "DRS077422" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample name": [ { "text": "CAL1-RUNX2-IP", "tag": "attribute" } ], "tissue type": [ { "text": "Cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "title": [ { "text": "RUNX2-IP-CAL1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMD00144947", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-20T01:00:49.196Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00144947" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00144947{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00144947/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMD00144947/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMD00144947" } } }, { "name": "GM12234-sc-2011-06-09T13:38:33Z-1162246", "accession": "SAMEA1706519", "sraAccession": "ERS037324", "webinSubmissionAccountId": "Webin-2", "taxId": 9606, "status": "PUBLIC", "release": "2013-01-30T11:24:07Z", "update": "2024-02-04T23:53:15.060Z", "submitted": "2011-06-09T13:38:33Z", "characteristics": { "ArrayExpress-CellType": [ { "text": "B-Lymphocyte", "tag": "attribute" } ], "ArrayExpress-Immunoprecipitate": [ { "text": "CTCF", "tag": "attribute" } ], "ArrayExpress-Sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "ArrayExpress-Species": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2013-01-30T11:24:07Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-03-08T15:27:24Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA1706519", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SC" } ], "INSDC first public": [ { "text": "2013-01-30T11:24:07Z" } ], "INSDC last update": [ { "text": "2018-03-08T15:27:24Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS037324" } ], "Submitter Id": [ { "text": "GM12234-sc-2011-06-09T13:38:33Z-1162246", "tag": "Namespace:SC" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA1706519", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T03:23:26.395Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1706519" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1706519{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1706519/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1706519/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA1706519" } } }, { "name": "Activin_H3K4me3_replicate3-sc-2013-07-25T11:46:23Z-1672014", "accession": "SAMEA1929670", "sraAccession": "ERS329829", "webinSubmissionAccountId": "Webin-2", "taxId": 9606, "status": "PUBLIC", "release": "2013-11-18T09:24:39Z", "update": "2024-02-05T02:53:35.371Z", "submitted": "2013-07-25T11:46:23Z", "characteristics": { "ArrayExpress-CellType": [ { "text": "H9 hESC line", "tag": "attribute" } ], "ArrayExpress-Compound": [ { "text": "Activin", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_81351" ], "tag": "attribute" } ], "ArrayExpress-Dose": [ { "text": "10 ng/ml", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_16412" ], "tag": "attribute" } ], "ArrayExpress-Genotype": [ { "text": "Wildtype", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005543" ], "tag": "attribute" } ], "ArrayExpress-GrowthCondition": [ { "text": "Activin", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_81351" ], "tag": "attribute" } ], "ArrayExpress-Immunoprecipitate": [ { "text": "Anti H3K4me3", "tag": "attribute" } ], "ArrayExpress-Sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "ArrayExpress-Species": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "ArrayExpress-TimePoint": [ { "text": "4h", "tag": "attribute" } ], "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2013-11-18T09:24:39Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-03-08T16:37:19Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA1929670", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SC" } ], "INSDC first public": [ { "text": "2013-11-18T09:24:39Z" } ], "INSDC last update": [ { "text": "2018-03-08T16:37:19Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS329829" } ], "Submitter Id": [ { "text": "Activin_H3K4me3_replicate3-sc-2013-07-25T11:46:23Z-1672014", "tag": "Namespace:SC" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sample description": [ { "text": "ChIP for H3K4me3 from H9 cells treated with 10ng/ml Activin", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA1929670", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T03:27:02.291Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1929670" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1929670{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1929670/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA1929670/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA1929670" } } }, { "name": "NS10-sc-1768717", "accession": "SAMEA2396196", "sraAccession": "ERS420353", "webinSubmissionAccountId": "Webin-2", "taxId": 9606, "status": "PUBLIC", "release": "2014-11-11T09:58:46Z", "update": "2024-02-05T04:20:31.604Z", "submitted": "2014-03-07T16:42:24Z", "characteristics": { "ArrayExpress-CellType": [ { "text": "HL60", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002793" ], "tag": "attribute" } ], "ArrayExpress-Immunoprecipitate": [ { "text": "CTCF", "tag": "attribute" } ], "ArrayExpress-OrganismPart": [ { "text": "Blood", "tag": "attribute" } ], "ArrayExpress-Phenotype": [ { "text": "Cancer", "tag": "attribute" } ], "ArrayExpress-Sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "ArrayExpress-Species": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2014-11-11T09:58:46Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2018-03-08T17:14:49Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA2396196", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SC" } ], "INSDC first public": [ { "text": "2014-11-11T09:58:46Z" } ], "INSDC last update": [ { "text": "2018-03-08T17:14:49Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS420353" } ], "Submitter Id": [ { "text": "NS10-sc-1768717", "tag": "Namespace:SC" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sample description": [ { "text": "CTCF", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA2396196", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-03-30T03:45:47.506Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA2396196" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA2396196{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA2396196/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA2396196/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA2396196" } } }, { "name": "48d476c0-d3f5-11e5-88b1-3c4a9275d6c6", "accession": "SAMEA4075774", "sraAccession": "ERS1246884", "webinSubmissionAccountId": "Webin-2", "taxId": 9606, "status": "PUBLIC", "release": "2017-10-31T10:19:10Z", "update": "2024-02-02T08:24:14.028Z", "submitted": "2016-07-12T16:58:34Z", "characteristics": { "ArrayExpress-CellType": [ { "text": "Mammary Epithelial", "tag": "attribute" } ], "ArrayExpress-DevelopmentalStage": [ { "text": "Tumour", "tag": "attribute" } ], "ArrayExpress-Immunoprecipitate": [ { "text": "BCL11A(mix)", "tag": "attribute" } ], "ArrayExpress-Phenotype": [ { "text": "TNBC cancer", "tag": "attribute" } ], "ArrayExpress-Sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "ArrayExpress-Species": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ], "tag": "attribute" } ], "ENA-CHECKLIST": [ { "text": "ERC000011", "tag": "attribute" } ], "ENA-FIRST-PUBLIC": [ { "text": "2017-10-31T10:19:10Z", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2016-07-12T16:58:34Z", "tag": "attribute" } ], "External Id": [ { "text": "SAMEA4075774", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "SC" } ], "INSDC first public": [ { "text": "2017-10-31T10:19:10Z" } ], "INSDC last update": [ { "text": "2016-07-12T16:58:34Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "ERS1246884" } ], "Submitter Id": [ { "text": "48d476c0-d3f5-11e5-88b1-3c4a9275d6c6", "tag": "Namespace:SC" } ], "common name": [ { "text": "human", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "sample description": [ { "text": "BCL11A chipseq", "tag": "attribute" } ], "scientific_name": [ { "text": "Homo sapiens", "ontologyTerms": [ "" ] } ], "title": [ { "text": "MC11A", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006453" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMEA4075774", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2018-12-07T06:31:20.475Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4075774" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4075774{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4075774/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMEA4075774/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMEA4075774" } } }, { "name": "GSM468209", "accession": "SAMN00006882", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2009-12-17T13:20:08.003Z", "update": "2022-03-28T12:04:27.239Z", "submitted": "2009-12-17T13:20:05.307Z", "characteristics": { "External Id": [ { "text": "SAMN00006882", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Molecular Biology (274), Radboud University" } ], "INSDC first public": [ { "text": "2009-12-17T13:20:08.003Z" } ], "INSDC last update": [ { "text": "2014-10-04T01:12:14.497Z" } ], "INSDC secondary accession": [ { "text": "SRS009092" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS009092" } ], "antibody": [ { "text": "PML", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "UPR9 cells", "tag": "attribute" } ], "title": [ { "text": "PML_ChIPseq_UPR9_noZinc_JM30" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00006882", "duo": [] } ], "submittedVia": "JSON_API", "create": "2009-12-17T13:20:05.307Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00006882" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00006882{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00006882/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00006882/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00006882" } } }, { "name": "GSM486471", "accession": "SAMN00010337", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2010-03-22T16:52:48.527Z", "update": "2022-03-28T12:05:34.780Z", "submitted": "2010-03-22T16:50:37.450Z", "characteristics": { "External Id": [ { "text": "SAMN00010337", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gerstein, MB&B, Yale University" } ], "INSDC first public": [ { "text": "2010-03-22T16:52:48.527Z" } ], "INSDC last update": [ { "text": "2014-02-24T17:50:56.667Z" } ], "INSDC secondary accession": [ { "text": "SRS025385" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS025385" } ], "biomaterial provider": [ { "text": "Coriell Cell Repositories http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM12892", "tag": "attribute" } ], "cell line": [ { "text": "GM12892", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002786" ], "tag": "attribute" } ], "cell type": [ { "text": "Lymphoblastoid cell", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000572" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Pol II (8WG16)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Lymphoblastoid Cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000572" ], "tag": "attribute" } ], "title": [ { "text": "GM12892_Pol_II_ChIPSeq_Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00010337", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-03-22T16:50:37.450Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010337" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010337{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010337/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010337/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00010337" } } }, { "name": "GSM487695", "accession": "SAMN00010679", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2010-07-01T10:26:25.030Z", "update": "2022-03-28T12:05:41.343Z", "submitted": "2010-03-30T15:03:08.073Z", "characteristics": { "External Id": [ { "text": "SAMN00010679", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "USC Epigenome Center, University of Southern California" } ], "INSDC first public": [ { "text": "2010-07-01T10:26:25.030Z" } ], "INSDC last update": [ { "text": "2014-02-24T17:51:00.812Z" } ], "INSDC secondary accession": [ { "text": "SRS041879" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS041879" } ], "antibody": [ { "text": "anti-H2A.Z", "tag": "attribute" } ], "cell line": [ { "text": "T24 bladder cancer cells", "tag": "attribute" } ], "fraction": [ { "text": "IP", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Mitotic T24 Cells", "tag": "attribute" } ], "title": [ { "text": "H2A.Z_Mitotic_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00010679", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-03-30T15:03:08.073Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010679" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010679{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010679/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010679/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00010679" } } }, { "name": "GSM529410", "accession": "SAMN00010935", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2010-06-04T17:14:04.947Z", "update": "2022-03-28T12:05:45.495Z", "submitted": "2010-04-05T14:34:06.980Z", "characteristics": { "External Id": [ { "text": "SAMN00010935", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Richard Young, Biology, Whitehead Instute - MIT" } ], "INSDC first public": [ { "text": "2010-06-04T17:14:04.947Z" } ], "INSDC last update": [ { "text": "2014-02-24T17:51:07.626Z" } ], "INSDC secondary accession": [ { "text": "SRS058878" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS058878" } ], "cell line": [ { "text": "hES cell line WIBR3", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "oxygen concentration": [ { "text": "5% O2", "tag": "attribute" } ], "source_name": [ { "text": "hES line WIBR3 5% O2", "tag": "attribute" } ], "title": [ { "text": "H3K4me3 WIBR3 5% O2" } ] }, "relationships": [ { "source": "SAMEA103887531", "type": "derived from", "target": "SAMN00010935" }, { "source": "SAMEA103887532", "type": "derived from", "target": "SAMN00010935" }, { "source": "SAMEA6032112", "type": "derived from", "target": "SAMN00010935" } ], "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00010935", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-04-05T14:34:06.980Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010935" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010935{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010935/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00010935/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00010935" } } }, { "name": "GSM529969", "accession": "SAMN00011725", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2010-04-22T10:01:54.030Z", "update": "2022-03-28T12:06:00.717Z", "submitted": "2010-04-22T10:01:12.580Z", "characteristics": { "External Id": [ { "text": "SAMN00011725", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "BME, Boston University" } ], "INSDC first public": [ { "text": "2010-04-22T10:01:54.030Z" } ], "INSDC last update": [ { "text": "2014-10-04T01:12:21.350Z" } ], "INSDC secondary accession": [ { "text": "SRS059627" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS059627" } ], "age": [ { "text": "69", "tag": "attribute" } ], "cell type": [ { "text": "neurons from prefrontal cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000540" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population": [ { "text": "NeuN+", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000540" ], "tag": "attribute" } ], "source_name": [ { "text": "prefrontal cortex", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000451" ], "tag": "attribute" } ], "title": [ { "text": "69 yr old H3K4me3_NeuN+_rep1 #11.1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00011725", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-04-22T10:01:12.580Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00011725" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00011725{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00011725/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00011725/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00011725" } } }, { "name": "GSM586874", "accession": "SAMN00113249", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-10T00:00:00Z", "update": "2022-03-28T12:37:07.130Z", "submitted": "2010-09-13T17:04:03.943Z", "characteristics": { "External Id": [ { "text": "SAMN00113249", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Genetics Section, Genome Technology Branch, NHGRI" } ], "INSDC first public": [ { "text": "2017-08-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-08-10T01:14:18.777Z" } ], "INSDC secondary accession": [ { "text": "SRS114782" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS114782" } ], "antibody manufacturer": [ { "text": "Santa Cruz", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-GFP", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sonication cycles": [ { "text": "15", "tag": "attribute" } ], "source_name": [ { "text": "Pancreatic islets", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000006" ], "tag": "attribute" } ], "tissue": [ { "text": "Pancreatic islets", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000006" ], "tag": "attribute" } ], "title": [ { "text": "Islet3_GFP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00113249", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-09-13T17:04:03.943Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00113249" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00113249{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00113249/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00113249/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00113249" } } }, { "name": "GSM641819", "accession": "SAMN00188971", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2011-03-01T13:28:49.730Z", "update": "2022-03-28T13:01:30.690Z", "submitted": "2010-12-21T16:22:04.113Z", "characteristics": { "External Id": [ { "text": "SAMN00188971", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Polyak, Medical Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2011-03-01T13:28:49.730Z" } ], "INSDC last update": [ { "text": "2014-02-24T17:54:20.320Z" } ], "INSDC secondary accession": [ { "text": "SRS150662" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS150662" } ], "antibody catalog number": [ { "text": "07-449", "tag": "attribute" } ], "antibody vendor": [ { "text": "Millipore", "tag": "attribute" } ], "cell marker": [ { "text": "CD44+", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005180" ], "tag": "attribute" } ], "cell purification antibody catalog number": [ { "text": "550988", "tag": "attribute" } ], "cell purification antibody vendor": [ { "text": "BD-Pharmingen", "tag": "attribute" } ], "cell type": [ { "text": "epithelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85045" ], "tag": "attribute" } ], "disease state": [ { "text": "normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "reduction mammoplasty", "tag": "attribute" } ], "tissue": [ { "text": "breast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000310" ], "tag": "attribute" } ], "title": [ { "text": "H3K27me3_sample2_CD44+" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00188971", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-12-21T16:22:04.113Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00188971" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00188971{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00188971/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00188971/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00188971" } } }, { "name": "GSM644991", "accession": "SAMN00189373", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2012-11-01T17:30:04.913Z", "update": "2022-03-28T13:01:37.133Z", "submitted": "2010-12-30T12:08:04.010Z", "characteristics": { "External Id": [ { "text": "SAMN00189373", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "KAIST" } ], "INSDC first public": [ { "text": "2012-11-01T17:30:04.913Z" } ], "INSDC last update": [ { "text": "2014-02-24T17:54:23.285Z" } ], "INSDC secondary accession": [ { "text": "SRS151031" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS151031" } ], "antibody catalog number": [ { "text": "ab9050", "tag": "attribute" } ], "antibody vendor": [ { "text": "Abcam", "tag": "attribute" } ], "cell line": [ { "text": "NCCIT", "tag": "attribute" } ], "cell type": [ { "text": "embryonic carcinoma cells", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-H3K36me3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NCCIT, H3K36me3 ChIP", "tag": "attribute" } ], "title": [ { "text": "H3K36me3_ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00189373", "duo": [] } ], "submittedVia": "JSON_API", "create": "2010-12-30T12:08:04.010Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00189373" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00189373{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00189373/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00189373/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00189373" } } }, { "name": "GSM726978", "accession": "SAMN00619129", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2012-09-20T16:05:34.173Z", "update": "2022-03-28T16:02:05.185Z", "submitted": "2011-05-20T09:42:07.360Z", "characteristics": { "External Id": [ { "text": "SAMN00619129", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Molecular Biology (274), Radboud University" } ], "INSDC first public": [ { "text": "2012-09-20T16:05:34.173Z" } ], "INSDC last update": [ { "text": "2014-06-12T01:12:19.007Z" } ], "INSDC secondary accession": [ { "text": "SRS193329" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS193329" } ], "antibody": [ { "text": "RUNX1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000094" ], "tag": "attribute" } ], "antibody catalog number": [ { "text": "ab23980", "tag": "attribute" } ], "antibody lot/batch number": [ { "text": "Gr21798-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006577" ], "tag": "attribute" } ], "antibody vendor": [ { "text": "Abcam", "tag": "attribute" } ], "cell type": [ { "text": "hematopoietic cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000988" ], "tag": "attribute" } ], "disease state": [ { "text": "leukemic", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SKNO-1 (leukemic)", "tag": "attribute" } ], "title": [ { "text": "SKNO-1_RUNX1 (Abcam ab23980, Gr21798-1)_no" } ], "treatment": [ { "text": "no", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00619129", "duo": [] } ], "submittedVia": "JSON_API", "create": "2011-05-20T09:42:07.360Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00619129" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00619129{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00619129/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00619129/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00619129" } } }, { "name": "GSM801050", "accession": "SAMN00738201", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2011-10-11T09:53:07.833Z", "update": "2022-03-28T16:44:03.383Z", "submitted": "2011-10-11T09:53:06.670Z", "characteristics": { "External Id": [ { "text": "SAMN00738201", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "IGBMC" } ], "INSDC first public": [ { "text": "2011-10-11T09:53:07.833Z" } ], "INSDC last update": [ { "text": "2015-01-07T01:57:20.327Z" } ], "INSDC secondary accession": [ { "text": "SRS266408" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS266408" } ], "cell line": [ { "text": "H3396 cells", "tag": "attribute" } ], "chip antibody": [ { "text": "CBP", "tag": "attribute" } ], "chip antibody manufacturer": [ { "text": "Santa Cruz", "tag": "attribute" } ], "comment": [ { "text": "Santa Cruz: CBP (A22)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3396 cells", "tag": "attribute" } ], "title": [ { "text": "CBP EtOH" } ], "treatment": [ { "text": "ethanol", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_16236" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00738201", "duo": [] } ], "submittedVia": "JSON_API", "create": "2011-10-11T09:53:06.670Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738201" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738201{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738201/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738201/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00738201" } } }, { "name": "GSM803356", "accession": "SAMN00738318", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2011-10-11T12:57:29.993Z", "update": "2022-03-28T16:44:05.490Z", "submitted": "2011-10-11T12:57:06.080Z", "characteristics": { "External Id": [ { "text": "SAMN00738318", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ENCODE DCC" } ], "INSDC first public": [ { "text": "2011-10-11T12:57:29.993Z" } ], "INSDC last update": [ { "text": "2014-12-24T01:50:15.450Z" } ], "INSDC secondary accession": [ { "text": "SRS266525" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS266525" } ], "antibody antibodydescription": [ { "text": "Mouse monoclonal, GABPa(G-1), IgG1. Antibody Target: GABP", "tag": "attribute" } ], "antibody targetdescription": [ { "text": "The transcription factor GA-binding protein (GABP) is composed of two subunits, alpha and beta. Alpha binds to a specific DNA sequence.", "tag": "attribute" } ], "antibody vendorid": [ { "text": "sc-28312", "tag": "attribute" } ], "antibody vendorname": [ { "text": "Santa Cruz Biotechnology", "tag": "attribute" } ], "biomaterial provider": [ { "text": "Coriell; http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM12878", "tag": "attribute" } ], "cell description": [ { "text": "B-lymphocyte, lymphoblastoid, International HapMap Project - CEPH/Utah - European Caucasion, Epstein-Barr Virus", "tag": "attribute" } ], "controlid": [ { "text": "SL217,SL218", "tag": "attribute" }, { "text": "SL217", "tag": "attribute" } ], "datatype": [ { "text": "ChipSeq", "tag": "attribute" } ], "datatype description": [ { "text": "Chromatin IP Sequencing", "tag": "attribute" } ], "labexpid": [ { "text": "SL203", "tag": "attribute" }, { "text": "SL203,SL205", "tag": "attribute" } ], "labversion": [ { "text": "PCR2x", "tag": "attribute" } ], "labversion description": [ { "text": "a 25-cycle round of PCR and an additional 15-cycle round of PCR after gel size selection (Myers)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "protocol": [ { "text": "PCR2x", "tag": "attribute" } ], "protocol description": [ { "text": "a 25-cycle round of PCR and an additional 15-cycle round of PCR after gel size selection (Myers)", "tag": "attribute" }, { "text": "2-cycles of PCR (Myers)", "tag": "attribute" } ], "replicate": [ { "text": "1", "tag": "attribute" }, { "text": "1,2", "tag": "attribute" } ], "replicate description": [ { "text": "tier 1", "tag": "attribute" } ], "softwareversion": [ { "text": "MACS", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0009109" ], "tag": "attribute" } ], "source_name": [ { "text": "GM12878", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002784" ], "tag": "attribute" } ], "title": [ { "text": "HudsonAlpha_ChipSeq_GM12878_GABP_PCR2x" } ], "treatment description": [ { "text": "No special treatment or protocol applies", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00738318", "duo": [] } ], "submittedVia": "JSON_API", "create": "2011-10-11T12:57:06.080Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738318" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738318{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738318/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00738318/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00738318" } } }, { "name": "GSM817348", "accession": "SAMN00739223", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-12-31T00:44:03.693Z", "update": "2022-03-28T16:44:17.145Z", "submitted": "2011-10-14T14:37:06.953Z", "characteristics": { "External Id": [ { "text": "SAMN00739223", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pfizer Worldwide Research & Development" } ], "INSDC first public": [ { "text": "2013-12-31T00:44:03.693Z" } ], "INSDC last update": [ { "text": "2014-03-06T14:46:53.046Z" } ], "INSDC secondary accession": [ { "text": "SRS267051" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS267051" } ], "cells": [ { "text": "VCaP", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007752" ], "tag": "attribute" } ], "chip antibody": [ { "text": "AR", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Hormone refractory prostate cancer cells", "tag": "attribute" } ], "title": [ { "text": "R1881(-)" } ], "treatment": [ { "text": "Vehicle (0.1% DMSO)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00739223", "duo": [] } ], "submittedVia": "JSON_API", "create": "2011-10-14T14:37:06.953Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00739223" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00739223{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00739223/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00739223/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00739223" } } }, { "name": "GSM835568", "accession": "SAMN00760176", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-11-16T01:18:58.303Z", "update": "2022-03-28T16:50:28Z", "submitted": "2011-11-18T17:05:04.080Z", "characteristics": { "External Id": [ { "text": "SAMN00760176", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Reymond, CIG, UNIL" } ], "INSDC first public": [ { "text": "2013-11-16T01:18:58.303Z" } ], "INSDC last update": [ { "text": "2014-03-06T14:47:36.834Z" } ], "INSDC secondary accession": [ { "text": "SRS271169" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS271169" } ], "cell line id": [ { "text": "SE160", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005179" ], "tag": "attribute" } ], "cell type": [ { "text": "Lymphoblastoid cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000572" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H4K20me1 [Abcam ab9051]", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "EBV transformed mononuclear cells from perypherial blood", "tag": "attribute" } ], "title": [ { "text": "DGS_H4K20me1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00760176", "duo": [] } ], "submittedVia": "JSON_API", "create": "2011-11-18T17:05:04.080Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00760176" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00760176{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00760176/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00760176/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00760176" } } }, { "name": "GSM881390", "accession": "SAMN00792919", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2012-11-01T17:31:41.383Z", "update": "2022-03-28T17:00:15.836Z", "submitted": "2012-02-27T23:26:05.440Z", "characteristics": { "External Id": [ { "text": "SAMN00792919", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dr. Sheng Zhong, Bioengineering, University of California San Diego" } ], "INSDC first public": [ { "text": "2012-11-01T17:31:41.383Z" } ], "INSDC last update": [ { "text": "2014-03-06T14:49:39.982Z" } ], "INSDC secondary accession": [ { "text": "SRS295538" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS295538" } ], "cell type": [ { "text": "human embryonic stem cell (H1)", "tag": "attribute" } ], "chip": [ { "text": "H2AZ", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "human embryonic stem cell (H1)", "tag": "attribute" } ], "title": [ { "text": "H1_H2AZ_ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN00792919", "duo": [] } ], "submittedVia": "JSON_API", "create": "2012-02-27T23:26:05.440Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00792919" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00792919{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00792919/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN00792919/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN00792919" } } }, { "name": "GSM992733", "accession": "SAMN01129907", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-07-18T00:00:00Z", "update": "2023-07-19T23:05:10.331Z", "submitted": "2012-08-27T12:05:21.027Z", "characteristics": { "External Id": [ { "text": "SAMN01129907", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Crystal Marconett, Biochemistry & Molecular Biology, University of Southern California" } ], "INSDC first public": [ { "text": "2023-07-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-07-18T01:25:20.587Z" } ], "INSDC secondary accession": [ { "text": "SRS359530" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS359530" } ], "cell type": [ { "text": "Primary isolated AT2 cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85045" ], "tag": "attribute" } ], "chip antibody manufacturer": [ { "text": "Millipore", "tag": "attribute" } ], "cod": [ { "text": "anoxia", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "source_name": [ { "text": "Alveolar Epithelial type 2 (AT2 cell)", "tag": "attribute" } ], "title": [ { "text": "Day 0 H3K27me3 ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN01129907", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN01129907", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2012-08-27T12:05:21.027Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01129907" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01129907{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01129907/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01129907/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN01129907" } } }, { "name": "GSM1003727", "accession": "SAMN01174239", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-12-06T01:21:42.443Z", "update": "2022-03-28T19:23:27.262Z", "submitted": "2012-09-13T15:05:36.920Z", "characteristics": { "External Id": [ { "text": "SAMN01174239", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NKI" } ], "INSDC first public": [ { "text": "2013-12-06T01:21:42.443Z" } ], "INSDC last update": [ { "text": "2014-03-06T16:23:23.657Z" } ], "INSDC secondary accession": [ { "text": "SRS362891" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS362891" } ], "aromatase inhibitor treatment outcome": [ { "text": "poor", "tag": "attribute" } ], "chip antibody": [ { "text": "07-449 (millipore)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "procedure": [ { "text": "ChIP-seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002692" ], "tag": "attribute" } ], "source_name": [ { "text": "breast carcinoma", "tag": "attribute" } ], "tissue": [ { "text": "primary breast tumor", "tag": "attribute" } ], "title": [ { "text": "poor outcome_2_H3K27me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN01174239", "duo": [] } ], "submittedVia": "JSON_API", "create": "2012-09-13T15:05:36.920Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01174239" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01174239{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01174239/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01174239/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN01174239" } } }, { "name": "GSM1057016", "accession": "SAMN01874812", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-09-21T01:27:11.710Z", "update": "2022-03-28T23:49:55.648Z", "submitted": "2012-12-26T12:05:03.907Z", "characteristics": { "External Id": [ { "text": "SAMN01874812", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hospital for Special Surgery" } ], "INSDC first public": [ { "text": "2013-09-21T01:27:11.710Z" } ], "INSDC last update": [ { "text": "2014-03-06T16:47:44.110Z" } ], "INSDC secondary accession": [ { "text": "SRS381511" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS381511" } ], "cell type": [ { "text": "CD14+ monocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0001054" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam ab-4729)", "tag": "attribute" } ], "experimental condition": [ { "text": "Cultured with MCSF (10ng/ml)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Peripheral blood cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0003494" ], "tag": "attribute" } ], "title": [ { "text": "H3K27Ac_ChIPSeq_rep1_A" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN01874812", "duo": [] } ], "submittedVia": "JSON_API", "create": "2012-12-26T12:05:03.907Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01874812" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01874812{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01874812/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN01874812/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN01874812" } } }, { "name": "GSM1125982", "accession": "SAMN02048836", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-05-10T06:46:58.440Z", "update": "2022-03-29T00:50:23.485Z", "submitted": "2013-04-18T13:11:08.577Z", "characteristics": { "External Id": [ { "text": "SAMN02048836", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ReddyLab, Department of Biostatistics & Bioinformatics, Duke University" } ], "INSDC first public": [ { "text": "2013-05-10T06:46:58.440Z" } ], "INSDC last update": [ { "text": "2014-03-06T17:09:27.644Z" } ], "INSDC secondary accession": [ { "text": "SRS414449" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS414449" } ], "cell type": [ { "text": "Bronchial Epithelial Cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "chip antibody": [ { "text": "GRHL2", "tag": "attribute" } ], "chip antibody manufacturer": [ { "text": "Sigma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004563" ], "tag": "attribute" } ], "donor": [ { "text": "C29", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Bronchial Epithelial Cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "title": [ { "text": "C_29_GRHL2_ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02048836", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-04-18T13:11:08.577Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02048836" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02048836{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02048836/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02048836/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02048836" } } }, { "name": "GSM798386", "accession": "SAMN02198091", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-06-11T13:00:00.933Z", "update": "2022-03-29T01:28:33.697Z", "submitted": "2013-06-11T13:00:00.933Z", "characteristics": { "External Id": [ { "text": "SAMN02198091", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cambridge Research Institute, Cancer Research UK" } ], "INSDC first public": [ { "text": "2013-06-11T13:00:00.933Z" } ], "INSDC last update": [ { "text": "2014-03-07T14:18:28.327Z" } ], "INSDC secondary accession": [ { "text": "SRS496935" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS496935" } ], "antibody": [ { "text": "anti-ER (SC-543, Santa Cruz Biotechnologies)", "tag": "attribute" } ], "condition": [ { "text": "Responder", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human tumour tissue", "tag": "attribute" } ], "tissue": [ { "text": "CX627219_T4", "tag": "attribute" } ], "title": [ { "text": "SLX-2627.438.s_5" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02198091", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-06-11T13:00:00.933Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02198091" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02198091{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02198091/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02198091/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02198091" } } }, { "name": "GSM1160644", "accession": "SAMN02199196", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-10-01T00:00:00Z", "update": "2022-03-29T01:28:56.094Z", "submitted": "2013-06-11T16:20:25.226Z", "characteristics": { "External Id": [ { "text": "SAMN02199196", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hernandez, CIG, University of Lausanne" } ], "INSDC first public": [ { "text": "2013-10-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-20T16:32:49.708Z" } ], "INSDC secondary accession": [ { "text": "SRS441408" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS441408" } ], "cell type": [ { "text": "IMR90 cells", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-POLR3D (mouse and human) CS681 Ab, raised against peptide CSPDFESLLDHKHR {Chong, 2001 #96}", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "IMR90 cells", "tag": "attribute" } ], "title": [ { "text": "POLR3D_IMR90" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02199196", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-06-11T16:20:25.226Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02199196" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02199196{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02199196/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02199196/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02199196" } } }, { "name": "GSM1164212", "accession": "SAMN02204424", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-10-01T01:14:22.930Z", "update": "2022-03-29T01:30:37.981Z", "submitted": "2013-06-15T22:30:33.347Z", "characteristics": { "External Id": [ { "text": "SAMN02204424", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pritchard, Human Genetics, University of Chicago" } ], "INSDC first public": [ { "text": "2013-10-01T01:14:22.930Z" } ], "INSDC last update": [ { "text": "2014-03-07T14:42:22.856Z" } ], "INSDC secondary accession": [ { "text": "SRS445475" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS445475" } ], "biomaterial provider": [ { "text": "Coriell; http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM19239", "tag": "attribute" } ], "cell line": [ { "text": "GM19239", "tag": "attribute" } ], "cell type": [ { "text": "lymphoblastoid cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005292" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me1 (Millipore 07-436)", "tag": "attribute" } ], "chip antibody manufacturer": [ { "text": "Millipore", "tag": "attribute" } ], "country of origin": [ { "text": "Nigeria", "tag": "attribute" } ], "ethnicity": [ { "text": "Yoruba", "ontologyTerms": [ "http://purl.obolibrary.org/obo/HANCESTRO_0575" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "population": [ { "text": "YRI", "tag": "attribute" } ], "source_name": [ { "text": "lymphoblastoid cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005292" ], "tag": "attribute" } ], "title": [ { "text": "H3K4me1 ChIP-seq for GM19239" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02204424", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-06-15T22:30:33.347Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02204424" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02204424{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02204424/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02204424/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02204424" } } }, { "name": "GSM1233880", "accession": "SAMN02359414", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-10-19T01:28:27.803Z", "update": "2022-03-29T02:25:15.380Z", "submitted": "2013-09-19T16:36:37.287Z", "characteristics": { "External Id": [ { "text": "SAMN02359414", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2013-10-19T01:28:27.803Z" } ], "INSDC last update": [ { "text": "2014-03-07T15:52:03.731Z" } ], "INSDC secondary accession": [ { "text": "SRS484640" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS484640" } ], "antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "cell line": [ { "text": "10847", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "Lymphoblastoid Cell Lines", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005292" ], "tag": "attribute" } ], "title": [ { "text": "GM10847_H3K4me3_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02359414", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-09-19T16:36:37.287Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02359414" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02359414{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02359414/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02359414/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02359414" } } }, { "name": "GSM1239617", "accession": "SAMN02363670", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-09-25T11:31:35.820Z", "update": "2022-03-29T02:26:27.087Z", "submitted": "2013-09-25T11:31:35.820Z", "characteristics": { "External Id": [ { "text": "SAMN02363670", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Taipale lab, Dep of Biosciences and Nutrition, Novum, Karolinska Institute" } ], "INSDC first public": [ { "text": "2013-09-25T11:31:35.820Z" } ], "INSDC last update": [ { "text": "2014-05-16T01:27:47.943Z" } ], "INSDC secondary accession": [ { "text": "SRS487803" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS487803" } ], "antibody": [ { "text": "Abcam : ab117756", "tag": "attribute" } ], "cell line": [ { "text": "LoVo", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006639" ], "tag": "attribute" } ], "cell type": [ { "text": "colon adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000365" ], "tag": "attribute" } ], "control sample": [ { "text": "batch5_chrom2_LoVo_IgG_Rabbit", "tag": "attribute" } ], "fraction of peaks close to tss": [ { "text": "0.456", "tag": "attribute" } ], "hgn": [ { "text": "ZBTB2", "tag": "attribute" } ], "lowest e-value for a high complexity de novo motif": [ { "text": "3.3e-06", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "qc successful": [ { "text": "FailedQC", "tag": "attribute" } ], "source_name": [ { "text": "LoVo", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006639" ], "tag": "attribute" } ], "title": [ { "text": "batch5_chrom2_LoVo_ZBTB24_Rabbit_FailedQC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02363670", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-09-25T11:31:35.820Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02363670" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02363670{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02363670/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02363670/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02363670" } } }, { "name": "GSM1240840", "accession": "SAMN02364587", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2013-09-28T01:16:43.217Z", "update": "2022-03-29T02:26:45.951Z", "submitted": "2013-09-27T08:41:09.410Z", "characteristics": { "External Id": [ { "text": "SAMN02364587", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Taipale lab, Dep of Biosciences and Nutrition, Novum, Karolinska Institute" } ], "INSDC first public": [ { "text": "2013-09-28T01:16:43.217Z" } ], "INSDC last update": [ { "text": "2014-03-07T15:53:13.884Z" } ], "INSDC secondary accession": [ { "text": "SRS487990" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS487990" } ], "antibody": [ { "text": "Abcam : ab9263", "tag": "attribute" } ], "cell line": [ { "text": "GP5d", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006576" ], "tag": "attribute" } ], "cell type": [ { "text": "colon adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000365" ], "tag": "attribute" } ], "control sample": [ { "text": "GP5dsiRAD21_IgG_Rabbit", "tag": "attribute" } ], "hgn": [ { "text": "SMC3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sirna": [ { "text": "RAD39", "tag": "attribute" } ], "source_name": [ { "text": "GP5d", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006576" ], "tag": "attribute" } ], "title": [ { "text": "GP5dsiRAD21_SMC3_Rabbit" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02364587", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-09-27T08:41:09.410Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02364587" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02364587{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02364587/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02364587/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02364587" } } }, { "name": "GSM1294891", "accession": "SAMN02469158", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-09-15T01:20:44.400Z", "update": "2022-03-29T02:55:15.004Z", "submitted": "2013-12-19T08:40:49.453Z", "characteristics": { "External Id": [ { "text": "SAMN02469158", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Research UK Cambridge Institute" } ], "INSDC first public": [ { "text": "2015-09-15T01:20:44.400Z" } ], "INSDC last update": [ { "text": "2015-09-15T01:28:01.640Z" } ], "INSDC secondary accession": [ { "text": "SRS517294" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS517294" } ], "antibody": [ { "text": "anti p53 mouse monoclonal (DO-1) Sigma", "tag": "attribute" } ], "condition": [ { "text": "pAPO", "tag": "attribute" } ], "factor": [ { "text": "p53", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "diploid fibroblast", "tag": "attribute" } ], "title": [ { "text": "Apoptosis IMR90 p53 r3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02469158", "duo": [] } ], "submittedVia": "JSON_API", "create": "2013-12-19T08:40:49.453Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02469158" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02469158{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02469158/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02469158/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02469158" } } }, { "name": "GSM1340262", "accession": "SAMN02673401", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-09-15T01:21:01.850Z", "update": "2022-03-29T04:02:07.721Z", "submitted": "2014-03-05T14:00:41Z", "characteristics": { "External Id": [ { "text": "SAMN02673401", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Research UK Cambridge Institute" } ], "INSDC first public": [ { "text": "2015-09-15T01:21:01.850Z" } ], "INSDC last update": [ { "text": "2015-09-15T01:27:53.240Z" } ], "INSDC secondary accession": [ { "text": "SRS566209" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS566209" } ], "chip antibody": [ { "text": "anti-H3K4me3", "tag": "attribute" } ], "chip antibody vendor": [ { "text": "Diagenode", "tag": "attribute" } ], "cuture condition": [ { "text": "untreated, cultured in RPMI+10%FBS", "tag": "attribute" } ], "factor": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "prostate tissue_H3K4me3 ChIP", "tag": "attribute" } ], "tissue": [ { "text": "human prostate tissue", "tag": "attribute" } ], "title": [ { "text": "human prostate tissue_H3K4me3 ChIP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02673401", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-03-05T14:00:41Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02673401" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02673401{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02673401/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02673401/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02673401" } } }, { "name": "GSM1341959", "accession": "SAMN02677606", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-05-18T01:12:56.113Z", "update": "2022-03-29T04:03:49.353Z", "submitted": "2014-03-07T15:20:20.400Z", "characteristics": { "External Id": [ { "text": "SAMN02677606", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Biology, Max Planck Institute for Infection Biology" } ], "INSDC first public": [ { "text": "2015-05-18T01:12:56.113Z" } ], "INSDC last update": [ { "text": "2015-05-18T01:26:38.747Z" } ], "INSDC secondary accession": [ { "text": "SRS567577" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS567577" } ], "cell line": [ { "text": "AGS", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002109" ], "tag": "attribute" } ], "cell type": [ { "text": "gastric cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H2AXpS139 (Millipore, 05-636, lot: 2116620)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "8-12", "tag": "attribute" } ], "source_name": [ { "text": "AGS cells", "tag": "attribute" } ], "time": [ { "text": "18 h", "tag": "attribute" } ], "title": [ { "text": "H2AXpS139-ChIP-seq 18 h H.pylori rep1" } ], "treatment": [ { "text": "H. pylori infection", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02677606", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-03-07T15:20:20.400Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02677606" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02677606{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02677606/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02677606/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02677606" } } }, { "name": "GSM1446920", "accession": "SAMN02943049", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-15T00:00:00Z", "update": "2023-05-12T12:16:51.560Z", "submitted": "2014-07-28T12:12:35.393Z", "characteristics": { "External Id": [ { "text": "SAMN02943049", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Radboud University" } ], "INSDC first public": [ { "text": "2022-06-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-15T01:18:21.560Z" } ], "INSDC secondary accession": [ { "text": "SRS668115" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS668115" } ], "cell type": [ { "text": "Keratinocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000312" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "differentiation day": [ { "text": "2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Keratinocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000312" ], "tag": "attribute" } ], "title": [ { "text": "H3K27ac_day2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN02943049", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02943049", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2014-07-28T12:12:35.393Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02943049" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02943049{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02943049/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02943049/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02943049" } } }, { "name": "GSM1462552", "accession": "SAMN02947372", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-08-24T01:13:31.087Z", "update": "2022-03-29T05:48:03.389Z", "submitted": "2014-07-30T17:31:05.927Z", "characteristics": { "External Id": [ { "text": "SAMN02947372", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Fondazione Edo ed Elvo Tempia" } ], "INSDC first public": [ { "text": "2015-08-24T01:13:31.087Z" } ], "INSDC last update": [ { "text": "2015-08-24T01:18:48.653Z" } ], "INSDC secondary accession": [ { "text": "SRS671282" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS671282" } ], "antibodies": [ { "text": "CSL (Cell Signaling RBPSUH Cat.No. 5313)", "tag": "attribute" } ], "body site": [ { "text": "abdomen skin", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001416" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "4-6", "tag": "attribute" } ], "source_name": [ { "text": "primary dermal fibroblasts", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002551" ], "tag": "attribute" } ], "title": [ { "text": "CSL ChIPSeq_CellSignalling Ab" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN02947372", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-07-30T17:31:05.927Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02947372" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02947372{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02947372/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN02947372/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN02947372" } } }, { "name": "GSM1483899", "accession": "SAMN03001998", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-08-21T01:12:22.487Z", "update": "2022-03-29T06:22:28.800Z", "submitted": "2014-08-21T17:26:59.950Z", "characteristics": { "External Id": [ { "text": "SAMN03001998", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Professor Udo Oppermann Lab, NDORMS, University of Oxford" } ], "INSDC first public": [ { "text": "2015-08-21T01:12:22.487Z" } ], "INSDC last update": [ { "text": "2015-08-21T01:17:32.377Z" } ], "INSDC secondary accession": [ { "text": "SRS687854" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS687854" } ], "cell line": [ { "text": "myeloma cell line JJN-3", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-H3K4me3 (Millipore, catalog# 07-473, lot# 2207275)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "multiple myeloma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001378" ], "tag": "attribute" } ], "time": [ { "text": "7 day", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000033" ], "tag": "attribute" } ], "title": [ { "text": "7d LNA Scr" } ], "treatment": [ { "text": "LNA Scrambled (negative control)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03001998", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-08-21T17:26:59.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03001998" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03001998{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03001998/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03001998/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03001998" } } }, { "name": "GSM1505677", "accession": "SAMN03069916", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-02-19T00:44:11.957Z", "update": "2022-03-29T06:56:47.008Z", "submitted": "2014-09-16T18:33:05.413Z", "characteristics": { "External Id": [ { "text": "SAMN03069916", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Harvard University" } ], "INSDC first public": [ { "text": "2015-02-19T00:44:11.957Z" } ], "INSDC last update": [ { "text": "2015-02-19T01:48:58.377Z" } ], "INSDC secondary accession": [ { "text": "SRS701884" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS701884" } ], "cell line": [ { "text": "HUES64", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005355" ], "tag": "attribute" } ], "cell type": [ { "text": "dMS", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3(Millipore,07-473,2178350)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "dMS", "tag": "attribute" } ], "title": [ { "text": "H3K4me3 MNChIP-seq in cell type dMS H3K4me3_041914_mesendo" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03069916", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-09-16T18:33:05.413Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03069916" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03069916{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03069916/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03069916/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03069916" } } }, { "name": "GSM1527696", "accession": "SAMN03120338", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-06-08T01:17:04.480Z", "update": "2022-03-29T07:11:31.950Z", "submitted": "2014-10-18T17:21:06.967Z", "characteristics": { "External Id": [ { "text": "SAMN03120338", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Regulatory Genomics, Cancer Biology, UCL Cancer Institute" } ], "INSDC first public": [ { "text": "2016-06-08T01:17:04.480Z" } ], "INSDC last update": [ { "text": "2016-06-08T01:20:32.550Z" } ], "INSDC secondary accession": [ { "text": "SRS723652" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS723652" } ], "antibody": [ { "text": "Santa-Cruz N-20 (sc-899)", "tag": "attribute" } ], "cell type": [ { "text": "Th1", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000084" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "In vitro differentiated Th1 cells", "tag": "attribute" } ], "title": [ { "text": "Homo sapiens Th1 reactivated PolII-N20" } ], "treatment/agent": [ { "text": "PMA/ionomycin", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03120338", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-10-18T17:21:06.967Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03120338" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03120338{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03120338/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03120338/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03120338" } } }, { "name": "GSM1556331", "accession": "SAMN03247009", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-02-19T14:09:29.687Z", "update": "2022-03-29T07:45:23.066Z", "submitted": "2014-12-01T12:25:43.213Z", "characteristics": { "External Id": [ { "text": "SAMN03247009", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Signal Transduction in Tumor Cells, Max-Delbrück-Center" } ], "INSDC first public": [ { "text": "2016-02-19T14:09:29.687Z" } ], "INSDC last update": [ { "text": "2016-02-19T14:14:44.347Z" } ], "INSDC secondary accession": [ { "text": "SRS774879" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS774879" } ], "cell line": [ { "text": "L1236", "tag": "attribute" } ], "chip antibody": [ { "text": "NFkB p65 (C-20) #sc-372, rabbit pkAb", "tag": "attribute" } ], "dsmz no": [ { "text": "ACC 530", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Hodgkin Lymphoma Cell Line", "tag": "attribute" } ], "title": [ { "text": "RelA_ChIPSeq_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03247009", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-12-01T12:25:43.213Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03247009" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03247009{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03247009/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03247009/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03247009" } } }, { "name": "GSM1572786", "accession": "SAMN03273130", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-06-01T01:15:54.613Z", "update": "2022-03-29T07:55:11.332Z", "submitted": "2014-12-24T10:10:44.627Z", "characteristics": { "External Id": [ { "text": "SAMN03273130", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Epigenomics Core, Medicine/Hematology-Oncology, Weill Cornell Medical College" } ], "INSDC first public": [ { "text": "2015-06-01T01:15:54.613Z" } ], "INSDC last update": [ { "text": "2015-06-01T01:22:33.173Z" } ], "INSDC secondary accession": [ { "text": "SRS803614" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS803614" } ], "cell line": [ { "text": "OCI-Ly1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005907" ], "tag": "attribute" } ], "chip antibody": [ { "text": "anti-histone H3 trimethyl K4 (ab8580, Abcam, Cambridge, MA)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Diffuse large B-cell lymphoma (DLBCL) cell line OCI-Ly21", "tag": "attribute" } ], "title": [ { "text": "Sample_H3K4me3_Index_4_lane6" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03273130", "duo": [] } ], "submittedVia": "JSON_API", "create": "2014-12-24T10:10:44.627Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03273130" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03273130{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03273130/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03273130/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03273130" } } }, { "name": "GSM1576986", "accession": "SAMN03275794", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-10-01T03:03:29.750Z", "update": "2022-03-29T07:56:02.503Z", "submitted": "2015-01-06T11:11:42.810Z", "characteristics": { "External Id": [ { "text": "SAMN03275794", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genome Institute Singapore" } ], "INSDC first public": [ { "text": "2015-10-01T03:03:29.750Z" } ], "INSDC last update": [ { "text": "2015-10-01T03:09:31.060Z" } ], "INSDC secondary accession": [ { "text": "SRS809694" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS809694" } ], "antibody": [ { "text": "3ug H3K27ac Actif motif (cat 39133,lot19208002)", "tag": "attribute" } ], "fat differentiation cycle": [ { "text": "cycle 3", "tag": "attribute" } ], "gender": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "Small-for-Gestational-Age (SGA)", "tag": "attribute" } ], "source_name": [ { "text": "umbilical cord derived mesenchymal stem cells (UC-MSC)", "tag": "attribute" } ], "title": [ { "text": "H3K27ac ChIPseq: SGA cycle 3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03275794", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-01-06T11:11:42.810Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03275794" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03275794{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03275794/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03275794/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03275794" } } }, { "name": "GSM1587913", "accession": "SAMN03290581", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-09-25T01:12:35.740Z", "update": "2022-03-29T08:03:02.626Z", "submitted": "2015-01-21T15:21:35.400Z", "characteristics": { "External Id": [ { "text": "SAMN03290581", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Shair, Chemistry and Chemical Biology, Harvard University" } ], "INSDC first public": [ { "text": "2015-09-25T01:12:35.740Z" } ], "INSDC last update": [ { "text": "2015-09-25T01:16:29.963Z" } ], "INSDC secondary accession": [ { "text": "SRS824206" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS824206" } ], "ca sensitivity": [ { "text": "sensitive", "tag": "attribute" } ], "cell line": [ { "text": "MOLM14", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006652" ], "tag": "attribute" } ], "cell type": [ { "text": "MLL-AF9-rearranged AML", "tag": "attribute" } ], "chip epitope": [ { "text": "H3K27ac", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MOLM14", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006652" ], "tag": "attribute" } ], "title": [ { "text": "MOLM14_H3K27ac_CA25_11" } ], "treatment protocol": [ { "text": "CA25", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03290581", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-01-21T15:21:35.400Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03290581" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03290581{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03290581/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03290581/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03290581" } } }, { "name": "GSM1606430", "accession": "SAMN03339163", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-21T00:00:00Z", "update": "2022-03-29T08:14:47.121Z", "submitted": "2015-02-10T10:00:28.790Z", "characteristics": { "External Id": [ { "text": "SAMN03339163", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Seung Kim Lab, Developmental Biology, Stanford University" } ], "INSDC first public": [ { "text": "2018-08-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-08-21T01:22:17.413Z" } ], "INSDC secondary accession": [ { "text": "SRS841964" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS841964" } ], "age": [ { "text": "adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "cell type": [ { "text": "duct", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "pancreas", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001264" ], "tag": "attribute" } ], "tissue": [ { "text": "pancreas", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001264" ], "tag": "attribute" } ], "title": [ { "text": "H3K27ac adult duct (EA29)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03339163", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-02-10T10:00:28.790Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339163" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339163{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339163/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339163/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03339163" } } }, { "name": "GSM1607405", "accession": "SAMN03339919", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-07-15T01:12:14.690Z", "update": "2022-03-29T08:15:02.410Z", "submitted": "2015-02-11T07:07:18.690Z", "characteristics": { "External Id": [ { "text": "SAMN03339919", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stem Cells and Cancer, Oncology, IRB Barcelona" } ], "INSDC first public": [ { "text": "2016-07-15T01:12:14.690Z" } ], "INSDC last update": [ { "text": "2016-07-15T01:14:27.003Z" } ], "INSDC secondary accession": [ { "text": "SRS843706" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS843706" } ], "chip antibody": [ { "text": "H3K27ac (Merck Millipore. Cat 07-360)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "2", "tag": "attribute" } ], "source_name": [ { "text": "Epidermal Stem Cells", "tag": "attribute" } ], "tissue": [ { "text": "Foreskin", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001332" ], "tag": "attribute" } ], "title": [ { "text": "H3K27ac shDNMT3A" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03339919", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-02-11T07:07:18.690Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339919" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339919{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339919/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03339919/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03339919" } } }, { "name": "GSM1616714", "accession": "SAMN03366098", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-04-09T01:13:57.097Z", "update": "2022-03-29T08:24:52.109Z", "submitted": "2015-02-23T09:55:59.703Z", "characteristics": { "External Id": [ { "text": "SAMN03366098", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "O'Callaghan Lab - Henry Wellcome Building for Molecular Physiology, Nuffield Department of Medicine, University of Oxford" } ], "INSDC first public": [ { "text": "2015-04-09T01:13:57.097Z" } ], "INSDC last update": [ { "text": "2015-04-09T01:16:23.687Z" } ], "INSDC secondary accession": [ { "text": "SRS852811" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS852811" } ], "cell type": [ { "text": "Macrophage", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000235" ], "tag": "attribute" } ], "chip antibody": [ { "text": "C/EBP beta antibody (Santa Cruz, catalog# sc-150, lot# co513)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Macrophage-oxLDL", "tag": "attribute" } ], "title": [ { "text": "C/EBP beta_Macrophage-oxLDL_206" } ], "treatment": [ { "text": "oxLDL (50mcg/ml)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03366098", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-02-23T09:55:59.703Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03366098" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03366098{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03366098/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03366098/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03366098" } } }, { "name": "GSM1715552", "accession": "SAMN03782267", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-01-05T01:12:06.990Z", "update": "2022-03-29T11:37:59.967Z", "submitted": "2015-06-18T16:30:29Z", "characteristics": { "External Id": [ { "text": "SAMN03782267", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Martin Eilers, Institute for Biochemistry and Molecular Biology, University of Wuerzburg" } ], "INSDC first public": [ { "text": "2016-01-05T01:12:06.990Z" } ], "INSDC last update": [ { "text": "2016-01-05T01:16:16.183Z" } ], "INSDC secondary accession": [ { "text": "SRS965204" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS965204" } ], "antibody": [ { "text": "total_RNAPII", "tag": "attribute" } ], "construct": [ { "text": "pInducer21-MYC-Kless-HA", "tag": "attribute" } ], "dox treatment": [ { "text": "EtOH", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_16236" ], "tag": "attribute" } ], "generation of cells": [ { "text": "primary breast epithelial cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "IMEC cell line", "tag": "attribute" } ], "title": [ { "text": "N20_Kless_EtOH.wig" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03782267", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-06-18T16:30:29Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03782267" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03782267{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03782267/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03782267/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03782267" } } }, { "name": "GSM1820936", "accession": "SAMN03857517", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-07-15T01:21:06.160Z", "update": "2022-03-29T11:58:40.388Z", "submitted": "2015-07-14T07:01:10Z", "characteristics": { "External Id": [ { "text": "SAMN03857517", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kharchenko, DBMI, Harvard Medical School" } ], "INSDC first public": [ { "text": "2015-07-15T01:21:06.160Z" } ], "INSDC last update": [ { "text": "2015-07-15T01:21:06.236Z" } ], "INSDC secondary accession": [ { "text": "SRS989916" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS989916" } ], "cell line": [ { "text": "TC-797 (Toretsky et al. 2003)", "tag": "attribute" } ], "cell type": [ { "text": "NMC", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K14ac (anti-H3K14ac , 2 ul per IP, Abcam , catalog no. ab52946)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "797", "tag": "attribute" } ], "title": [ { "text": "IP_H3K14ac_797_Rep1_Jun2014" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03857517", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-07-14T07:01:10Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03857517" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03857517{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03857517/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03857517/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03857517" } } }, { "name": "GSM1841301", "accession": "SAMN03946420", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-10-01T02:52:33.360Z", "update": "2022-03-29T12:34:43.326Z", "submitted": "2015-07-31T14:15:28Z", "characteristics": { "External Id": [ { "text": "SAMN03946420", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Charles W.M. Roberts, Pediatric Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2015-10-01T02:52:33.360Z" } ], "INSDC last update": [ { "text": "2015-10-01T02:57:35.280Z" } ], "INSDC secondary accession": [ { "text": "SRS1019195" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1019195" } ], "cell line": [ { "text": "RS4;11", "tag": "attribute" } ], "cell type": [ { "text": "acute lymphoblastic leukemia cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me2 (Millipore, 07-030)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RS4;11_Dex_1hr", "tag": "attribute" } ], "title": [ { "text": "RS411_Dex1h_H3K4me2 ChIP" } ], "treated with": [ { "text": "10 nM dexamethasone for 1 hour", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN03946420", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-07-31T14:15:28Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03946420" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03946420{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03946420/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN03946420/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN03946420" } } }, { "name": "GSM1858642", "accession": "SAMN04004036", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-04-09T01:18:01.163Z", "update": "2022-03-29T13:04:20.632Z", "submitted": "2015-08-20T15:31:43Z", "characteristics": { "External Id": [ { "text": "SAMN04004036", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "LRBGE, CCR, NCI / NIH" } ], "INSDC first public": [ { "text": "2016-04-09T01:18:01.163Z" } ], "INSDC last update": [ { "text": "2016-04-09T01:22:15.520Z" } ], "INSDC secondary accession": [ { "text": "SRS1042186" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1042186" } ], "antibody": [ { "text": "FoxA1 ab23738 Abcam", "tag": "attribute" } ], "cell line": [ { "text": "ZR-75-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001262" ], "tag": "attribute" } ], "cell type": [ { "text": "Ascites from a ductal carcinoma of the breast", "tag": "attribute" } ], "concentration": [ { "text": "100nM", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_45863" ], "tag": "attribute" } ], "growth proptocol": [ { "text": "For maintenance cells were cultured in RPMI containing 2mM L-glutamine supplemented 10% calf serum, 1mM sodium pyruvate, 1X non-essential amino acids, and 1% penicillin-streptomycin", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "replicate 2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000180" ], "tag": "attribute" } ], "source_name": [ { "text": "ZR-75-1 breast cancer cell line", "tag": "attribute" } ], "time": [ { "text": "30 minutes", "tag": "attribute" } ], "title": [ { "text": "Dex rep#2 FoxA1 ChIP-seq GH1067" } ], "treatment": [ { "text": "Dexamethasone", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_41879" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04004036", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-08-20T15:31:43Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04004036" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04004036{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04004036/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04004036/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04004036" } } }, { "name": "GSM1875146", "accession": "SAMN04053601", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-09-12T01:15:07.203Z", "update": "2022-03-29T13:25:07.105Z", "submitted": "2015-09-11T11:10:15Z", "characteristics": { "External Id": [ { "text": "SAMN04053601", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tim H-M Huang, Molecular Medicin, The University of Texas Health Science Center at San Antonio" } ], "INSDC first public": [ { "text": "2015-09-12T01:15:07.203Z" } ], "INSDC last update": [ { "text": "2015-09-12T01:20:31.850Z" } ], "INSDC secondary accession": [ { "text": "SRS1064913" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1064913" } ], "antibody": [ { "text": "LEF3", "tag": "attribute" } ], "cell line": [ { "text": "RL95-2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002320" ], "tag": "attribute" } ], "egf hr": [ { "text": "24hr", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RL95-2 cells", "tag": "attribute" } ], "title": [ { "text": "LEF1_24" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04053601", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-09-11T11:10:15Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04053601" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04053601{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04053601/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04053601/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04053601" } } }, { "name": "GSM1892617", "accession": "SAMN04110975", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-06-16T00:00:00Z", "update": "2022-03-29T13:52:14.301Z", "submitted": "2015-09-24T17:27:37Z", "characteristics": { "External Id": [ { "text": "SAMN04110975", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Shivdasani, Medical Oncology, Dana Farbed Cancer Institute" } ], "INSDC first public": [ { "text": "2017-06-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-06-16T01:29:19.220Z" } ], "INSDC secondary accession": [ { "text": "SRS1089336" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1089336" } ], "antibody": [ { "text": "H3K4me2 (Millipore, 07-030)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary colonic mucosa", "tag": "attribute" } ], "tissue": [ { "text": "FFPE", "tag": "attribute" } ], "title": [ { "text": "CM3 - FFPE H3K4me2-ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04110975", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-09-24T17:27:37Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04110975" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04110975{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04110975/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04110975/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04110975" } } }, { "name": "GSM1909086", "accession": "SAMN04168597", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2015-10-16T01:16:28.247Z", "update": "2022-03-29T14:13:33.406Z", "submitted": "2015-10-15T13:00:04Z", "characteristics": { "External Id": [ { "text": "SAMN04168597", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Research UK Cambridge Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2015-10-16T01:16:28.247Z" } ], "INSDC last update": [ { "text": "2015-10-16T01:22:15.913Z" } ], "INSDC secondary accession": [ { "text": "SRS1115873" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1115873" } ], "cell line": [ { "text": "MDA_MB_453", "tag": "attribute" } ], "chip antibody": [ { "text": "AR (Santa Cruz Biotech, N-20, sc-816)", "tag": "attribute" } ], "gender": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Mammary gland/breast metastatic carcinoma", "tag": "attribute" } ], "title": [ { "text": "MDA_MB_453_ARChIPseq_Vehicle1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04168597", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-10-15T13:00:04Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04168597" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04168597{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04168597/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04168597/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04168597" } } }, { "name": "GSM1922955", "accession": "SAMN04229273", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-01-26T00:00:00Z", "update": "2022-03-29T14:39:05.596Z", "submitted": "2015-11-01T11:11:12Z", "characteristics": { "External Id": [ { "text": "SAMN04229273", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bernstein, Molecular Pathology, MGH" } ], "INSDC first public": [ { "text": "2017-01-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-01-26T01:19:29.703Z" } ], "INSDC secondary accession": [ { "text": "SRS1743978" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1743978" } ], "cell line": [ { "text": "Patient-derived neurosphere line GSC8", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Millipore, 07-473, Lot 2207275)", "tag": "attribute" } ], "drug treatment": [ { "text": "12 day 1 µM dasatinib, 8 day 1.5 µM GSKJ4", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3K4me3_GSC8_12d-das_8d-GSKJ4", "tag": "attribute" } ], "title": [ { "text": "H3K4me3_GSC8_12d-das_8d-GSKJ4_ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04229273", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-11-01T11:11:12Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04229273" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04229273{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04229273/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04229273/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04229273" } } }, { "name": "GSM1940871", "accession": "SAMN04270717", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-11-15T00:00:00Z", "update": "2022-03-29T14:53:22.770Z", "submitted": "2015-11-15T09:41:22Z", "characteristics": { "External Id": [ { "text": "SAMN04270717", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stephen Mack Lab, Pediatrics, Baylor College of Medicine" } ], "INSDC first public": [ { "text": "2018-11-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-11-15T01:48:25.790Z" } ], "INSDC secondary accession": [ { "text": "SRS1164099" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1164099" } ], "chip antibody": [ { "text": "anti-H3K27ac (Abcam, AB4729, Lot #GR184557)", "tag": "attribute" } ], "diagnosis": [ { "text": "Primary", "tag": "attribute" } ], "epigenetic mark": [ { "text": "H3K27ac", "tag": "attribute" } ], "molecular subgroup": [ { "text": "PFA", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Brain", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000955" ], "tag": "attribute" } ], "title": [ { "text": "BT2010129" } ], "tumor type": [ { "text": "Ependymoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1000028" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04270717", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-11-15T09:41:22Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04270717" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04270717{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04270717/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04270717/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04270717" } } }, { "name": "GSM1975197", "accession": "SAMN04350727", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-09-28T01:15:27.043Z", "update": "2022-03-29T15:23:10.528Z", "submitted": "2015-12-18T11:06:34Z", "characteristics": { "External Id": [ { "text": "SAMN04350727", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "GIS" } ], "INSDC first public": [ { "text": "2016-09-28T01:15:27.043Z" } ], "INSDC last update": [ { "text": "2016-09-28T01:20:22.863Z" } ], "INSDC secondary accession": [ { "text": "SRS1213017" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1213017" } ], "chip antibody": [ { "text": "H3K27Ac", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Gastric Primary Sample", "tag": "attribute" } ], "tissue": [ { "text": "Gastric Primary Sample", "tag": "attribute" } ], "title": [ { "text": "GCC077_mem" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04350727", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-12-18T11:06:34Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04350727" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04350727{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04350727/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04350727/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04350727" } } }, { "name": "GSM1981418", "accession": "SAMN04370259", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-09-05T00:00:00Z", "update": "2022-03-29T15:28:52.730Z", "submitted": "2015-12-24T10:49:17Z", "characteristics": { "External Id": [ { "text": "SAMN04370259", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Histone Variant Group, Genomics and Epigenetics, Garvan Institute of Medical Research" } ], "INSDC first public": [ { "text": "2017-09-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-09-05T01:22:17.467Z" } ], "INSDC secondary accession": [ { "text": "SRS1223485" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1223485" } ], "cell type": [ { "text": "Primary prostate epithelial cells. Cambrex Bio Science Cat. No. CC-2556", "tag": "attribute" } ], "chip antibody": [ { "text": "Abcam Cat #ab18262", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage number": [ { "text": "7", "tag": "attribute" } ], "source_name": [ { "text": "Human cell line", "tag": "attribute" } ], "title": [ { "text": "H2AZac_ChIPseq_PrEC_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04370259", "duo": [] } ], "submittedVia": "JSON_API", "create": "2015-12-24T10:49:17Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04370259" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04370259{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04370259/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04370259/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04370259" } } }, { "name": "GSM2043201", "accession": "SAMN04432220", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-01-01T00:00:00Z", "update": "2022-03-29T15:44:18.937Z", "submitted": "2016-01-21T06:55:04Z", "characteristics": { "External Id": [ { "text": "SAMN04432220", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Ernesto Guccione, IMCB, A*Star Singapore" } ], "INSDC first public": [ { "text": "2020-01-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-01-01T02:16:25.527Z" } ], "INSDC secondary accession": [ { "text": "SRS1255756" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1255756" } ], "cell line": [ { "text": "P493", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-Myc (Santa Cruz Biotechnology, Catalog#: sc-764, Antibody name: N262, Lot#: D0413)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "P493 MST", "tag": "attribute" } ], "title": [ { "text": "P493_MST" } ], "treatment": [ { "text": "MST-312", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04432220", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-01-21T06:55:04Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04432220" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04432220{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04432220/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04432220/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04432220" } } }, { "name": "GSM2144749", "accession": "SAMN04958926", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-06-07T02:18:53.797Z", "update": "2022-03-29T17:55:42.031Z", "submitted": "2016-05-06T17:01:16Z", "characteristics": { "External Id": [ { "text": "SAMN04958926", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zwart, Molecular Pathology, the Netherlands Cancer Institute" } ], "INSDC first public": [ { "text": "2016-06-07T02:18:53.797Z" } ], "INSDC last update": [ { "text": "2016-06-07T02:23:40.767Z" } ], "INSDC secondary accession": [ { "text": "SRS1424590" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1424590" } ], "chip antibody": [ { "text": "H3K27ac (39133; Active motif)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Tamoxifen-associated endometrial tumor", "tag": "attribute" } ], "tissue": [ { "text": "endometrioid adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000466" ], "tag": "attribute" } ], "title": [ { "text": "Tumor A H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04958926", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-05-06T17:01:16Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04958926" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04958926{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04958926/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04958926/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04958926" } } }, { "name": "GSM2150351", "accession": "SAMN04990212", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-05-30T00:00:00Z", "update": "2022-03-29T18:13:12.123Z", "submitted": "2016-05-11T14:36:06Z", "characteristics": { "External Id": [ { "text": "SAMN04990212", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Ting Wang Lab, Genetics, Washington University in St. Louis" } ], "INSDC first public": [ { "text": "2017-05-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-05-30T01:14:21.677Z" } ], "INSDC secondary accession": [ { "text": "SRS1433408" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1433408" } ], "antibody": [ { "text": "H3K9ac", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NCI-H1299-EGFP/NEO", "tag": "attribute" } ], "title": [ { "text": "DAC_H3K9ac" } ], "treatment": [ { "text": "DAC", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN04990212", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-05-11T14:36:06Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04990212" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04990212{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04990212/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN04990212/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN04990212" } } }, { "name": "GSM2190588", "accession": "SAMN05214333", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-07-12T01:24:21.120Z", "update": "2022-03-29T18:43:10.238Z", "submitted": "2016-06-08T07:56:11.613Z", "characteristics": { "External Id": [ { "text": "SAMN05214333", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NIH" } ], "INSDC first public": [ { "text": "2016-07-12T01:24:21.120Z" } ], "INSDC last update": [ { "text": "2016-07-12T01:27:41.283Z" } ], "INSDC secondary accession": [ { "text": "SRS1491181" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1491181" } ], "chip antibody": [ { "text": "Med1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ], "tag": "attribute" } ], "chip antibody vendor": [ { "text": "Bethyl", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SKMEL147", "tag": "attribute" } ], "title": [ { "text": "SKMEL147_Med1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05214333", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-06-08T07:56:11.613Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05214333" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05214333{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05214333/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05214333/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05214333" } } }, { "name": "GSM2258800", "accession": "SAMN05509685", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-12-16T00:00:00Z", "update": "2022-03-29T20:09:58.458Z", "submitted": "2016-08-03T15:23:26.807Z", "characteristics": { "External Id": [ { "text": "SAMN05509685", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bioinformatics and Computational Biology, The University of Texas MD Anderson Cancer Center" } ], "INSDC first public": [ { "text": "2017-12-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-12-16T01:27:23.153Z" } ], "INSDC secondary accession": [ { "text": "SRS1599471" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1599471" } ], "cell line": [ { "text": "SKBR3", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001236" ], "tag": "attribute" } ], "cell type": [ { "text": "Breast cancer cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002885" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me1 (Abcam, ab8895)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SKBR3 cells, H3K4me1 ChIP", "tag": "attribute" } ], "title": [ { "text": "SKBR3.H3K4me1.rep1" } ], "treatment": [ { "text": "Control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05509685", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-03T15:23:26.807Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05509685" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05509685{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05509685/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05509685/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05509685" } } }, { "name": "GSM2259137", "accession": "SAMN05510500", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-04-01T00:00:00Z", "update": "2022-03-29T20:10:17.075Z", "submitted": "2016-08-03T17:11:25.780Z", "characteristics": { "External Id": [ { "text": "SAMN05510500", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Javed Khan, Genetics Branch, NCI, NIH" } ], "INSDC first public": [ { "text": "2018-04-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-04-03T21:36:32Z" } ], "INSDC secondary accession": [ { "text": "SRS1599822" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1599822" } ], "antibody": [ { "text": "H3K27ac, Active Motif (cat39133, lot 31814008 pAb)", "tag": "attribute" } ], "enrichment target": [ { "text": "H3K27ac", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RMS cell line, mutant HRAS", "tag": "attribute" } ], "target function": [ { "text": "Active enhancers", "tag": "attribute" } ], "time": [ { "text": "48 hr", "tag": "attribute" } ], "title": [ { "text": "CTR T48 H3K27ac rep 2" } ], "treatment": [ { "text": "Trametinib 100nM", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05510500", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-03T17:11:25.780Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05510500" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05510500{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05510500/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05510500/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05510500" } } }, { "name": "GSM2262968", "accession": "SAMN05514005", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-11-19T01:26:43.007Z", "update": "2022-03-29T20:11:25.335Z", "submitted": "2016-08-05T11:06:07.043Z", "characteristics": { "External Id": [ { "text": "SAMN05514005", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Biology, Radboud University" } ], "INSDC first public": [ { "text": "2016-11-19T01:26:43.007Z" } ], "INSDC last update": [ { "text": "2016-11-19T01:31:24.497Z" } ], "INSDC secondary accession": [ { "text": "SRS1603802" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1603802" } ], "background strain": [ { "text": "Adult Human Peripheral Blood", "tag": "attribute" } ], "cell type": [ { "text": "Monocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000576" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit polyclonal anti-H3K27me3 (Diagenode, cat. # pAb-195-050)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RPMI d6 rep2 H3K27me3", "tag": "attribute" } ], "title": [ { "text": "RPMI_d6_rep2_H3K27me3" } ], "treatment": [ { "text": "Naïve-Mf (culture for 6 days to macrophage)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05514005", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-05T11:06:07.043Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05514005" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05514005{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05514005/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05514005/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05514005" } } }, { "name": "GSM2277185", "accession": "SAMN05571199", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-03-02T00:00:00Z", "update": "2022-03-29T20:35:13.688Z", "submitted": "2016-08-12T16:11:04.383Z", "characteristics": { "External Id": [ { "text": "SAMN05571199", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genome Plasticity Laboratory, Department of Biomedicine, University of Basel" } ], "INSDC first public": [ { "text": "2017-03-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-03-02T16:20:46.783Z" } ], "INSDC secondary accession": [ { "text": "SRS1614444" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1614444" } ], "cell type": [ { "text": "human cord blood CD34+ cell-derived neutrophil progenitor cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3 (Millipore, 07-499, lot: JBC1924326)", "tag": "attribute" } ], "differentiation": [ { "text": "100 ng/ml G-CSF", "tag": "attribute" } ], "exposure conditions": [ { "text": "ELF-MF (50Hz powerline, 0.007 mT, 5' on/10' off)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "neutrophil progenitor cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000834" ], "tag": "attribute" } ], "time of differentiation and exposure": [ { "text": "5 days", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000033" ], "tag": "attribute" } ], "title": [ { "text": "H3K27me3 t5 sham_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05571199", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-12T16:11:04.383Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05571199" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05571199{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05571199/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05571199/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05571199" } } }, { "name": "GSM2279959", "accession": "SAMN05578157", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-12-15T01:13:19.277Z", "update": "2022-03-29T20:37:30.411Z", "submitted": "2016-08-15T14:06:55.730Z", "characteristics": { "External Id": [ { "text": "SAMN05578157", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gladstone Institute, UCSF" } ], "INSDC first public": [ { "text": "2016-12-15T01:13:19.277Z" } ], "INSDC last update": [ { "text": "2016-12-15T01:18:38.027Z" } ], "INSDC secondary accession": [ { "text": "SRS1618192" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1618192" } ], "cell type": [ { "text": "iPS-derived cardiomyocytes", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K36me3 (ab9050, lot:GR114293-2)", "tag": "attribute" } ], "differentiation stage": [ { "text": "Differentiation D32", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "20-30", "tag": "attribute" } ], "source_name": [ { "text": "purified cardiomyocyte WT", "tag": "attribute" } ], "title": [ { "text": "1_8_H3K36me3_chip" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05578157", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-15T14:06:55.730Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05578157" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05578157{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05578157/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05578157/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05578157" } } }, { "name": "GSM2283772", "accession": "SAMN05587084", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-03-29T00:00:00Z", "update": "2022-03-29T20:39:45.231Z", "submitted": "2016-08-17T12:56:04.520Z", "characteristics": { "External Id": [ { "text": "SAMN05587084", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hermeking, Institute of Pathology, Ludwig-Maximilians-University Munich" } ], "INSDC first public": [ { "text": "2017-03-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-03-29T01:23:17.890Z" } ], "INSDC secondary accession": [ { "text": "SRS1625242" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1625242" } ], "cell characteristics": [ { "text": "epithelial, parental", "tag": "attribute" } ], "cell type": [ { "text": "colorectal cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K79me3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "colorectal cancer cell line", "tag": "attribute" } ], "title": [ { "text": "H3K79me3 ChIP-seq of parental DLD1 colorectal cancer cell line" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05587084", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-17T12:56:04.520Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05587084" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05587084{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05587084/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05587084/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05587084" } } }, { "name": "GSM2290171", "accession": "SAMN05615480", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-11-24T01:19:48.600Z", "update": "2022-03-29T20:53:10.920Z", "submitted": "2016-08-24T09:36:07.190Z", "characteristics": { "External Id": [ { "text": "SAMN05615480", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Haematology Unit, Weatherall Institute of Molecular Medicine" } ], "INSDC first public": [ { "text": "2016-11-24T01:19:48.600Z" } ], "INSDC last update": [ { "text": "2016-11-24T01:23:45.757Z" } ], "INSDC secondary accession": [ { "text": "SRS1636034" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1636034" } ], "cell type": [ { "text": "Paediatric pre B-cell line derived from cALL with t(1;19)(q23;p13) translocation", "tag": "attribute" } ], "chip antibody": [ { "text": "E2A (Cell Signaling, 12258/1)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Leukemia cell line (RCH-ACV)", "tag": "attribute" } ], "title": [ { "text": "RCH_E2A_ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05615480", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-08-24T09:36:07.190Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05615480" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05615480{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05615480/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05615480/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05615480" } } }, { "name": "GSM2356703", "accession": "SAMN05930281", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-10-17T00:00:00Z", "update": "2022-03-29T22:05:33.815Z", "submitted": "2016-10-20T11:00:05.850Z", "characteristics": { "External Id": [ { "text": "SAMN05930281", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bioinformatics, IRCAN" } ], "INSDC first public": [ { "text": "2017-10-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-10-17T01:14:18.827Z" } ], "INSDC secondary accession": [ { "text": "SRS1754315" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1754315" } ], "cell type": [ { "text": "Post-mitotic differentiated muscle cells (myotubes)", "tag": "attribute" } ], "chip antibody": [ { "text": "TRF2 (IMGENEX, monoclonal mouse IMG-124A, clone 4A794.15)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "origin": [ { "text": "Muscle biopsy - deltoid", "tag": "attribute" } ], "source_name": [ { "text": "Post-mitotic differentiated muscle cells - MYOTUBES", "tag": "attribute" } ], "title": [ { "text": "Scramble", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ] } ], "viral transduction": [ { "text": "sh Scramble", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05930281", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-10-20T11:00:05.850Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05930281" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05930281{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05930281/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05930281/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05930281" } } }, { "name": "GSM2360941", "accession": "SAMN05944026", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-03-16T00:00:00Z", "update": "2022-03-29T22:09:36.655Z", "submitted": "2016-10-26T13:26:07.890Z", "characteristics": { "External Id": [ { "text": "SAMN05944026", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for Genetics, Justus-Liebig-University Giessen" } ], "INSDC first public": [ { "text": "2017-03-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-03-16T01:21:24.950Z" } ], "INSDC secondary accession": [ { "text": "SRS1761365" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1761365" } ], "antibody": [ { "text": "H3K27ac (Diagenode, 174-050)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HuH7 cells", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq analysis of H3K27ac in Huh7 cells ( IL-1 )" } ], "treatment": [ { "text": "10ng/ml IL-1alpha for 1 h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05944026", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-10-26T13:26:07.890Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05944026" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05944026{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05944026/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05944026/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05944026" } } }, { "name": "GSM2370635", "accession": "SAMN05968151", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-01-12T01:15:41.933Z", "update": "2022-03-29T22:19:54.190Z", "submitted": "2016-11-02T11:31:20.430Z", "characteristics": { "External Id": [ { "text": "SAMN05968151", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Allergy, Cincinnati Children's Hospital" } ], "INSDC first public": [ { "text": "2017-01-12T01:15:41.933Z" } ], "INSDC last update": [ { "text": "2017-01-12T01:19:25.403Z" } ], "INSDC secondary accession": [ { "text": "SRS1777158" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1777158" } ], "biowardrobe ids": [ { "text": "488", "tag": "attribute" } ], "cell type": [ { "text": "Resting naive CD4 purified cells", "tag": "attribute" } ], "chip antibodies": [ { "text": "H2A.z (Abcam ab4174)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "Naïve H2A.z R2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN05968151", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-11-02T11:31:20.430Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05968151" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05968151{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05968151/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN05968151/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN05968151" } } }, { "name": "GSM2405920", "accession": "SAMN06054373", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-02-24T00:00:00Z", "update": "2022-03-29T22:52:57.617Z", "submitted": "2016-11-25T13:36:10.480Z", "characteristics": { "External Id": [ { "text": "SAMN06054373", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bradner Lab, Medical Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2017-02-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-02-24T01:25:18.650Z" } ], "INSDC secondary accession": [ { "text": "SRS1818630" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1818630" } ], "antibody": [ { "text": "H3K9ac", "tag": "attribute" } ], "antibody catalog number": [ { "text": "Ab4441", "tag": "attribute" } ], "antibody manufacturer": [ { "text": "Abcam", "tag": "attribute" } ], "cell line": [ { "text": "MV4;11(Cas9; ENL-FKBP(F36V); ENL-/-)", "tag": "attribute" } ], "input": [ { "text": "mv411_input", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sequencing barcode": [ { "text": "GGTTGGAC", "tag": "attribute" } ], "source_name": [ { "text": "MLL-AF4 rearranged acute myeloid leukemia", "tag": "attribute" } ], "title": [ { "text": "MV411_H3K9ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06054373", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-11-25T13:36:10.480Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06054373" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06054373{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06054373/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06054373/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06054373" } } }, { "name": "GSM2432244", "accession": "SAMN06163727", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2016-12-20T01:28:29.277Z", "update": "2022-03-29T23:39:59.703Z", "submitted": "2016-12-19T10:51:08.683Z", "characteristics": { "External Id": [ { "text": "SAMN06163727", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Murat Gunel, Departments of Neurosurgery and Genetics, Yale University" } ], "INSDC first public": [ { "text": "2016-12-20T01:28:29.277Z" } ], "INSDC last update": [ { "text": "2016-12-20T01:33:43.677Z" } ], "INSDC secondary accession": [ { "text": "SRS1870393" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1870393" } ], "grade": [ { "text": "1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NonNF2_H3k27me3_ChIPSEQ", "tag": "attribute" } ], "tissue type": [ { "text": "meningioma", "ontologyTerms": [ "http://www.orpha.net/ORDO/Orphanet_2495" ], "tag": "attribute" } ], "title": [ { "text": "NonNF2_MN-105_H3k27me3_ChIPSEQ" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06163727", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-12-19T10:51:08.683Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06163727" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06163727{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06163727/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06163727/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06163727" } } }, { "name": "GSM2432961", "accession": "SAMN06165849", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-02-22T00:00:00Z", "update": "2022-03-29T23:40:48.851Z", "submitted": "2016-12-19T13:31:56.747Z", "characteristics": { "External Id": [ { "text": "SAMN06165849", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology, Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2017-02-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-02-22T01:21:21.017Z" } ], "INSDC secondary accession": [ { "text": "SRS1871032" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1871032" } ], "cell line": [ { "text": "D341", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source type": [ { "text": "cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "source_name": [ { "text": "H3K27ac ChIP-seq in D341 cell line infected with shOTX2.1393", "tag": "attribute" } ], "title": [ { "text": "D341_shOTX2.1393_H3K27ac_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06165849", "duo": [] } ], "submittedVia": "JSON_API", "create": "2016-12-19T13:31:56.747Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06165849" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06165849{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06165849/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06165849/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06165849" } } }, { "name": "GSM2459950", "accession": "SAMN06234154", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-26T00:00:00Z", "update": "2022-03-30T00:02:19.617Z", "submitted": "2017-01-16T11:46:06.807Z", "characteristics": { "External Id": [ { "text": "SAMN06234154", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "CCRC, University of Georgia" } ], "INSDC first public": [ { "text": "2017-08-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-08-26T01:55:17.310Z" } ], "INSDC secondary accession": [ { "text": "SRS1923859" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1923859" } ], "cell type": [ { "text": "colorectal adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000365" ], "tag": "attribute" } ], "chip antibodies": [ { "text": "H3K27m3:cat 39155, Active Motif", "tag": "attribute" } ], "derivation": [ { "text": "Isolated from primary tumor", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "colon tumor cells", "tag": "attribute" } ], "title": [ { "text": "H3K27m3 ChIP-2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06234154", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-01-16T11:46:06.807Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06234154" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06234154{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06234154/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06234154/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06234154" } } }, { "name": "GSM2472122", "accession": "SAMN06281731", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-25T00:00:00Z", "update": "2022-03-30T00:22:18.664Z", "submitted": "2017-01-30T11:11:11.103Z", "characteristics": { "External Id": [ { "text": "SAMN06281731", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology, Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2017-08-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2017-08-25T11:08:45.607Z" } ], "INSDC secondary accession": [ { "text": "SRS1948620" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1948620" } ], "chip antibody": [ { "text": "BAF155 (generated in-house epitope=aa924-1004; C-terminus)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source type": [ { "text": "cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "source_name": [ { "text": "SKNMC", "tag": "attribute" } ], "title": [ { "text": "BAF155 ChIP-seq in SKNMC cell line infected with shEWSFLI1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06281731", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-01-30T11:11:11.103Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06281731" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06281731{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06281731/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06281731/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06281731" } } }, { "name": "GSM2476333", "accession": "SAMN06294517", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-01T00:00:00Z", "update": "2022-03-30T00:26:13.301Z", "submitted": "2017-02-03T13:36:08.683Z", "characteristics": { "External Id": [ { "text": "SAMN06294517", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "BSB2.03.24, Biology, University of Texas at San Antonio" } ], "INSDC first public": [ { "text": "2019-02-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-01T01:15:17.567Z" } ], "INSDC secondary accession": [ { "text": "SRS1957100" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS1957100" } ], "chip antibody": [ { "text": "Millipore #07-442; Active Motif #39162", "tag": "attribute" } ], "developmental stage": [ { "text": "adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "region": [ { "text": "epithelium", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001997" ], "tag": "attribute" } ], "source_name": [ { "text": "EAC primary specimen", "tag": "attribute" } ], "tissue": [ { "text": "esophagus", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001043" ], "tag": "attribute" } ], "title": [ { "text": "EAC H3K9me3 ChIP-Seq #2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06294517", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-02-03T13:36:08.683Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06294517" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06294517{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06294517/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06294517/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06294517" } } }, { "name": "GSM2481073", "accession": "SAMN06312754", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-11-29T00:00:00Z", "update": "2022-03-30T00:31:20.591Z", "submitted": "2017-02-08T16:06:04.043Z", "characteristics": { "External Id": [ { "text": "SAMN06312754", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bioinformatics Group, School of Pharmacy & Biomedical Science, University of Portsmouth" } ], "INSDC first public": [ { "text": "2017-11-29T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS1964880" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS1964880" } ], "antibody catalog num": [ { "text": "A301-568A", "tag": "attribute" } ], "antibody lot num": [ { "text": "1", "tag": "attribute" } ], "antibody vendor": [ { "text": "Bethyl Laboratories", "tag": "attribute" } ], "cell line": [ { "text": "leukemia cell line MOLM13", "tag": "attribute" } ], "genotype/variation": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "ip antibody": [ { "text": "METTL3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Whole cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/GO_0005623" ], "tag": "attribute" } ], "title": [ { "text": "METTL3 Rep4" } ], "truseq barcode": [ { "text": "TGACCA", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06312754", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-02-08T16:06:04.043Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06312754" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06312754{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06312754/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06312754/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06312754" } } }, { "name": "GSM2482830", "accession": "SAMN06320319", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-03T00:00:00Z", "update": "2022-03-30T00:33:41.257Z", "submitted": "2017-02-10T13:06:04.203Z", "characteristics": { "External Id": [ { "text": "SAMN06320319", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Children's Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2017-08-03T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS1968972" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS1968972" } ], "cell line": [ { "text": "NB-1643", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002798" ], "tag": "attribute" } ], "cell type": [ { "text": "Neuroblastoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000621" ], "tag": "attribute" } ], "chip antibody": [ { "text": "B8.4b (Santa Cruz, Catalog# sc-53993, Lot# K1315)", "tag": "attribute" } ], "mycn status": [ { "text": "amplified", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NB-1643 neuroblastoma cells", "tag": "attribute" } ], "title": [ { "text": "NB1643_MYCN_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06320319", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-02-10T13:06:04.203Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06320319" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06320319{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06320319/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06320319/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06320319" } } }, { "name": "GSM2516785", "accession": "SAMN06470132", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-09-30T00:00:00Z", "update": "2022-03-30T01:36:59.670Z", "submitted": "2017-03-02T15:52:27.047Z", "characteristics": { "External Id": [ { "text": "SAMN06470132", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bayer Pharma AG" } ], "INSDC first public": [ { "text": "2017-09-30T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2017440" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2017440" } ], "cell line": [ { "text": "CHL-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002132" ], "tag": "attribute" } ], "chip antibody": [ { "text": "anti-BRD4 (Bethyl Labs, A301-985A100)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "melanoma cancer cell line CHL-1", "tag": "attribute" } ], "tissue": [ { "text": "skin", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000014" ], "tag": "attribute" } ], "title": [ { "text": "CHL1_BRD4_D4_02" } ], "tumor type": [ { "text": "melanoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000756" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06470132", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-03-02T15:52:27.047Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06470132" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06470132{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06470132/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06470132/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06470132" } } }, { "name": "GSM2521495", "accession": "SAMN06474273", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-09-19T00:00:00Z", "update": "2022-03-30T01:38:15.977Z", "submitted": "2017-03-03T14:06:03.933Z", "characteristics": { "External Id": [ { "text": "SAMN06474273", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2017-09-19T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2022574" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2022574" } ], "antibody": [ { "text": "RNA Pol II", "tag": "attribute" } ], "antibody catalog number": [ { "text": "C15100055", "tag": "attribute" } ], "antibody manufacturer": [ { "text": "Diagenode", "tag": "attribute" } ], "cell line": [ { "text": "MOLT4", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001220" ], "tag": "attribute" } ], "drug treatment": [ { "text": "JQ1 (1 uM) for 2 hours", "tag": "attribute" } ], "input sample": [ { "text": "MOLT4_Pol2_input", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sequencing barcode": [ { "text": "TGCGATCT", "tag": "attribute" } ], "source_name": [ { "text": "T-ALL", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000209" ], "tag": "attribute" } ], "title": [ { "text": "MOLT4_Pol2_JQ1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06474273", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-03-03T14:06:03.933Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06474273" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06474273{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06474273/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06474273/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06474273" } } }, { "name": "GSM2550234", "accession": "SAMN06642822", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-12-05T00:00:00Z", "update": "2022-03-30T02:50:54.297Z", "submitted": "2017-03-24T20:30:03.167Z", "characteristics": { "External Id": [ { "text": "SAMN06642822", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University School of Medicine" } ], "INSDC first public": [ { "text": "2017-12-05T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2071205" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2071205" } ], "cell type": [ { "text": "Cardiac progenitor cells (CPCs)", "tag": "attribute" } ], "chip antibody": [ { "text": "Histone H3K27me3 antibody (clone: 7B11)", "tag": "attribute" } ], "chip antibody vendor": [ { "text": "Active Motif", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "P3-4", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002099" ], "tag": "attribute" } ], "source_name": [ { "text": "F2-CPCs", "tag": "attribute" } ], "title": [ { "text": "F2-CPC-K27me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06642822", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-03-24T20:30:03.167Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06642822" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06642822{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06642822/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06642822/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06642822" } } }, { "name": "GSM2571810", "accession": "SAMN06701880", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-06-04T00:00:00Z", "update": "2022-03-30T03:10:39.830Z", "submitted": "2017-04-07T18:11:22.290Z", "characteristics": { "External Id": [ { "text": "SAMN06701880", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Simches Research Center, Rm 8400, Pathology, Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2018-06-04T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2121241" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2121241" } ], "cell line": [ { "text": "Rec-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002317" ], "tag": "attribute" } ], "cell type": [ { "text": "Mantle cell lymphoma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "NICD1 (Cell Signaling, catalog #4147)", "tag": "attribute" } ], "drug treatment": [ { "text": "GSI-mock-washout", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Rec-1 cell line", "tag": "attribute" } ], "title": [ { "text": "Rec-1_NICD1_gsi-gsi-r1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06701880", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-07T18:11:22.290Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06701880" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06701880{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06701880/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06701880/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06701880" } } }, { "name": "GSM2573025", "accession": "SAMN06706268", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-31T00:00:00Z", "update": "2022-03-30T03:11:43.271Z", "submitted": "2017-04-10T17:06:08.443Z", "characteristics": { "External Id": [ { "text": "SAMN06706268", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mark Ptashne, Molecular Biology Program, Sloan Kettering Institute" } ], "INSDC first public": [ { "text": "2017-08-31T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2120098" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2120098" } ], "cell line": [ { "text": "MRC5 fibroblast", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Abcam ab8580 Lot: GR240214-2)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "8", "tag": "attribute" } ], "protocol": [ { "text": "Oct4, Sox2 and Klf4 addition", "tag": "attribute" } ], "source_name": [ { "text": "MRC5 Day 5 after OSK rep1", "tag": "attribute" } ], "time": [ { "text": "5 days", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000033" ], "tag": "attribute" } ], "title": [ { "text": "OSK_rep1_H3K4me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06706268", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-10T17:06:08.443Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706268" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706268{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706268/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706268/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06706268" } } }, { "name": "GSM2573751", "accession": "SAMN06706912", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-05-28T00:00:00Z", "update": "2022-03-30T03:11:54.830Z", "submitted": "2017-04-11T09:36:06.123Z", "characteristics": { "External Id": [ { "text": "SAMN06706912", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kennedy Krieger Institute" } ], "INSDC first public": [ { "text": "2017-05-28T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2120349" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2120349" } ], "cell type": [ { "text": "Human glioblastoma cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85045" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "in vitro for a long time", "tag": "attribute" } ], "source_name": [ { "text": "Human glioblastoma cells", "tag": "attribute" } ], "tissue": [ { "text": "Brain", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000955" ], "tag": "attribute" } ], "title": [ { "text": "H3K27me3_ChIP-seq for WT at 0hr" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN06706912", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-04-11T09:36:06.123Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706912" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706912{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706912/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN06706912/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN06706912" } } }, { "name": "GSM2661807", "accession": "SAMN07210947", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-09-30T00:00:00Z", "update": "2022-03-30T05:27:30.160Z", "submitted": "2017-06-09T16:27:04.813Z", "characteristics": { "External Id": [ { "text": "SAMN07210947", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Research Division, Hospital for special surgery" } ], "INSDC first public": [ { "text": "2017-09-30T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2267454" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2267454" } ], "antibody": [ { "text": "pS469-GRIP1", "tag": "attribute" } ], "cell line": [ { "text": "THP1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001253" ], "tag": "attribute" } ], "cell type": [ { "text": "macrophage", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000235" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "THP1 MΦ", "tag": "attribute" } ], "tissue": [ { "text": "peripheral blood-derived", "tag": "attribute" } ], "title": [ { "text": "THP1 MΦ, pS469-GRIP1(Ncoa2), Dex, 100nm, 1hour, rep 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07210947", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-06-09T16:27:04.813Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07210947" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07210947{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07210947/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07210947/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07210947" } } }, { "name": "GSM2676806", "accession": "SAMN07258791", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-08-22T00:00:00Z", "update": "2022-03-30T05:44:10.725Z", "submitted": "2017-06-20T14:51:07.750Z", "characteristics": { "External Id": [ { "text": "SAMN07258791", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gladstone Institutes" } ], "INSDC first public": [ { "text": "2017-08-22T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2299133" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2299133" } ], "chip antibody": [ { "text": "Abcam ab110641", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "J-Lat A72", "tag": "attribute" } ], "title": [ { "text": "2_DMSO_BRG1" } ], "treatment": [ { "text": "DMSO", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07258791", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-06-20T14:51:07.750Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07258791" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07258791{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07258791/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07258791/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07258791" } } }, { "name": "GSM2683110", "accession": "SAMN07274458", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-06-24T00:00:00Z", "update": "2022-03-30T05:48:19.703Z", "submitted": "2017-06-23T21:11:02.620Z", "characteristics": { "External Id": [ { "text": "SAMN07274458", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2017-06-24T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2311954" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2311954" } ], "cell line": [ { "text": "WM164", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002390" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 Active motif (39159)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "WM164 melanoma cells", "tag": "attribute" } ], "title": [ { "text": "H3K4me3 WM164 Dabrafenib (D2)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07274458", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-06-23T21:11:02.620Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07274458" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07274458{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07274458/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07274458/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07274458" } } }, { "name": "GSM2735382", "accession": "SAMN07460479", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-09-27T00:00:00Z", "update": "2022-03-30T06:49:45.961Z", "submitted": "2017-08-08T08:21:03.040Z", "characteristics": { "External Id": [ { "text": "SAMN07460479", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Yarden, Biological Regulation, Weizmann Institute of Science" } ], "INSDC first public": [ { "text": "2019-09-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-09-27T17:57:18.783Z" } ], "INSDC secondary accession": [ { "text": "SRS2414837" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2414837" } ], "cell line": [ { "text": "MCF10A", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001200" ], "tag": "attribute" } ], "chip antibody": [ { "text": "rabbit anti-GR polyclonal antibody (Thermo Fisher Scientific, PA1-511A)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MCF10A_EGF + DEX_60 min", "tag": "attribute" } ], "title": [ { "text": "gr-ed60-1" } ], "treated with": [ { "text": "EGF + DEX", "tag": "attribute" } ], "treatment time": [ { "text": "60 min", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07460479", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-08-08T08:21:03.040Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07460479" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07460479{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07460479/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07460479/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07460479" } } }, { "name": "GSM2746616", "accession": "SAMN07518904", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-14T00:00:00Z", "update": "2022-03-30T07:08:35.083Z", "submitted": "2017-08-18T09:01:06.230Z", "characteristics": { "External Id": [ { "text": "SAMN07518904", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-08-14T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2438437" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2438437" } ], "cell line": [ { "text": "clear cell renal cell carcinoma cell line 786-O", "tag": "attribute" } ], "chip antibody": [ { "text": "Abcam H3K4me1 rabbit polyclonal ab (ab8895) - 3 ug (lot# GR141677-4)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "shrna": [ { "text": "off-target control", "tag": "attribute" } ], "source_name": [ { "text": "clear cell renal cell carcinoma cell line", "tag": "attribute" } ], "title": [ { "text": "786_control_H3K4me1_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07518904", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-08-18T09:01:06.230Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07518904" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07518904{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07518904/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07518904/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07518904" } } }, { "name": "GSM2779867", "accession": "SAMN07633311", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-09-12T00:00:00Z", "update": "2022-03-30T07:52:52.805Z", "submitted": "2017-09-12T08:31:18.747Z", "characteristics": { "External Id": [ { "text": "SAMN07633311", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-09-12T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2507897" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2507897" } ], "cell type": [ { "text": "Huh-7.5", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005384" ], "tag": "attribute" } ], "chip antibody": [ { "text": "ChIPAb Trimethyl-Histone H3 (Lys-4) 17-614 (Millipore)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "liver", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002107" ], "tag": "attribute" } ], "tissue": [ { "text": "liver", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002107" ], "tag": "attribute" } ], "title": [ { "text": "H3K4Me3 ChIP-seq from HCV infected cells repeat 1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07633311", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-09-12T08:31:18.747Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07633311" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07633311{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07633311/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07633311/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07633311" } } }, { "name": "GSM2806165", "accession": "SAMN07757284", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-03-08T00:00:00Z", "update": "2022-03-30T08:42:38.173Z", "submitted": "2017-10-06T15:01:22.420Z", "characteristics": { "External Id": [ { "text": "SAMN07757284", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zaret Lab, Cell & Developmental Biology, The University of Pennsylvania" } ], "INSDC first public": [ { "text": "2018-03-08T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2571098" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2571098" } ], "antibody": [ { "text": "Millipore, #07-329", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "lateral temporal lobe", "tag": "attribute" } ], "study group": [ { "text": "Old", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0007222" ], "tag": "attribute" } ], "tissue": [ { "text": "lateral temporal lobe", "tag": "attribute" } ], "title": [ { "text": "14-7A.H4K16ac.Old" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07757284", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-10-06T15:01:22.420Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07757284" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07757284{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07757284/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07757284/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07757284" } } }, { "name": "GSM2825179", "accession": "SAMN07815081", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-10-20T00:00:00Z", "update": "2022-03-30T09:07:29.944Z", "submitted": "2017-10-19T17:16:07.030Z", "characteristics": { "External Id": [ { "text": "SAMN07815081", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Helmholtz Center Munich" } ], "INSDC first public": [ { "text": "2017-10-20T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2610317" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2610317" } ], "cell line": [ { "text": "H9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0003045" ], "tag": "attribute" } ], "chip antibody": [ { "text": "anti-H3K27me3 (C15410069; LotNr: A1821D; Diagenode)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "trophoblast progenitors at day 2.5", "tag": "attribute" } ], "title": [ { "text": "H3K27me3 ChIP from APA-positive trophoblast progenitors, biological replicate 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN07815081", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-10-19T17:16:07.030Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07815081" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07815081{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07815081/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN07815081/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN07815081" } } }, { "name": "GSM2863698", "accession": "SAMN08057878", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-22T00:00:00Z", "update": "2022-03-30T10:54:10.779Z", "submitted": "2017-11-22T15:11:32.123Z", "characteristics": { "External Id": [ { "text": "SAMN08057878", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "231, cancer genetics, IIB" } ], "INSDC first public": [ { "text": "2019-07-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-22T01:16:32.810Z" } ], "INSDC secondary accession": [ { "text": "SRS2710374" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2710374" } ], "cell type": [ { "text": "colonic organoids", "tag": "attribute" } ], "chip antibody": [ { "text": "rabbit-monoclonal VDR antibody (Cell Signalling, custom made 2 mg/mL, MA, USA)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "0-5", "tag": "attribute" } ], "source_name": [ { "text": "Colonic Stem cell enriched culture", "tag": "attribute" } ], "strain": [ { "text": "primary culture", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002660" ], "tag": "attribute" } ], "title": [ { "text": "ChIP8.Cont" } ], "treatment": [ { "text": "EtOH", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_16236" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08057878", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-11-22T15:11:32.123Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08057878" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08057878{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08057878/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08057878/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08057878" } } }, { "name": "GSM2871863", "accession": "SAMN08118233", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-07-15T00:00:00Z", "update": "2022-03-30T11:20:31.594Z", "submitted": "2017-12-01T13:46:18.313Z", "characteristics": { "External Id": [ { "text": "SAMN08118233", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cell Stress Biology, Roswell Park Cancer Institute" } ], "INSDC first public": [ { "text": "2021-07-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-07-15T01:30:19.423Z" } ], "INSDC secondary accession": [ { "text": "SRS2727512" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2727512" } ], "cell line": [ { "text": "HT1080", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002059" ], "tag": "attribute" } ], "chip antibody": [ { "text": "SSRP1 antibody", "tag": "attribute" } ], "chip antibody clone": [ { "text": "10D1", "tag": "attribute" } ], "chip antibody vendor": [ { "text": "BioLegend", "tag": "attribute" } ], "concentration": [ { "text": "3uM", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HT1080_CBL0137", "tag": "attribute" } ], "time of treatment": [ { "text": "1.5 hr", "tag": "attribute" } ], "title": [ { "text": "CBL0137 replicate 1" } ], "treated with": [ { "text": "CBL0137", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08118233", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-01T13:46:18.313Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08118233" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08118233{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08118233/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08118233/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08118233" } } }, { "name": "GSM2877305", "accession": "SAMN08138333", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2017-12-07T00:00:00Z", "update": "2022-03-30T11:26:24.657Z", "submitted": "2017-12-06T10:46:13.720Z", "characteristics": { "External Id": [ { "text": "SAMN08138333", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Washington University School of Medicine" } ], "INSDC first public": [ { "text": "2017-12-07T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2739266" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2739266" } ], "cell type": [ { "text": "JMSU-1", "tag": "attribute" } ], "chip antibody": [ { "text": "RXRA (Perseus Proteomics, K8508, lot A2)", "tag": "attribute" } ], "genotype": [ { "text": "RXRA S427F", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "bladder cancer cells", "tag": "attribute" } ], "title": [ { "text": "RXRA_S427F_Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08138333", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-06T10:46:13.720Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08138333" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08138333{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08138333/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08138333/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08138333" } } }, { "name": "GSM2890242", "accession": "SAMN08178704", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-16T00:00:00Z", "update": "2022-03-30T11:39:00.876Z", "submitted": "2017-12-14T18:56:11.960Z", "characteristics": { "External Id": [ { "text": "SAMN08178704", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology, St Jude Children's Research Hosipital" } ], "INSDC first public": [ { "text": "2019-02-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-16T01:25:22.440Z" } ], "INSDC secondary accession": [ { "text": "SRS2758993" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2758993" } ], "cell line": [ { "text": "derived from H9 (day 17)", "tag": "attribute" } ], "cell type": [ { "text": "Human Neuron Cell D17", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac(ActiveMotif,39133)", "tag": "attribute" } ], "genotype/variation": [ { "text": "53BP1 KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell Line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "title": [ { "text": "H3K27ac-53BP1KOneuronD17 replicate 1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08178704", "duo": [] } ], "submittedVia": "JSON_API", "create": "2017-12-14T18:56:11.960Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08178704" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08178704{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08178704/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08178704/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08178704" } } }, { "name": "GSM2915363", "accession": "SAMN08326919", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-01-17T00:00:00Z", "update": "2022-03-30T12:25:37.210Z", "submitted": "2018-01-08T14:05:02.537Z", "characteristics": { "External Id": [ { "text": "SAMN08326919", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-01-17T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2818237" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2818237" } ], "cell type": [ { "text": "airway epithelial cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Qiagen, GAH-8208)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "15-18", "tag": "attribute" } ], "source_name": [ { "text": "Calu3 cells", "tag": "attribute" } ], "title": [ { "text": "MERS_H3K4me3_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08326919", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-08T14:05:02.537Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08326919" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08326919{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08326919/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08326919/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08326919" } } }, { "name": "GSM2929025", "accession": "SAMN08348543", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-08-22T00:00:00Z", "update": "2022-03-30T12:30:25.069Z", "submitted": "2018-01-11T06:56:11.800Z", "characteristics": { "External Id": [ { "text": "SAMN08348543", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Case Western Reserve Uni" } ], "INSDC first public": [ { "text": "2018-08-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-08-22T01:16:41.933Z" } ], "INSDC secondary accession": [ { "text": "SRS2853234" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS2853234" } ], "cell type": [ { "text": "Primary human epididymis cells", "tag": "attribute" } ], "chip antibody": [ { "text": "AR (Santa Cruz Biotechnology sc-815x)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Epididymis", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001301" ], "tag": "attribute" } ], "title": [ { "text": "AR_VC_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08348543", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-11T06:56:11.800Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08348543" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08348543{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08348543/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08348543/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08348543" } } }, { "name": "GSM2931701", "accession": "SAMN08354857", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-06-07T00:00:00Z", "update": "2022-03-30T12:32:47.472Z", "submitted": "2018-01-11T13:21:03.887Z", "characteristics": { "External Id": [ { "text": "SAMN08354857", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Didier Picard's Laboratory, Cell Biology- Science 3, University of Genéve" } ], "INSDC first public": [ { "text": "2018-06-07T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2827771" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2827771" } ], "cell line": [ { "text": "MDA-MB-134", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001205" ], "tag": "attribute" } ], "cell type": [ { "text": "Epithelial ERalpha positive breast cancer cell line", "tag": "attribute" } ], "chip antibodies": [ { "text": "pCREB1 (Cell Signalling Technology, 87G3, lot 14)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "between 10 and 12", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MONDO_0004975" ], "tag": "attribute" } ], "source_name": [ { "text": "pCREB1 E2 ChIP-seq", "tag": "attribute" } ], "title": [ { "text": "pCREB1 E2 ChIP-seq replicate 1" } ], "treated with": [ { "text": "100 nM estradiol (E2) for 1hr", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08354857", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-11T13:21:03.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08354857" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08354857{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08354857/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08354857/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08354857" } } }, { "name": "GSM2942522", "accession": "SAMN08378922", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-04-18T00:00:00Z", "update": "2022-03-30T12:45:25.383Z", "submitted": "2018-01-19T09:36:11.983Z", "characteristics": { "External Id": [ { "text": "SAMN08378922", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biomedical Informatics, The Ohio State University" } ], "INSDC first public": [ { "text": "2018-04-18T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS2859605" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS2859605" } ], "cell type": [ { "text": "Primary B-CLL cells", "tag": "attribute" } ], "chip antibody": [ { "text": "BRD4 (Active Motif #A301-985A1)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "protocol": [ { "text": "baseline", "tag": "attribute" } ], "source_name": [ { "text": "B-Chronic Lymphocytic Leukemia (CLL) cels", "tag": "attribute" } ], "title": [ { "text": "BRD4_ChIPseq_4a" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08378922", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-01-19T09:36:11.983Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08378922" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08378922{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08378922/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08378922/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08378922" } } }, { "name": "GSM3027218", "accession": "SAMN08623595", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-02T00:00:00Z", "update": "2022-03-30T14:26:38.295Z", "submitted": "2018-02-28T12:56:14.900Z", "characteristics": { "External Id": [ { "text": "SAMN08623595", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Science Institute Singapore, National University of Singapore" } ], "INSDC first public": [ { "text": "2019-04-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-02T01:15:18.360Z" } ], "INSDC secondary accession": [ { "text": "SRS3007976" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3007976" } ], "cell type": [ { "text": "liposarcoma cells", "tag": "attribute" } ], "chip antibody": [ { "text": "RNAPol2 (Santa Cruz, #sc-899X)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "LPS141", "tag": "attribute" } ], "title": [ { "text": "LPS141_RNAPol2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08623595", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-02-28T12:56:14.900Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08623595" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08623595{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08623595/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08623595/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08623595" } } }, { "name": "GSM3041099", "accession": "SAMN08713072", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-24T00:00:00Z", "update": "2022-03-30T15:09:55.101Z", "submitted": "2018-03-14T16:46:24.590Z", "characteristics": { "External Id": [ { "text": "SAMN08713072", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Evseenko Lab, Orthopaedic Surgery, Universityof California Los Angeles" } ], "INSDC first public": [ { "text": "2019-04-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-24T02:02:24.087Z" } ], "INSDC secondary accession": [ { "text": "SRS3044420" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3044420" } ], "cell type": [ { "text": "Chondrocytes", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000138" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3, Diagenode, C15410195", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Embryonic stem cell-derived chondrocytes - day 14", "tag": "attribute" } ], "title": [ { "text": "H1-14d_rep3_H3K27me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08713072", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-03-14T16:46:24.590Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08713072" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08713072{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08713072/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08713072/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08713072" } } }, { "name": "GSM3067923", "accession": "SAMN08796151", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-27T00:00:00Z", "update": "2022-03-30T15:37:54.535Z", "submitted": "2018-03-26T13:58:03.073Z", "characteristics": { "External Id": [ { "text": "SAMN08796151", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tan Lab, Department of Oncology, Children's Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2019-03-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-27T01:22:22.713Z" } ], "INSDC secondary accession": [ { "text": "SRS3092543" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3092543" } ], "cell type": [ { "text": "Effector memory TREG cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam, ab4729)", "tag": "attribute" } ], "disease state": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "individual": [ { "text": "C14", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Effector memory TREG cells", "tag": "attribute" } ], "tissue": [ { "text": "Peripheral Blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "C14_Treg_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08796151", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-03-26T13:58:03.073Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08796151" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08796151{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08796151/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08796151/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08796151" } } }, { "name": "GSM3073930", "accession": "SAMN08833129", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-27T00:00:00Z", "update": "2022-03-30T15:51:11.037Z", "submitted": "2018-04-02T16:27:15.453Z", "characteristics": { "External Id": [ { "text": "SAMN08833129", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Shilatifard Lab, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine" } ], "INSDC first public": [ { "text": "2018-10-27T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3114951" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3114951" } ], "antibody": [ { "text": "homemade AFF1CT", "tag": "attribute" } ], "cell type": [ { "text": "small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "mutation": [ { "text": "MYC amplifcation", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H2171", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002282" ], "tag": "attribute" } ], "title": [ { "text": "AFF1_H2171_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08833129", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-04-02T16:27:15.453Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08833129" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08833129{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08833129/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08833129/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08833129" } } }, { "name": "GSM3111111", "accession": "SAMN08982205", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-08-19T00:00:00Z", "update": "2022-03-30T16:52:10.842Z", "submitted": "2018-04-25T15:37:09.440Z", "characteristics": { "External Id": [ { "text": "SAMN08982205", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mathieu Lupien, Medical Biophysics, University Health Network, University of Toronto" } ], "INSDC first public": [ { "text": "2020-08-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-08-19T01:20:22.370Z" } ], "INSDC secondary accession": [ { "text": "SRS3219874" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3219874" } ], "agent": [ { "text": "paclitaxel", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_45863" ], "tag": "attribute" } ], "antibody": [ { "text": "H3K27ac (Abcam Ab4729)", "tag": "attribute" } ], "cell line": [ { "text": "MDA-MB-436", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001214" ], "tag": "attribute" } ], "cell type": [ { "text": "TNBC", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "paclitaxel sensitivity": [ { "text": "Taxol-resistant", "tag": "attribute" } ], "replicate": [ { "text": "GD_ChIP_22", "tag": "attribute" } ], "source_name": [ { "text": "MDA-MB-436", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001214" ], "tag": "attribute" } ], "title": [ { "text": "Human_436_20B_2_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN08982205", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-04-25T15:37:09.440Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982205" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982205{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982205/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN08982205/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN08982205" } } }, { "name": "GSM3146369", "accession": "SAMN09223825", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-15T00:00:00Z", "update": "2022-03-30T18:36:09.942Z", "submitted": "2018-05-18T11:16:05.577Z", "characteristics": { "External Id": [ { "text": "SAMN09223825", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "State Key Laboratory of Medical Genomics, Shanghai Institute of Hematology, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine" } ], "INSDC first public": [ { "text": "2018-12-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-12-15T02:47:23.550Z" } ], "INSDC secondary accession": [ { "text": "SRS3315833" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3315833" } ], "cell line": [ { "text": "Kasumi-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006607" ], "tag": "attribute" } ], "cell type": [ { "text": "leukemic cell line with an 8;21 chromosome translocation", "tag": "attribute" } ], "chip antibody": [ { "text": "HA-Tag (C29F4) Rabbit mAb (CST #3724)", "tag": "attribute" } ], "genotype/variation": [ { "text": "overexpress E2A", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "4-5 passages", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MP_0001914" ], "tag": "attribute" } ], "source_name": [ { "text": "Myeloblast", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000835" ], "tag": "attribute" } ], "title": [ { "text": "E2A_ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09223825", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-18T11:16:05.577Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09223825" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09223825{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09223825/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09223825/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09223825" } } }, { "name": "GSM3152774", "accession": "SAMN09254222", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-14T00:00:00Z", "update": "2023-05-17T22:57:32.605Z", "submitted": "2018-05-24T12:16:03.887Z", "characteristics": { "External Id": [ { "text": "SAMN09254222", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Departement of Biomedicine, University of Basel" } ], "INSDC first public": [ { "text": "2023-04-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-14T01:16:26.360Z" } ], "INSDC secondary accession": [ { "text": "SRS3335538" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3335538" } ], "cell line": [ { "text": "SUM159PT", "tag": "attribute" } ], "cell type": [ { "text": "Breast cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-H3K27ac (ab4729, Abcam)", "tag": "attribute" } ], "genotype": [ { "text": "KOD", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "REP1", "tag": "attribute" } ], "source_name": [ { "text": "SUM159PT", "tag": "attribute" } ], "title": [ { "text": "H3K27AC_KOD1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN09254222", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2018-05-24T12:16:03.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09254222" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09254222{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09254222/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09254222/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09254222" } } }, { "name": "GSM3165641", "accession": "SAMN09284051", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-06-22T00:00:00Z", "update": "2022-03-30T19:03:33.320Z", "submitted": "2018-05-30T15:41:14.543Z", "characteristics": { "External Id": [ { "text": "SAMN09284051", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cold Spring Harbor Laboratory" } ], "INSDC first public": [ { "text": "2018-06-22T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3356784" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3356784" } ], "cell line": [ { "text": "NCI-H211", "tag": "attribute" } ], "cell type": [ { "text": "Small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (abcam ab4729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "title": [ { "text": "H211_2_H3K27ac" } ], "treatment": [ { "text": "exponentially growing cells with no infection", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09284051", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-05-30T15:41:14.543Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09284051" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09284051{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09284051/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09284051/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09284051" } } }, { "name": "GSM3189491", "accession": "SAMN09407805", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-25T00:00:00Z", "update": "2022-03-30T19:37:02.191Z", "submitted": "2018-06-13T14:26:16.150Z", "characteristics": { "External Id": [ { "text": "SAMN09407805", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gothenburg university" } ], "INSDC first public": [ { "text": "2019-06-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-25T01:47:17.440Z" } ], "INSDC secondary accession": [ { "text": "SRS3415292" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3415292" } ], "chip antibody": [ { "text": "EZH2 Ab", "tag": "attribute" } ], "ngs seq": [ { "text": "ChIP seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002692" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Peripheral blood mononuclear cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "title": [ { "text": "CLLM2-EZH2-Ab" } ], "tumor classification": [ { "text": "IGHV Mutated CLL", "tag": "attribute" } ], "tumor type": [ { "text": "Chronic lymphocytic leukemia", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000095" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09407805", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-13T14:26:16.150Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09407805" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09407805{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09407805/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09407805/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09407805" } } }, { "name": "GSM3191790", "accession": "SAMN09429098", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-12-15T00:00:00Z", "update": "2022-03-30T19:50:37.092Z", "submitted": "2018-06-15T10:21:09.930Z", "characteristics": { "External Id": [ { "text": "SAMN09429098", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jun Song Lab, Department of Physics, University of Illinois" } ], "INSDC first public": [ { "text": "2018-12-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2018-12-15T02:39:20.720Z" } ], "INSDC secondary accession": [ { "text": "SRS3421447" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3421447" } ], "antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sirna": [ { "text": "siSCR", "tag": "attribute" } ], "source_name": [ { "text": "Melanocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000148" ], "tag": "attribute" } ], "title": [ { "text": "ChIP-seq H3K4me3 Melanocyte siSCR" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09429098", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-15T10:21:09.930Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09429098" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09429098{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09429098/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09429098/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09429098" } } }, { "name": "GSM3192297", "accession": "SAMN09430901", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-19T00:00:00Z", "update": "2022-03-30T19:51:50.319Z", "submitted": "2018-06-15T15:14:13.950Z", "characteristics": { "External Id": [ { "text": "SAMN09430901", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Developmental Neurology, St Jude Children's Research Hospital" } ], "INSDC first public": [ { "text": "2019-03-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-19T01:23:21.743Z" } ], "INSDC secondary accession": [ { "text": "SRS3422551" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3422551" } ], "cell source": [ { "text": "in vivo xenograft dissected from mouse brain", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3 (Millipore, 07-449)", "tag": "attribute" } ], "experiment id": [ { "text": "X7_in_vivo_2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "shRNA backbone": [ { "text": "miR30", "tag": "attribute" } ], "shRNA id": [ { "text": "non silencing shRNA", "tag": "attribute" } ], "source_name": [ { "text": "SJ-DIPGx7 (PDX)", "tag": "attribute" } ], "title": [ { "text": "X7a-10_Ctl_H3K27me3_ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09430901", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-15T15:14:13.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09430901" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09430901{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09430901/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09430901/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09430901" } } }, { "name": "GSM3229508", "accession": "SAMN09501694", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-17T00:00:00Z", "update": "2022-03-30T20:32:46.015Z", "submitted": "2018-06-27T13:20:14.427Z", "characteristics": { "External Id": [ { "text": "SAMN09501694", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Javed Khan, Genetics Branch, NCI, NIH" } ], "INSDC first public": [ { "text": "2019-07-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-17T01:36:24.503Z" } ], "INSDC secondary accession": [ { "text": "SRS3472414" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3472414" } ], "antibody": [ { "text": "Rad21 (Santa Cruz, ChIP Grade ab992)", "tag": "attribute" } ], "cell line": [ { "text": "RH4", "tag": "attribute" } ], "enrichment target": [ { "text": "RAD21", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RH4", "tag": "attribute" } ], "target function": [ { "text": "Cohesin Complex", "tag": "attribute" } ], "title": [ { "text": "RH4 D6 RAD21 Rep2" } ], "treatment": [ { "text": "DMSO, 6 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09501694", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-06-27T13:20:14.427Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09501694" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09501694{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09501694/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09501694/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09501694" } } }, { "name": "GSM3307898", "accession": "SAMN09724723", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-03-11T00:00:00Z", "update": "2022-03-30T21:39:07.355Z", "submitted": "2018-07-26T14:16:02.923Z", "characteristics": { "External Id": [ { "text": "SAMN09724723", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Kadoch Lab, Pediatric Oncology, Dana Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2019-03-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-03-11T01:32:29.660Z" } ], "INSDC secondary accession": [ { "text": "SRS3599045" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3599045" } ], "cell line": [ { "text": "BIN-67", "tag": "attribute" } ], "chip antibody": [ { "text": "ARID2 (CST, D8D8U)", "tag": "attribute" } ], "lentivirus": [ { "text": "SMARCA4.T910M", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BIN-67 (SCCOHT)", "tag": "attribute" } ], "title": [ { "text": "BIN-67_ARID2_SMARCA4.T910M_ChIP-Seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09724723", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-07-26T14:16:02.923Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09724723" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09724723{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09724723/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09724723/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09724723" } } }, { "name": "GSM3314496", "accession": "SAMN09742271", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-24T00:00:00Z", "update": "2022-03-30T21:44:35.191Z", "submitted": "2018-07-30T16:30:03.033Z", "characteristics": { "External Id": [ { "text": "SAMN09742271", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Medical School, Nanjing University" } ], "INSDC first public": [ { "text": "2021-05-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-24T01:29:16.873Z" } ], "INSDC secondary accession": [ { "text": "SRS3611932" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3611932" } ], "chip antibody": [ { "text": "Santa Cruz, sc1003", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "human podocyte", "tag": "attribute" } ], "tissue": [ { "text": "podocyte", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000653" ], "tag": "attribute" } ], "title": [ { "text": "GR-ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN09742271", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-07-30T16:30:03.033Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09742271" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09742271{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09742271/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09742271/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09742271" } } }, { "name": "GSM3319929", "accession": "SAMN09768731", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-31T00:00:00Z", "update": "2022-03-30T21:52:38.344Z", "submitted": "2018-08-06T10:15:03.860Z", "characteristics": { "External Id": [ { "text": "SAMN09768731", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biology, Indiana University" } ], "INSDC first public": [ { "text": "2019-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-31T05:10:57.610Z" } ], "INSDC secondary accession": [ { "text": "SRS3630128" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3630128" } ], "cell cycle stage": [ { "text": "Mixed (asynchronous)", "tag": "attribute" } ], "cell line": [ { "text": "MDA-MB-435 melanoma cells", "tag": "attribute" } ], "chip antibody": [ { "text": "rabbit anti-CTCF (Millipore 07-729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Asynchronous pan-CTCF ChIP-seq", "tag": "attribute" } ], "title": [ { "text": "Asynchronous pan-CTCF ChIP-seq replicate 1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09768731", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-06T10:15:03.860Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09768731" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09768731{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09768731/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09768731/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09768731" } } }, { "name": "GSM3328071", "accession": "SAMN09802019", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-08-07T00:00:00Z", "update": "2022-03-30T22:03:16.636Z", "submitted": "2018-08-10T12:56:10.293Z", "characteristics": { "External Id": [ { "text": "SAMN09802019", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Science Institute Singapore, National University of Singapore" } ], "INSDC first public": [ { "text": "2019-08-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-08-07T01:59:17.027Z" } ], "INSDC secondary accession": [ { "text": "SRS3647704" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3647704" } ], "cell line": [ { "text": "HEYA8", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3 (07-449, Millipore)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Ovarian cancer cell line", "tag": "attribute" } ], "title": [ { "text": "HEYA8 with H3K27me3 ChIP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09802019", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-10T12:56:10.293Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09802019" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09802019{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09802019/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09802019/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09802019" } } }, { "name": "GSM3357691", "accession": "SAMN09917808", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-09-27T00:00:00Z", "update": "2022-03-30T22:43:40.143Z", "submitted": "2018-08-27T13:21:08.797Z", "characteristics": { "External Id": [ { "text": "SAMN09917808", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Meiyu Geng, Antitumor Pharmacology, Shanghai Institute of Materia Medica" } ], "INSDC first public": [ { "text": "2018-09-27T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3717783" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3717783" } ], "cell strain": [ { "text": "SMMC-7721", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Active Motif, 39133, lot 31814008)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Hepatocellular carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000182" ], "tag": "attribute" } ], "title": [ { "text": "SMMC-7721_H3K27ac_ChIPSeq_DMSO" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN09917808", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-08-27T13:21:08.797Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09917808" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09917808{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09917808/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09917808/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09917808" } } }, { "name": "GSM3358131", "accession": "SAMN09924997", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-03T00:00:00Z", "update": "2022-03-30T22:47:21.872Z", "submitted": "2018-08-27T17:41:33.480Z", "characteristics": { "External Id": [ { "text": "SAMN09924997", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Abdel-Wahab, HOPP, MSKCC" } ], "INSDC first public": [ { "text": "2019-05-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-03T03:14:39.750Z" } ], "INSDC secondary accession": [ { "text": "SRS3718578" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3718578" } ], "antibody": [ { "text": "h3k9me3", "tag": "attribute" } ], "cell type": [ { "text": "CLL IGHV unmutated", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CLL", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000095" ], "tag": "attribute" } ], "tissue": [ { "text": "Peripheral Blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "cll_vs_h3k9me3_bam" } ] }, "submittedVia": "JSON_API", "create": "2018-08-27T17:41:33.480Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09924997" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09924997{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09924997/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN09924997/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN09924997" } } }, { "name": "GSM3401076", "accession": "SAMN10128010", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-15T00:00:00Z", "update": "2022-03-31T00:03:02.333Z", "submitted": "2018-09-25T14:01:10.770Z", "characteristics": { "External Id": [ { "text": "SAMN10128010", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Epigenetics Laboratory, GW Cancer Center, George Washington University" } ], "INSDC first public": [ { "text": "2020-04-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-15T01:50:18.830Z" } ], "INSDC secondary accession": [ { "text": "SRS3819921" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3819921" } ], "cell line": [ { "text": "PANC1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002713" ], "tag": "attribute" } ], "cell type": [ { "text": "human pancreatic cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "Ubiquityl-Histone H2A (Lys119) (D27C4), Cell Signaling Technology, Cat# 8240, RRID:AB_10891618", "tag": "attribute" } ], "input used for data normalization": [ { "text": "Input#1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005031" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "pancreas", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001264" ], "tag": "attribute" } ], "title": [ { "text": "PANC1_H2AK119Ub_IR" } ], "treatment": [ { "text": "10Gy of ionizing irradiation", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10128010", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-09-25T14:01:10.770Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10128010" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10128010{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10128010/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10128010/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10128010" } } }, { "name": "GSM3403678", "accession": "SAMN10138840", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-31T00:00:00Z", "update": "2022-03-31T00:07:21.991Z", "submitted": "2018-09-27T14:23:54.887Z", "characteristics": { "External Id": [ { "text": "SAMN10138840", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular pathology, Institute of biomedicine and translational medicine, University of Tartu" } ], "INSDC first public": [ { "text": "2019-05-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-31T02:18:10.463Z" } ], "INSDC secondary accession": [ { "text": "SRS3854474" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3854474" } ], "cell type": [ { "text": "PBMC", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Millipore, catalog# 07-473, lot# 2930138)", "tag": "attribute" } ], "genotype": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "individual": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PBMC", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_2000001" ], "tag": "attribute" } ], "title": [ { "text": "control1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ] } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10138840", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-09-27T14:23:54.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10138840" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10138840{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10138840/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10138840/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10138840" } } }, { "name": "GSM3408271", "accession": "SAMN10148309", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-29T00:00:00Z", "update": "2022-03-31T00:12:11.344Z", "submitted": "2018-10-01T10:01:14.320Z", "characteristics": { "External Id": [ { "text": "SAMN10148309", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "CIC bioGUNE" } ], "INSDC first public": [ { "text": "2021-09-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-30T20:20:28.267Z" } ], "INSDC secondary accession": [ { "text": "SRS3860380" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3860380" } ], "cell line": [ { "text": "ST88-14", "tag": "attribute" } ], "cell type": [ { "text": "NF1-derived MPNST", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-Histone H3, monomethyl (Lys4) Rabbit polyclonal, Abcam, Cat# ab8895", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cancer cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001639" ], "tag": "attribute" } ], "title": [ { "text": "ST88 cell, H3K4me1 ChIP, sh HuR#1, number 3" } ], "treatment": [ { "text": "sh HuR", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN10148309", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-01T10:01:14.320Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10148309" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10148309{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10148309/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10148309/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10148309" } } }, { "name": "GSM3408928", "accession": "SAMN10150529", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-07-23T00:00:00Z", "update": "2022-03-31T00:13:05.919Z", "submitted": "2018-10-01T17:23:09.600Z", "characteristics": { "External Id": [ { "text": "SAMN10150529", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biochemistry and Molecular Genetics, American University of Beirut" } ], "INSDC first public": [ { "text": "2019-07-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-07-23T03:07:09.163Z" } ], "INSDC secondary accession": [ { "text": "SRS3861718" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3861718" } ], "cell type": [ { "text": "Biphenotypic B Myelomonocytic Leukemia", "tag": "attribute" } ], "chip antibody": [ { "text": "BRD2 (Bethyl Labs #A302-583A)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "AML cells", "tag": "attribute" } ], "title": [ { "text": "BRD2_ChIPSeq_IBET151_500nM_MV4;11_rep1" } ] }, "submittedVia": "JSON_API", "create": "2018-10-01T17:23:09.600Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10150529" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10150529{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10150529/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10150529/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10150529" } } }, { "name": "GSM3409893", "accession": "SAMN10160937", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-10-03T00:00:00Z", "update": "2022-03-31T00:17:31.036Z", "submitted": "2018-10-02T09:00:23.340Z", "characteristics": { "External Id": [ { "text": "SAMN10160937", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Pathology, Netherlands Cancer Institute" } ], "INSDC first public": [ { "text": "2018-10-03T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3869888" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3869888" } ], "case/control": [ { "text": "Control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3 (Active Motif, catalog# 39155, lot# 31814017)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient id": [ { "text": "P509T", "ontologyTerms": [ "http://identifiers.org/medgen/C4017280" ], "tag": "attribute" } ], "source_name": [ { "text": "primary prostate cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001663" ], "tag": "attribute" } ], "tissue": [ { "text": "primary prostate cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001663" ], "tag": "attribute" } ], "title": [ { "text": "P509T_H3K27me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10160937", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-02T09:00:23.340Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10160937" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10160937{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10160937/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10160937/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10160937" } } }, { "name": "GSM3425380", "accession": "SAMN10228273", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2018-11-13T00:00:00Z", "update": "2022-03-31T00:39:45.393Z", "submitted": "2018-10-10T12:06:11.517Z", "characteristics": { "External Id": [ { "text": "SAMN10228273", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2018-11-13T00:00:00Z" } ], "INSDC secondary accession": [ { "text": "SRS3898393" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "SRA accession": [ { "text": "SRS3898393" } ], "antibody": [ { "text": "H3K4me3 (ab8580, Abcam)", "tag": "attribute" } ], "cell line": [ { "text": "NALM6", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002245" ], "tag": "attribute" } ], "cell type": [ { "text": "B-ALL cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NALM6", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002245" ], "tag": "attribute" } ], "title": [ { "text": "NALM6_H3K4ME3" } ], "treatment": [ { "text": "Vehicle", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000732" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10228273", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-10T12:06:11.517Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10228273" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10228273{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10228273/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10228273/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10228273" } } }, { "name": "GSM3438290", "accession": "SAMN10258646", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-30T00:00:00Z", "update": "2022-03-31T01:00:51.448Z", "submitted": "2018-10-18T17:06:11.433Z", "characteristics": { "External Id": [ { "text": "SAMN10258646", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genome Institute of Singapore" } ], "INSDC first public": [ { "text": "2020-10-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-30T02:20:19.427Z" } ], "INSDC secondary accession": [ { "text": "SRS3951945" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3951945" } ], "cell line": [ { "text": "KATOIII", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002217" ], "tag": "attribute" } ], "cell type": [ { "text": "gastric cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam, ab4729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "gastric cancer cell line", "tag": "attribute" } ], "title": [ { "text": "KATOIII_H3K27ac [histone]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10258646", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-18T17:06:11.433Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10258646" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10258646{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10258646/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10258646/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10258646" } } }, { "name": "GSM3443101", "accession": "SAMN10280103", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-10-01T00:00:00Z", "update": "2022-03-31T01:13:56.962Z", "submitted": "2018-10-23T11:56:07.090Z", "characteristics": { "External Id": [ { "text": "SAMN10280103", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institut Curie" } ], "INSDC first public": [ { "text": "2019-10-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-10-01T05:38:19.430Z" } ], "INSDC secondary accession": [ { "text": "SRS3968178" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3968178" } ], "cell line": [ { "text": "MDA-MB-468", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001216" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9me2 ( cell signaling, Cat # 4658S; Rabbit monoclonal [D85B4])", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages used": [ { "text": "From 6 to 14", "ontologyTerms": [ "http://purl.obolibrary.org/obo/OBI_0001479" ], "tag": "attribute" } ], "source_name": [ { "text": "Basal breast cancer cells", "tag": "attribute" } ], "tissue": [ { "text": "Basal breast cancer cells", "tag": "attribute" } ], "title": [ { "text": "A1023C23: H3K9me2_untreated-3" } ] }, "submittedVia": "JSON_API", "create": "2018-10-23T11:56:07.090Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10280103" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10280103{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10280103/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10280103/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10280103" } } }, { "name": "GSM3449551", "accession": "SAMN10340257", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-04-11T00:00:00Z", "update": "2022-03-31T01:29:32.066Z", "submitted": "2018-10-29T09:21:03.160Z", "characteristics": { "External Id": [ { "text": "SAMN10340257", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Division of Bio-informational Pharmacology, Medical Research Institute, Tokyo Medical and Dental University" } ], "INSDC first public": [ { "text": "2019-04-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-04-13T23:28:12.973Z" } ], "INSDC secondary accession": [ { "text": "SRS3989981" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS3989981" } ], "antibody": [ { "text": "FLAG", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PO_0020103" ], "tag": "attribute" } ], "cell type": [ { "text": "HUVECs", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002451" ], "tag": "attribute" } ], "donor": [ { "text": "pooled from multiple donors", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "4-7", "tag": "attribute" } ], "source_name": [ { "text": "human umblical vein endothelial cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002451" ], "tag": "attribute" } ], "title": [ { "text": "4_KDM7A_TNF60min_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10340257", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-10-29T09:21:03.160Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10340257" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10340257{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10340257/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10340257/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10340257" } } }, { "name": "GSM3456993", "accession": "SAMN10378871", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-17T00:00:00Z", "update": "2022-03-31T01:48:29.870Z", "submitted": "2018-11-05T10:46:06.153Z", "characteristics": { "External Id": [ { "text": "SAMN10378871", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Oncology, Ludwig Institute for Cancer Research, and University of Lausanne" } ], "INSDC first public": [ { "text": "2021-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-17T01:09:17.747Z" } ], "INSDC secondary accession": [ { "text": "SRS4016004" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4016004" } ], "antibody": [ { "text": "H3K27ac pAb (31933, Active Motif)", "tag": "attribute" } ], "cell l line": [ { "text": "UWB1.289", "tag": "attribute" } ], "genotype": [ { "text": "MUT", "ontologyTerms": [ "http://www.orpha.net/ORDO/Orphanet_79312" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "UWB1.289 with mutation in BRCA1 - replicate 2", "tag": "attribute" } ], "title": [ { "text": "BRCA1_MUT2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN10378871", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-11-05T10:46:06.153Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10378871" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10378871{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10378871/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10378871/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10378871" } } }, { "name": "GSM3494632", "accession": "SAMN10494993", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-18T00:00:00Z", "update": "2023-05-14T00:52:40.810Z", "submitted": "2018-11-28T14:25:04.310Z", "characteristics": { "External Id": [ { "text": "SAMN10494993", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The Salk Institute for Biological Studies" } ], "INSDC first public": [ { "text": "2022-11-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-11-18T01:29:23.957Z" } ], "INSDC secondary accession": [ { "text": "SRS4088799" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4088799" } ], "antibody source": [ { "text": "Abcam ab110641", "tag": "attribute" } ], "genotype/variation": [ { "text": "K755R/+", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "K755R/+ hNPCs", "tag": "attribute" } ], "title": [ { "text": "SMARCA4-K755R-rep1-ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10494993", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2018-11-28T14:25:04.310Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10494993" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10494993{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10494993/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10494993/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10494993" } } }, { "name": "GSM3518695", "accession": "SAMN10611160", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-18T00:00:00Z", "update": "2022-03-31T03:19:51.670Z", "submitted": "2018-12-18T13:30:04.757Z", "characteristics": { "External Id": [ { "text": "SAMN10611160", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Quertermous, Medicine Cardiology, Stanford University" } ], "INSDC first public": [ { "text": "2019-12-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-18T02:04:45.270Z" } ], "INSDC secondary accession": [ { "text": "SRS4174156" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4174156" } ], "chip antibody": [ { "text": "anti-SRF (Santa Cruz sc-335)", "tag": "attribute" } ], "growth medium": [ { "text": "Grown in serum", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cultured coronary artery smooth muscle cells", "tag": "attribute" } ], "tissue": [ { "text": "Cultured HCASMC", "tag": "attribute" } ], "title": [ { "text": "HCASMC SRF ChIPseq [TQ40]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10611160", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-12-18T13:30:04.757Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10611160" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10611160{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10611160/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10611160/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10611160" } } }, { "name": "GSM3523232", "accession": "SAMN10619036", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-11T00:00:00Z", "update": "2022-03-31T03:25:22.762Z", "submitted": "2018-12-20T08:32:22.677Z", "characteristics": { "External Id": [ { "text": "SAMN10619036", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Genome Research, Life Sciences, University of Modena and Reggio Emilia" } ], "INSDC first public": [ { "text": "2020-04-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-11T01:22:19.040Z" } ], "INSDC secondary accession": [ { "text": "SRS4176830" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4176830" } ], "antibody": [ { "text": "H3K4me3 (ab8580, Abcam)", "tag": "attribute" } ], "cell type": [ { "text": "human HSPC-derived early erythroid progenitors", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "erythroid progenitors (E-Prog)", "tag": "attribute" } ], "tissue": [ { "text": "Human umbilical cord blood", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq_H3K4me3_EProg" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10619036", "duo": [] } ], "submittedVia": "JSON_API", "create": "2018-12-20T08:32:22.677Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10619036" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10619036{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10619036/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10619036/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10619036" } } }, { "name": "GSM3537206", "accession": "SAMN10686566", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-09T00:00:00Z", "update": "2022-03-31T03:47:51.120Z", "submitted": "2019-01-02T17:17:11.497Z", "characteristics": { "External Id": [ { "text": "SAMN10686566", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Pathology, Johns Hopkins School of Medicine" } ], "INSDC first public": [ { "text": "2020-06-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-09T02:33:24.943Z" } ], "INSDC secondary accession": [ { "text": "SRS4201574" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4201574" } ], "biological replicate": [ { "text": "1", "tag": "attribute" } ], "cell type": [ { "text": "endometrial epithelial cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0010710" ], "tag": "attribute" } ], "chip antibody": [ { "text": "ARID1A (CST, #12354)", "tag": "attribute" } ], "genotype": [ { "text": "ARID1A KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "endometrial epithelial cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0010710" ], "tag": "attribute" } ], "technical replicate": [ { "text": "3", "tag": "attribute" } ], "title": [ { "text": "ChIP-Seq: ARID1A-KO1 AR-CST rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10686566", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-02T17:17:11.497Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686566" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686566{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686566/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10686566/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10686566" } } }, { "name": "GSM3544058", "accession": "SAMN10699290", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-20T00:00:00Z", "update": "2022-03-31T03:54:09.108Z", "submitted": "2019-01-07T08:16:05.727Z", "characteristics": { "External Id": [ { "text": "SAMN10699290", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Bradley Lab, Basic Sciences and Public Health Sciences, Fred Hutchinson Cancer Research Center" } ], "INSDC first public": [ { "text": "2019-06-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-20T02:18:49.980Z" } ], "INSDC secondary accession": [ { "text": "SRS4216578" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4216578" } ], "cell line": [ { "text": "MEL270", "tag": "attribute" } ], "chip antibody": [ { "text": "GLTSCR1 (Santa Cruz SC-240516)", "tag": "attribute" } ], "lentiviral vector": [ { "text": "pINDUCER eGFP empty", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MEL270", "tag": "attribute" } ], "title": [ { "text": "MEL270.dBRD9.GLTSCR1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10699290", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-07T08:16:05.727Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10699290" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10699290{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10699290/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10699290/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10699290" } } }, { "name": "GSM3558572", "accession": "SAMN10721751", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-22T00:00:00Z", "update": "2022-03-31T04:04:41.591Z", "submitted": "2019-01-10T09:27:04.700Z", "characteristics": { "External Id": [ { "text": "SAMN10721751", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Broad Institute of MIT and Harvard, Harvard Medical School, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2019-11-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-22T18:59:19.693Z" } ], "INSDC secondary accession": [ { "text": "SRS4237766" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4237766" } ], "cell line": [ { "text": "TTC1240", "tag": "attribute" } ], "cell type": [ { "text": "tumor cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "BRG1/SMARCA4 (Abcam, ab110641 [EPNCIR111A], lot: GR150844-37)", "tag": "attribute" } ], "lentivirus": [ { "text": "empty", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "TTC1240", "tag": "attribute" } ], "title": [ { "text": "TTC1240_ChIP_N106_Empty_SMARCA4" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10721751", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-10T09:27:04.700Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721751" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721751{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721751/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10721751/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10721751" } } }, { "name": "GSM3567224", "accession": "SAMN10764533", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-03T00:00:00Z", "update": "2023-05-14T02:11:54.234Z", "submitted": "2019-01-17T10:18:03.503Z", "characteristics": { "External Id": [ { "text": "SAMN10764533", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Biology, RIMLS, Radboud University" } ], "INSDC first public": [ { "text": "2022-01-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-03T01:14:41.317Z" } ], "INSDC secondary accession": [ { "text": "SRS4259273" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4259273" } ], "antibody": [ { "text": "GFI1B B7 antibody (Santa Cruz, sc-28356)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MEG01", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002232" ], "tag": "attribute" } ], "title": [ { "text": "MEG01_GFI1B" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN10764533", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-01-17T10:18:03.503Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10764533" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10764533{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10764533/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10764533/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10764533" } } }, { "name": "GSM3581647", "accession": "SAMN10833646", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-20T00:00:00Z", "update": "2022-03-31T04:41:07.135Z", "submitted": "2019-01-28T12:41:03.487Z", "characteristics": { "External Id": [ { "text": "SAMN10833646", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute of Diabetes and Regeneration Research, Helmholtz Zentrum München German Research Center for Environmental Health" } ], "INSDC first public": [ { "text": "2019-06-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-20T02:22:31.750Z" } ], "INSDC secondary accession": [ { "text": "SRS4299424" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4299424" } ], "antibody": [ { "text": "Goat anit PDX1 (Christopher V. E., Wright)", "tag": "attribute" } ], "assay": [ { "text": "PDX1", "tag": "attribute" } ], "lane": [ { "text": "Lane1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PDX1P33T/+ iPS derived pancreatic precursor cells", "tag": "attribute" } ], "title": [ { "text": "P33T-PP_PDX1_Lane1_CTTGTA" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10833646", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-01-28T12:41:03.487Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10833646" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10833646{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10833646/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10833646/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10833646" } } }, { "name": "GSM3591606", "accession": "SAMN10873654", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-03-27T00:00:00Z", "update": "2022-03-31T05:01:09.087Z", "submitted": "2019-02-05T10:57:04.723Z", "characteristics": { "External Id": [ { "text": "SAMN10873654", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Integrative Physiology, NNF Center for Basic Metabolic Research, Copenhagen University" } ], "INSDC first public": [ { "text": "2020-03-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-03-27T01:37:21.670Z" } ], "INSDC secondary accession": [ { "text": "SRS4328580" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4328580" } ], "cell type": [ { "text": "Primary Human Skeletal Muscle cells (hSMCs)", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me1 (Abcam, Ab8895)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "6", "tag": "attribute" } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "hSMCs_P6 TNFa K4me1", "tag": "attribute" } ], "title": [ { "text": "P6 TNFa Rep1 K4me1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10873654", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-05T10:57:04.723Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10873654" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10873654{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10873654/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10873654/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10873654" } } }, { "name": "GSM3592602", "accession": "SAMN10881046", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-16T00:00:00Z", "update": "2022-03-31T05:05:38.032Z", "submitted": "2019-02-06T13:22:11.830Z", "characteristics": { "External Id": [ { "text": "SAMN10881046", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Microbiology and Immunology, University of British Columbia" } ], "INSDC first public": [ { "text": "2020-07-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-16T01:50:19.093Z" } ], "INSDC secondary accession": [ { "text": "SRS4335287" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4335287" } ], "antibody": [ { "text": "anti-H3K4me3, Cell Signaling Technology, Cat# 9751", "tag": "attribute" } ], "cell type": [ { "text": "SV40 large T antigen immortalized human granulosa cells", "tag": "attribute" } ], "genotype/variation": [ { "text": "transduced with V5-FOXL2 C134W lentivirus", "tag": "attribute" } ], "induction": [ { "text": "12 hours Doxycycline induction", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SVOG3e cells transduced with V5-FOXL2 C134W", "tag": "attribute" } ], "title": [ { "text": "H3K4me3_Dox_mut" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10881046", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-06T13:22:11.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10881046" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10881046{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10881046/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10881046/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10881046" } } }, { "name": "GSM3596390", "accession": "SAMN10904731", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-09T00:00:00Z", "update": "2022-03-31T05:10:13.775Z", "submitted": "2019-02-08T16:05:03.620Z", "characteristics": { "External Id": [ { "text": "SAMN10904731", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "INSERM" } ], "INSDC first public": [ { "text": "2019-02-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-09T03:15:21.953Z" } ], "INSDC secondary accession": [ { "text": "SRS4344834" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4344834" } ], "antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "cell line": [ { "text": "KG1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002218" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "KG1 cell line", "tag": "attribute" } ], "tissue": [ { "text": "bone marrow", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002371" ], "tag": "attribute" } ], "title": [ { "text": "H3K27ac_ChIPSeq_KG1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10904731", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-08T16:05:03.620Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904731" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904731{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904731/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904731/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10904731" } } }, { "name": "GSM3596346", "accession": "SAMN10904990", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-03-13T00:00:00Z", "update": "2022-03-31T05:10:20.297Z", "submitted": "2019-02-08T16:36:07.437Z", "characteristics": { "External Id": [ { "text": "SAMN10904990", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "European Molecular Biology Laboratory (EMBL)" } ], "INSDC first public": [ { "text": "2020-03-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-03-13T01:14:02.573Z" } ], "INSDC secondary accession": [ { "text": "SRS4344879" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4344879" } ], "antibody": [ { "text": "H3K4me1", "tag": "attribute" } ], "batch": [ { "text": "1", "tag": "attribute" } ], "bmpr2": [ { "text": "wild type", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005168" ], "tag": "attribute" } ], "condition": [ { "text": "CTRL", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ], "tag": "attribute" } ], "gender": [ { "text": "female", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000383" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "pulmonary arterial endothelial cells", "tag": "attribute" } ], "title": [ { "text": "H3K4me1_CTRL7_female_wild type_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10904990", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-08T16:36:07.437Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904990" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904990{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904990/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10904990/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10904990" } } }, { "name": "GSM3615456", "accession": "SAMN10983197", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-02-22T00:00:00Z", "update": "2022-03-31T05:32:29.764Z", "submitted": "2019-02-21T09:16:03.577Z", "characteristics": { "External Id": [ { "text": "SAMN10983197", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular Pathology, Netherlands Cancer Institute" } ], "INSDC first public": [ { "text": "2019-02-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-02-22T02:05:18.890Z" } ], "INSDC secondary accession": [ { "text": "SRS4387590" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4387590" } ], "cell type": [ { "text": "prostate cancer-derived fibroblasts", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (active motif; 39133)", "tag": "attribute" } ], "group": [ { "text": "PCDF2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PCDF2_veh_H3K27ac", "tag": "attribute" } ], "title": [ { "text": "PCDF2_veh_H3K27ac_repl2" } ], "treatment": [ { "text": "veh", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN10983197", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-02-21T09:16:03.577Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10983197" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10983197{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10983197/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN10983197/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN10983197" } } }, { "name": "GSM3671501", "accession": "SAMN11131203", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-14T00:00:00Z", "update": "2022-03-31T06:24:57.959Z", "submitted": "2019-03-15T10:56:07.480Z", "characteristics": { "External Id": [ { "text": "SAMN11131203", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Molecular and Human Genetics, Baylor College of Medicine" } ], "INSDC first public": [ { "text": "2020-10-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-14T10:59:21.773Z" } ], "INSDC secondary accession": [ { "text": "SRS4492459" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4492459" } ], "barcode": [ { "text": "CCACTCCT", "tag": "attribute" } ], "growth protocol": [ { "text": "10% FBS, DMEM", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SHEP MYCN neuroblastoma cell line", "tag": "attribute" } ], "title": [ { "text": "TL51_SHEP_MYCN_WT_DMSO_WCE" } ], "treatment": [ { "text": "DMSO for 6HR", "tag": "attribute" } ] }, "submittedVia": "JSON_API", "create": "2019-03-15T10:56:07.480Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11131203" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11131203{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11131203/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11131203/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11131203" } } }, { "name": "GSM3673911", "accession": "SAMN11156925", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-31T00:00:00Z", "update": "2022-03-31T06:34:07.319Z", "submitted": "2019-03-17T12:51:06.130Z", "characteristics": { "External Id": [ { "text": "SAMN11156925", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Fulai Jin, Genetics and Genomes Sciences, Case Western Reserve University" } ], "INSDC first public": [ { "text": "2020-07-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-31T01:41:15.633Z" } ], "INSDC secondary accession": [ { "text": "SRS4498584" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4498584" } ], "chip antibody": [ { "text": "CTCF (Abcam, ab70303)", "tag": "attribute" } ], "developmental stage": [ { "text": "Adult", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001272" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Adult anterior temporal cortex", "tag": "attribute" } ], "tissue": [ { "text": "brain (adult anterior temporal cortex)", "tag": "attribute" } ], "title": [ { "text": "Adult_Rep3_CTCF (chip-seq)" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11156925", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-17T12:51:06.130Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11156925" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11156925{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11156925/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11156925/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11156925" } } }, { "name": "GSM3687004", "accession": "SAMN11252836", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-18T00:00:00Z", "update": "2022-03-31T07:16:49.392Z", "submitted": "2019-03-25T19:44:14.093Z", "characteristics": { "External Id": [ { "text": "SAMN11252836", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Internal Med III, University Hospital Regensburg" } ], "INSDC first public": [ { "text": "2019-11-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-18T09:00:19.247Z" } ], "INSDC secondary accession": [ { "text": "SRS4537034" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4537034" } ], "cell line": [ { "text": "CTV-1", "tag": "attribute" } ], "cell type": [ { "text": "T cell leukemia cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "PU.1 (Santa Cruz, #sc-352X)", "tag": "attribute" } ], "fixation method": [ { "text": "FA", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "preperation batch": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "CTV-1_mutPU.1mRNA_FA_PU.1-ChIP", "tag": "attribute" } ], "title": [ { "text": "CTV-1_mutPU.1mRNA_FA_PU.1-ChIP_1" } ], "transfected ivt mrna": [ { "text": "PU.1mut", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11252836", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-03-25T19:44:14.093Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11252836" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11252836{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11252836/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11252836/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11252836" } } }, { "name": "GSM3701060", "accession": "SAMN11309268", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-05-14T00:00:00Z", "update": "2022-03-31T07:38:43.818Z", "submitted": "2019-04-01T14:52:05.320Z", "characteristics": { "External Id": [ { "text": "SAMN11309268", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jabado Lab, Department of Pediatrics, McGill University" } ], "INSDC first public": [ { "text": "2019-05-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-05-14T02:22:23.533Z" } ], "INSDC secondary accession": [ { "text": "SRS4566767" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4566767" } ], "chip antibody": [ { "text": "Diagenode-H3K27ac (Cat# C15410196, RRID:AB_2637079)", "tag": "attribute" } ], "genotype": [ { "text": "H3.3K27M", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "Tumor", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000616" ], "tag": "attribute" } ], "source_name": [ { "text": "H3.3K27M_Tumor", "tag": "attribute" } ], "title": [ { "text": "JN29-BS3_brain_h3k27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11309268", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-01T14:52:05.320Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11309268" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11309268{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11309268/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11309268/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11309268" } } }, { "name": "GSM3720399", "accession": "SAMN11402498", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-04-02T00:00:00Z", "update": "2022-03-31T08:11:51.818Z", "submitted": "2019-04-12T08:06:09.110Z", "characteristics": { "External Id": [ { "text": "SAMN11402498", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UCSD" } ], "INSDC first public": [ { "text": "2020-04-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-04-02T01:35:20.723Z" } ], "INSDC secondary accession": [ { "text": "SRS4615664" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4615664" } ], "cell line": [ { "text": "A2780", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006362" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3K4me2_A2780_vehicle", "tag": "attribute" } ], "title": [ { "text": "H3K4me2_A2780_vehicle" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11402498", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-12T08:06:09.110Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11402498" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11402498{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11402498/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11402498/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11402498" } } }, { "name": "GSM3735802", "accession": "SAMN11505973", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-03-28T00:00:00Z", "update": "2022-03-31T08:36:01.042Z", "submitted": "2019-04-25T09:39:03.773Z", "characteristics": { "External Id": [ { "text": "SAMN11505973", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chromatin and cell Biology, IGH" } ], "INSDC first public": [ { "text": "2020-03-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-03-28T01:59:31.143Z" } ], "INSDC secondary accession": [ { "text": "SRS4671984" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4671984" } ], "antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "cell type": [ { "text": "WI-38hTERT/GFP-RAF1-ER", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human fetal lung fibroblats (Oncogene induces senescent)", "tag": "attribute" } ], "title": [ { "text": "ChIP_OISD2_H3K4me3_Rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11505973", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-25T09:39:03.773Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11505973" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11505973{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11505973/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11505973/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11505973" } } }, { "name": "GSM3736459", "accession": "SAMN11509971", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-24T00:00:00Z", "update": "2022-03-31T08:37:15.583Z", "submitted": "2019-04-25T16:26:06.377Z", "characteristics": { "External Id": [ { "text": "SAMN11509971", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NIEHS" } ], "INSDC first public": [ { "text": "2021-02-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-24T02:48:28.427Z" } ], "INSDC secondary accession": [ { "text": "SRS4675525" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4675525" } ], "cell type": [ { "text": "induced endoderm cells", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-H3K27ac (abcam, ab177178)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ES derived endoderm cells", "tag": "attribute" } ], "title": [ { "text": "H3K27ac CHIP of endoderm cells [YFH14]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN11509971", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11509971", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-04-25T16:26:06.377Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11509971" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11509971{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11509971/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11509971/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11509971" } } }, { "name": "GSM3781579", "accession": "SAMN11784676", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-20T00:00:00Z", "update": "2022-03-31T10:12:58.418Z", "submitted": "2019-05-20T11:51:12.127Z", "characteristics": { "External Id": [ { "text": "SAMN11784676", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Science Institute of Singapore" } ], "INSDC first public": [ { "text": "2021-05-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-20T01:29:18.770Z" } ], "INSDC secondary accession": [ { "text": "SRS4789495" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4789495" } ], "cell line": [ { "text": "KYSE150", "tag": "attribute" } ], "cell type": [ { "text": "esophageal squamous cell carcinoma (ESCC) cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit Anti-Histone H3 (acetyl K27), Abcam, Cat# ab4729", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "KYSE150_H3K27ac", "tag": "attribute" } ], "title": [ { "text": "KYSE150_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN11784676", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-05-20T11:51:12.127Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11784676" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11784676{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11784676/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11784676/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11784676" } } }, { "name": "GSM3791242", "accession": "SAMN11822520", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-08T00:00:00Z", "update": "2022-03-31T10:30:25.259Z", "submitted": "2019-05-22T09:32:09.910Z", "characteristics": { "External Id": [ { "text": "SAMN11822520", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Prof. Patrick Cramer, Molecular Biology, Max Planck Institute for Biophysical Chemistry" } ], "INSDC first public": [ { "text": "2021-04-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-08T03:09:50.800Z" } ], "INSDC secondary accession": [ { "text": "SRS4805082" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4805082" } ], "cell type": [ { "text": "RCH-ACV stably expressing estrogen inducible C/EBPa", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-BRD4 (Bethyl Laboratories, A301-985A100)", "tag": "attribute" } ], "extract protocol": [ { "text": "NEB Ultra DNA Library kit", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "BLaER", "tag": "attribute" } ], "title": [ { "text": "BRD4_12h_rep1_ChIPSeq" } ], "treatment": [ { "text": "Beta-estradiol (100nM) treatment 12h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN11822520", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-05-22T09:32:09.910Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822520" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822520{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822520/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11822520/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11822520" } } }, { "name": "GSM3791750", "accession": "SAMN11831865", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-09-04T00:00:00Z", "update": "2022-03-31T10:33:59.387Z", "submitted": "2019-05-22T14:32:08.253Z", "characteristics": { "External Id": [ { "text": "SAMN11831865", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jane Skok, Pathology, NYU Langone Health" } ], "INSDC first public": [ { "text": "2019-09-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-09-04T09:51:16.920Z" } ], "INSDC secondary accession": [ { "text": "SRS4806480" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4806480" } ], "cell type": [ { "text": "multiple myeloma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "CTCF (Millipore 07-729)", "tag": "attribute" } ], "genotype/variation": [ { "text": "overexpressed NSD2 allele inactivated", "tag": "attribute" } ], "kit": [ { "text": "Nextera", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "parental cell line": [ { "text": "KMS11", "tag": "attribute" } ], "source_name": [ { "text": "TKO", "tag": "attribute" } ], "title": [ { "text": "NSD2_Low_1_CTCF-ChIPseq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11831865", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-05-22T14:32:08.253Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11831865" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11831865{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11831865/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11831865/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11831865" } } }, { "name": "GSM3813971", "accession": "SAMN11840189", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-01-14T00:00:00Z", "update": "2022-03-31T10:35:47.200Z", "submitted": "2019-05-23T09:36:20.953Z", "characteristics": { "External Id": [ { "text": "SAMN11840189", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2020-01-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-01-14T06:53:42.547Z" } ], "INSDC secondary accession": [ { "text": "SRS4809828" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4809828" } ], "cell line": [ { "text": "PC9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002847" ], "tag": "attribute" } ], "cell type": [ { "text": "Non-small cell lung cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "TEAD4 (ab58310, Abcam)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "PC9", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002847" ], "tag": "attribute" } ], "title": [ { "text": "48h_2DF_TEAD4" } ], "treatment": [ { "text": "osimertinib + strametinib", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN11840189", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-05-23T09:36:20.953Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11840189" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11840189{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11840189/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11840189/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11840189" } } }, { "name": "GSM3840021", "accession": "SAMN11917881", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-08-10T00:00:00Z", "update": "2022-03-31T11:11:16.914Z", "submitted": "2019-05-31T17:30:10.010Z", "characteristics": { "External Id": [ { "text": "SAMN11917881", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Payton Lab, Pathology and Immunology, Washington University in St. Louis" } ], "INSDC first public": [ { "text": "2019-08-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-08-10T03:14:18.460Z" } ], "INSDC secondary accession": [ { "text": "SRS4856359" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4856359" } ], "cell markers": [ { "text": "CD4+, CD26-", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005180" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam ab4729)", "tag": "attribute" } ], "disease": [ { "text": "Mycosis fungoides", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_1001051" ], "tag": "attribute" } ], "hdaci group": [ { "text": "Resistant", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Peripheral blood", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000178" ], "tag": "attribute" } ], "title": [ { "text": "CTCL079.OW.H3K27AC.CD26N" } ] }, "submittedVia": "JSON_API", "create": "2019-05-31T17:30:10.010Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11917881" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11917881{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11917881/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN11917881/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN11917881" } } }, { "name": "GSM3873121", "accession": "SAMN12018382", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-08-08T00:00:00Z", "update": "2022-03-31T11:41:55.882Z", "submitted": "2019-06-11T11:06:14.013Z", "characteristics": { "External Id": [ { "text": "SAMN12018382", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The University of Tokyo" } ], "INSDC first public": [ { "text": "2019-08-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-08-08T04:00:17.513Z" } ], "INSDC secondary accession": [ { "text": "SRS4942322" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS4942322" } ], "antibody": [ { "text": "Rabbit anti-non-phospho β-catenin antibody (Cell Signaling Technology, 8814)", "tag": "attribute" } ], "cell type": [ { "text": "Human iPS cells", "tag": "attribute" } ], "days after differentiation": [ { "text": "3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human iPS-derived cells on day 3 of the standard 2C protocol", "tag": "attribute" } ], "tissue": [ { "text": "Dermal fibroblasts", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002551" ], "tag": "attribute" } ], "title": [ { "text": "β-catenin_std_Day 3-1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12018382", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-06-11T11:06:14.013Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12018382" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12018382{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12018382/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12018382/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12018382" } } }, { "name": "GSM3905476", "accession": "SAMN12137363", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-06-26T00:00:00Z", "update": "2022-03-31T12:16:53.002Z", "submitted": "2019-06-25T16:11:10.693Z", "characteristics": { "External Id": [ { "text": "SAMN12137363", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gertz, University of Utah" } ], "INSDC first public": [ { "text": "2019-06-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-06-27T21:25:14.790Z" } ], "INSDC secondary accession": [ { "text": "SRS5028059" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5028059" } ], "activation construct": [ { "text": "dCas9-VP16(10x)", "tag": "attribute" } ], "antibody target": [ { "text": "RNAPII", "tag": "attribute" } ], "cell line": [ { "text": "Ishikawa", "tag": "attribute" } ], "cell type": [ { "text": "endometrial carcinoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Ishikawa Cell Line (endometrial carcinoma)", "tag": "attribute" } ], "targeted pools": [ { "text": "Pool 1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000663" ], "tag": "attribute" } ], "title": [ { "text": "polii_vp160_pool1_stringent: RNAPII VP16(10x) Pool1 rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12137363", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-06-25T16:11:10.693Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12137363" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12137363{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12137363/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12137363/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12137363" } } }, { "name": "GSM3934120", "accession": "SAMN12237798", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-08T00:00:00Z", "update": "2022-03-31T12:42:20.802Z", "submitted": "2019-07-09T14:01:11.280Z", "characteristics": { "External Id": [ { "text": "SAMN12237798", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Rai Lab, Genomic Medicine, MD Anderson Cancer Center" } ], "INSDC first public": [ { "text": "2019-11-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-08T06:54:17.367Z" } ], "INSDC secondary accession": [ { "text": "SRS5078870" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5078870" } ], "cell type": [ { "text": "Cell Line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 Abcam ab8580", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Melanoma Short Term Cultures", "tag": "attribute" } ], "title": [ { "text": "2173-STC1_E" } ] }, "submittedVia": "JSON_API", "create": "2019-07-09T14:01:11.280Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12237798" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12237798{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12237798/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12237798/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12237798" } } }, { "name": "GSM3937814", "accession": "SAMN12254851", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-08-09T00:00:00Z", "update": "2022-03-31T12:46:45.931Z", "submitted": "2019-07-11T08:51:03.917Z", "characteristics": { "External Id": [ { "text": "SAMN12254851", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Constellation Pharmaceuticals" } ], "INSDC first public": [ { "text": "2019-08-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-08-09T05:11:17.810Z" } ], "INSDC secondary accession": [ { "text": "SRS5085712" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5085712" } ], "cell line": [ { "text": "SUDHL6", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002357" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Cell Signaling Technolgy 9730", "tag": "attribute" } ], "chip antibody target": [ { "text": "H3K27me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85045" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Diffuse large B cell lymphoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000403" ], "tag": "attribute" } ], "title": [ { "text": "SUDHL6 DMSO 4 days H3K27me3 ChIP-seq" } ], "treatment": [ { "text": "DMSO 4 days", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12254851", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-07-11T08:51:03.917Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12254851" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12254851{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12254851/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12254851/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12254851" } } }, { "name": "GSM3959452", "accession": "SAMN12334496", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-21T00:00:00Z", "update": "2022-03-31T13:11:37.313Z", "submitted": "2019-07-22T11:36:19.980Z", "characteristics": { "External Id": [ { "text": "SAMN12334496", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Thomas Look, Pediatric Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2020-07-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-21T01:16:18.640Z" } ], "INSDC secondary accession": [ { "text": "SRS5132141" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5132141" } ], "cell line": [ { "text": "NGP", "tag": "attribute" } ], "cell type": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "chip antiboy": [ { "text": "H3K4me3 (Abcam, #ab8580)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Neuroblastoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000621" ], "tag": "attribute" } ], "title": [ { "text": "NGP_ctrl_H3K4me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12334496", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-07-22T11:36:19.980Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12334496" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12334496{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12334496/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12334496/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12334496" } } }, { "name": "GSM4072999", "accession": "SAMN12723276", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-09T00:00:00Z", "update": "2022-03-31T15:19:07.573Z", "submitted": "2019-09-10T12:31:09.887Z", "characteristics": { "External Id": [ { "text": "SAMN12723276", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biomedical Statistics and Informatics, Mayo Clinic" } ], "INSDC first public": [ { "text": "2020-09-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-09T02:57:21.957Z" } ], "INSDC secondary accession": [ { "text": "SRS5369956" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5369956" } ], "cell line": [ { "text": "PC-3", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002074" ], "tag": "attribute" } ], "cell type": [ { "text": "prostate cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001663" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit polyclonal anti-Histone H3K27-ac Abcam ab4729", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "20-30", "tag": "attribute" } ], "source_name": [ { "text": "prostate", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002367" ], "tag": "attribute" } ], "title": [ { "text": "GDC-R_vehicle_H3K27ac_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12723276", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-10T12:31:09.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12723276" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12723276{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12723276/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12723276/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12723276" } } }, { "name": "GSM4079781", "accession": "SAMN12757142", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-09-17T00:00:00Z", "update": "2022-03-31T15:28:32.909Z", "submitted": "2019-09-16T07:47:11.197Z", "characteristics": { "External Id": [ { "text": "SAMN12757142", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hideo Watanabe, Department of Medicine, Division of Pulmonary, Critical Care and Sleep Medicine, Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2019-09-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-09-17T11:02:21.133Z" } ], "INSDC secondary accession": [ { "text": "SRS5391192" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5391192" } ], "cell line": [ { "text": "LK2_DNp63", "tag": "attribute" } ], "cell type": [ { "text": "lung squamous cell carcinoma (LUSC) cell lines", "tag": "attribute" } ], "chip antibody": [ { "text": "p63 (Santa Cruz, sc-8431)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "LK2_DNp63_p63", "tag": "attribute" } ], "title": [ { "text": "p63 ChIP for LK2_DNp63" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12757142", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-16T07:47:11.197Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12757142" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12757142{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12757142/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12757142/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12757142" } } }, { "name": "GSM4089121", "accession": "SAMN12818074", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-21T00:00:00Z", "update": "2022-03-31T15:58:36.505Z", "submitted": "2019-09-23T06:42:04.743Z", "characteristics": { "External Id": [ { "text": "SAMN12818074", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Creyghton, Hubrecht Institute" } ], "INSDC first public": [ { "text": "2019-12-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-21T01:43:19.170Z" } ], "INSDC secondary accession": [ { "text": "SRS5420685" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5420685" } ], "antibody": [ { "text": "ab4729", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human White Matter", "tag": "attribute" } ], "tissue": [ { "text": "Human White Matter", "tag": "attribute" } ], "title": [ { "text": "Human_WhiteMatter_H3K27ac_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12818074", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-09-23T06:42:04.743Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818074" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818074{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818074/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12818074/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12818074" } } }, { "name": "GSM4097403", "accession": "SAMN12856516", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-01T00:00:00Z", "update": "2022-03-31T16:10:08.445Z", "submitted": "2019-09-26T10:12:03.950Z", "characteristics": { "External Id": [ { "text": "SAMN12856516", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Northwestern University" } ], "INSDC first public": [ { "text": "2020-10-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-01T04:29:19.213Z" } ], "INSDC secondary accession": [ { "text": "SRS5445238" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5445238" } ], "cell population": [ { "text": "CD34-/CD49b- Leiomyoma differentiated cell", "tag": "attribute" } ], "cell type": [ { "text": "uterine leiomyoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000731" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3: Millipore (07-473)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary uterine leiomyoma cells", "tag": "attribute" } ], "tissue preparation": [ { "text": "Primary P0 cells", "tag": "attribute" } ], "title": [ { "text": "H3K4me3_ChIP_LDC_merge" } ] }, "submittedVia": "JSON_API", "create": "2019-09-26T10:12:03.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12856516" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12856516{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12856516/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12856516/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12856516" } } }, { "name": "GSM4104633", "accession": "SAMN12889049", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-04T00:00:00Z", "update": "2022-03-31T16:27:13.496Z", "submitted": "2019-10-02T08:11:08.113Z", "characteristics": { "External Id": [ { "text": "SAMN12889049", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Children's Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2019-11-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-04T07:23:22.700Z" } ], "INSDC secondary accession": [ { "text": "SRS5465388" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5465388" } ], "cell line": [ { "text": "NB69", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002798" ], "tag": "attribute" } ], "chip antibody": [ { "text": "N-MYC (Active Motif, #61185)", "tag": "attribute" } ], "growth media": [ { "text": "RPMI 1640, 10% FBS, 1% Penicillin/Streptomycin, 2mM L-Glutamine", "tag": "attribute" } ], "mycn status": [ { "text": "non-amp", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "neuroblastoma-derived cell line", "tag": "attribute" } ], "title": [ { "text": "NB69 NMYC ChIP-Seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN12889049", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-02T08:11:08.113Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12889049" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12889049{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12889049/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12889049/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12889049" } } }, { "name": "GSM4109814", "accession": "SAMN12956634", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-01T00:00:00Z", "update": "2022-03-31T16:38:40.758Z", "submitted": "2019-10-07T10:40:07.253Z", "characteristics": { "External Id": [ { "text": "SAMN12956634", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Helin, Biotech Research Innovation Centre, Copenhagen University" } ], "INSDC first public": [ { "text": "2020-07-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-01T04:50:26.030Z" } ], "INSDC secondary accession": [ { "text": "SRS5484369" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5484369" } ], "cell line": [ { "text": "KGN", "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit polyclonal anti-SMAD4 (Proteintech, 10231-1-AP)", "tag": "attribute" } ], "genotype/variation": [ { "text": "KGN Cell-line is Heterozygous for FOXL2 C134W mutation", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "KGN cell-line", "tag": "attribute" } ], "title": [ { "text": "Exp2_KGN_TGF_SMAD4_ChIP" } ] }, "submittedVia": "JSON_API", "create": "2019-10-07T10:40:07.253Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12956634" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12956634{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12956634/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN12956634/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN12956634" } } }, { "name": "GSM4139501", "accession": "SAMN13112379", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-03T00:00:00Z", "update": "2022-03-31T17:26:41.652Z", "submitted": "2019-10-25T07:58:14.497Z", "characteristics": { "External Id": [ { "text": "SAMN13112379", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "The University of Arizona" } ], "INSDC first public": [ { "text": "2020-06-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-03T02:18:18.830Z" } ], "INSDC secondary accession": [ { "text": "SRS5570912" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5570912" } ], "cell type": [ { "text": "human aortic endothelial cell", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0002544" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Active Motif #39135", "tag": "attribute" } ], "donor id": [ { "text": "donor25", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "6 to 10", "tag": "attribute" } ], "source_name": [ { "text": "human aortic endothelial cell_untreated_h327ac", "tag": "attribute" } ], "title": [ { "text": "donor25.h3k27ac_notx.rep2" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13112379", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-10-25T07:58:14.497Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112379" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112379{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112379/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13112379/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13112379" } } }, { "name": "GSM4140630", "accession": "SAMN13113817", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-25T00:00:00Z", "update": "2023-05-14T09:13:20.490Z", "submitted": "2019-10-25T11:46:04.030Z", "characteristics": { "External Id": [ { "text": "SAMN13113817", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Renji Hospital" } ], "INSDC first public": [ { "text": "2022-10-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-10-25T06:35:19.933Z" } ], "INSDC secondary accession": [ { "text": "SRS5573515" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5573515" } ], "cell line": [ { "text": "HCT116", "tag": "attribute" } ], "cell type": [ { "text": "human colorectal cancer cells", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-Acetyl-Histone H3 (Lys27) (D5E4) XP antibody (CST, Lot NO. 8173)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "16-19", "tag": "attribute" } ], "source_name": [ { "text": "HCT116 cells", "tag": "attribute" } ], "title": [ { "text": "ENO1-IT1 siRNA-H3K27ace" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN13113817", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2019-10-25T11:46:04.030Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13113817" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13113817{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13113817/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13113817/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13113817" } } }, { "name": "GSM4146654", "accession": "SAMN13175641", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-12-05T00:00:00Z", "update": "2022-03-31T17:49:00.806Z", "submitted": "2019-11-01T08:11:07.920Z", "characteristics": { "External Id": [ { "text": "SAMN13175641", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "LGI, National Cancer Institute, national institutes of health/hhs" } ], "INSDC first public": [ { "text": "2019-12-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-12-05T20:40:19.640Z" } ], "INSDC secondary accession": [ { "text": "SRS5598890" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5598890" } ], "cell line": [ { "text": "Ramos", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002077" ], "tag": "attribute" } ], "cell line source gender": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "cell type": [ { "text": "Burkitt's lymphoma-derived cell line, EBV-negative", "tag": "attribute" } ], "chip antibody": [ { "text": "YY2", "tag": "attribute" } ], "chip antibody vendor": [ { "text": "Sigma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004563" ], "tag": "attribute" } ], "genotype": [ { "text": "WT", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "input sample used": [ { "text": "ChIP-INPUT1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Ramos cell line", "tag": "attribute" } ], "title": [ { "text": "ChIP-YY2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13175641", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-11-01T08:11:07.920Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13175641" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13175641{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13175641/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13175641/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13175641" } } }, { "name": "GSM4151965", "accession": "SAMN13223223", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2019-11-07T00:00:00Z", "update": "2022-03-31T18:04:07.712Z", "submitted": "2019-11-06T15:16:08.193Z", "characteristics": { "External Id": [ { "text": "SAMN13223223", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for experimental cancer research in pediatrics, Goethe University Frankfurt" } ], "INSDC first public": [ { "text": "2019-11-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2019-11-07T03:21:24.303Z" } ], "INSDC secondary accession": [ { "text": "SRS5618234" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5618234" } ], "cell line": [ { "text": "RD cells", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-rabbit H3K4me2 (Diagenode, Liège, Belgium)", "tag": "attribute" } ], "knockdown": [ { "text": "siRNA_LSD1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "p10-p15", "tag": "attribute" } ], "source_name": [ { "text": "Rhabdomyosarcoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002918" ], "tag": "attribute" } ], "title": [ { "text": "ChIP_H3K4me2_siRNA_LSD1_RD_Rep2" } ] }, "submittedVia": "JSON_API", "create": "2019-11-06T15:16:08.193Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13223223" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13223223{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13223223/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13223223/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13223223" } } }, { "name": "GSM4189024", "accession": "SAMN13353585", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-03-02T00:00:00Z", "update": "2022-03-31T18:46:48.073Z", "submitted": "2019-11-22T13:51:10.340Z", "characteristics": { "External Id": [ { "text": "SAMN13353585", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Shanghai JiaoTong University" } ], "INSDC first public": [ { "text": "2020-03-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-03-02T02:23:27.743Z" } ], "INSDC secondary accession": [ { "text": "SRS5707782" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5707782" } ], "antibody": [ { "text": "Rad21", "tag": "attribute" } ], "cell type": [ { "text": "human endometrial adenocarcinoma", "tag": "attribute" } ], "genotype": [ { "text": "RF insertion", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HEC-1-B cells", "tag": "attribute" } ], "title": [ { "text": "HEC-1-B_REV-FWD_Rad21" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13353585", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-11-22T13:51:10.340Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13353585" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13353585{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13353585/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13353585/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13353585" } } }, { "name": "GSM4202797", "accession": "SAMN13478071", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-29T00:00:00Z", "update": "2022-03-31T19:33:53.122Z", "submitted": "2019-12-04T11:05:12.363Z", "characteristics": { "External Id": [ { "text": "SAMN13478071", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Quantitative and Computational Biology, Baylor College of Medicine" } ], "INSDC first public": [ { "text": "2021-06-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-29T02:27:19.233Z" } ], "INSDC secondary accession": [ { "text": "SRS5761781" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5761781" } ], "chip antibody": [ { "text": "H3K4me3 Abcam ab8580", "tag": "attribute" } ], "genotype": [ { "text": "PRC2 WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Patient derived", "tag": "attribute" } ], "tissue": [ { "text": "Peripheral nerve", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000111" ], "tag": "attribute" } ], "title": [ { "text": "STS26T Cell line H3K4me3 ChIP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN13478071", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-04T11:05:12.363Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13478071" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13478071{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13478071/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13478071/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13478071" } } }, { "name": "GSM4212635", "accession": "SAMN13521320", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-27T00:00:00Z", "update": "2022-03-31T19:46:43.449Z", "submitted": "2019-12-10T10:33:10.730Z", "characteristics": { "External Id": [ { "text": "SAMN13521320", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gene Expression Laboratory, Tianjin Research Center for Basic Medical Science, Tianjin Medical University" } ], "INSDC first public": [ { "text": "2021-01-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-27T01:24:17.853Z" } ], "INSDC secondary accession": [ { "text": "SRS5792488" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5792488" } ], "cell line background": [ { "text": "WT 9-12", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001103" ], "tag": "attribute" } ], "cell type": [ { "text": "immortalized epithelial cell line obtained from patients with ADPKD", "tag": "attribute" } ], "chip antibody": [ { "text": "Santa Cruz Biotechnology, sc-585", "tag": "attribute" } ], "genotype/variation": [ { "text": "Nrf2 knockout", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "WT 9-12_Nrf2 knockout_vehicle", "tag": "attribute" } ], "title": [ { "text": "NRF2KO_DMSO_P300" } ], "treatment": [ { "text": "vehicle", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000732" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN13521320", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13521320", "duo": [] } ], "submittedVia": "JSON_API", "create": "2019-12-10T10:33:10.730Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13521320" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13521320{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13521320/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13521320/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13521320" } } }, { "name": "GSM4256994", "accession": "SAMN13763597", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-01-09T00:00:00Z", "update": "2022-03-31T21:01:55.422Z", "submitted": "2020-01-08T15:06:03.170Z", "characteristics": { "External Id": [ { "text": "SAMN13763597", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Fariba Behbod, Pathology and Laboratory Medicine, University of Kansas Medical Center" } ], "INSDC first public": [ { "text": "2020-01-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-01-09T03:35:17.280Z" } ], "INSDC secondary accession": [ { "text": "SRS5962409" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS5962409" } ], "biological replicate": [ { "text": "Positive control", "tag": "attribute" } ], "cell line": [ { "text": "DCIS.com", "tag": "attribute" } ], "cell type": [ { "text": "breast cancer cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002885" ], "tag": "attribute" } ], "chip antibody": [ { "text": "CTCF (Miilipore 7729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DCIScom-NS", "tag": "attribute" } ], "title": [ { "text": "DCIScom-NS-CTCF" } ], "treatment": [ { "text": "Non-scrambled control", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13763597", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-01-08T15:06:03.170Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13763597" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13763597{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13763597/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13763597/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13763597" } } }, { "name": "GSM4281936", "accession": "SAMN13909477", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-07-21T00:00:00Z", "update": "2022-03-31T21:45:36.003Z", "submitted": "2020-01-23T11:02:11.677Z", "characteristics": { "External Id": [ { "text": "SAMN13909477", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Integrative Physiology, NNF Center for Basic Metabolic Research, Copenhagen University" } ], "INSDC first public": [ { "text": "2021-07-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-07-21T01:26:21.083Z" } ], "INSDC secondary accession": [ { "text": "SRS6055374" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6055374" } ], "antibody": [ { "text": "H3K4me1 (Abcam, Ab8895)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "participant": [ { "text": "P5", "tag": "attribute" } ], "source_name": [ { "text": "vastus lateralis", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001379" ], "tag": "attribute" } ], "tissue": [ { "text": "vastus lateralis", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0001379" ], "tag": "attribute" } ], "title": [ { "text": "P5_1_K4me1" } ], "training": [ { "text": "Untrained", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN13909477", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-01-23T11:02:11.677Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13909477" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13909477{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13909477/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13909477/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13909477" } } }, { "name": "GSM4284958", "accession": "SAMN13927477", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-27T00:00:00Z", "update": "2022-03-31T21:52:11.426Z", "submitted": "2020-01-27T09:56:06.633Z", "characteristics": { "External Id": [ { "text": "SAMN13927477", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Martin Eilers, Chair for Biochemistry and Molecular Biology, University of Wuerzburg" } ], "INSDC first public": [ { "text": "2020-11-27T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-27T01:33:43.427Z" } ], "INSDC secondary accession": [ { "text": "SRS6065958" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6065958" } ], "cell line": [ { "text": "IMR-5", "tag": "attribute" } ], "cell type": [ { "text": "neuroblastoma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "pH3S10 (rabbit, Abcam, ab177218)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "neuroblastoma cell line", "tag": "attribute" } ], "title": [ { "text": "H3S10 S MLN" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN13927477", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-01-27T09:56:06.633Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13927477" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13927477{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13927477/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN13927477/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN13927477" } } }, { "name": "GSM4304442", "accession": "SAMN14075079", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-07T00:00:00Z", "update": "2022-03-31T22:47:28.429Z", "submitted": "2020-02-10T09:27:14.910Z", "characteristics": { "External Id": [ { "text": "SAMN14075079", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Leukemia, MD Anderson Cancer Center" } ], "INSDC first public": [ { "text": "2020-11-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-07T02:03:28.650Z" } ], "INSDC secondary accession": [ { "text": "SRS6125391" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6125391" } ], "cell line": [ { "text": "SET2", "tag": "attribute" } ], "cell type": [ { "text": "leukemia blast cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27Ac (Active Motif) RRID:AB_2793305", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "Drug resistant sAML cell line", "tag": "attribute" } ], "source_name": [ { "text": "Drug resistant sAML cell line", "tag": "attribute" } ], "title": [ { "text": "SET-2-OTX P/R H3K27Ac ChIP Seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14075079", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-10T09:27:14.910Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14075079" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14075079{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14075079/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14075079/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14075079" } } }, { "name": "GSM4340279", "accession": "SAMN14212272", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-18T00:00:00Z", "update": "2022-03-31T23:27:01.520Z", "submitted": "2020-02-26T10:35:11.617Z", "characteristics": { "External Id": [ { "text": "SAMN14212272", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jing Qu, Institute of Zoology, Chinese Academy of Sciences, State Key Laboratory of Stem Cell and Reproductive Biology" } ], "INSDC first public": [ { "text": "2020-06-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-18T02:33:16.297Z" } ], "INSDC secondary accession": [ { "text": "SRS6218926" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6218926" } ], "antibody": [ { "text": "H3K36me3", "tag": "attribute" } ], "cell type": [ { "text": "Neural stem cells", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "p5", "tag": "attribute" } ], "source_name": [ { "text": "Neural stem cells", "tag": "attribute" } ], "title": [ { "text": "H3K36me3 ChIP sequencing of hNSCs [H3K36me3-NSC_rep1_FKDL190743614-1a_H2VVCCCX2_L7]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14212272", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-02-26T10:35:11.617Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212272" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212272{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212272/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14212272/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14212272" } } }, { "name": "GSM4391915", "accession": "SAMN14322328", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-16T00:00:00Z", "update": "2022-04-01T00:00:59.451Z", "submitted": "2020-03-06T17:01:33.490Z", "characteristics": { "External Id": [ { "text": "SAMN14322328", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology Program, Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2021-11-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-16T01:14:31.730Z" } ], "INSDC secondary accession": [ { "text": "SRS6274969" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6274969" } ], "cell line": [ { "text": "JHRCC12", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Abcam, ab8580)", "tag": "attribute" } ], "genotype": [ { "text": "SETD2-proficient", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Clear cell renal cell carcinoma cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000349" ], "tag": "attribute" } ], "title": [ { "text": "ChIP-Seq SETD2_rescue_H3K4me3_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14322328", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-06T17:01:33.490Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322328" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322328{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322328/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14322328/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14322328" } } }, { "name": "GSM4430138", "accession": "SAMN14427981", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-01T00:00:00Z", "update": "2022-04-01T00:34:56.865Z", "submitted": "2020-03-23T13:21:12.447Z", "characteristics": { "External Id": [ { "text": "SAMN14427981", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Javed Khan, Genetics Branch, NCI, NIH" } ], "INSDC first public": [ { "text": "2021-01-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-01T11:39:20.970Z" } ], "INSDC secondary accession": [ { "text": "SRS6357354" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6357354" } ], "antibody/treatment": [ { "text": "anti-human/mouse/Rat SOX2 (pAb, goat, R&D systems cat@#AF2018)", "tag": "attribute" } ], "cell line": [ { "text": "MKL1", "tag": "attribute" } ], "cell type": [ { "text": "Merkel Cell carcinoma (MCC)", "tag": "attribute" } ], "enrichment target": [ { "text": "SOX2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MKL1", "tag": "attribute" } ], "target function": [ { "text": "Transcription Factor", "tag": "attribute" } ], "title": [ { "text": "MKL1 SOX2" } ], "virus status": [ { "text": "positive", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14427981", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14427981", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-23T13:21:12.447Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14427981" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14427981{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14427981/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14427981/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14427981" } } }, { "name": "GSM4430356", "accession": "SAMN14430459", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-05-24T00:00:00Z", "update": "2022-04-01T00:35:45.021Z", "submitted": "2020-03-23T16:08:09Z", "characteristics": { "External Id": [ { "text": "SAMN14430459", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Molecular Oncology, Chiba University" } ], "INSDC first public": [ { "text": "2020-05-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-05-24T02:44:58.217Z" } ], "INSDC secondary accession": [ { "text": "SRS6359406" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6359406" } ], "cell type": [ { "text": "Gastric cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3_ChIP (Millipore, 07-449, lot 28266067)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Gastric cancer cell line", "tag": "attribute" } ], "title": [ { "text": "NCC24_H3K27me3_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14430459", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-23T16:08:09Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14430459" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14430459{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14430459/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14430459/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14430459" } } }, { "name": "GSM4431270", "accession": "SAMN14439608", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-09-09T00:00:00Z", "update": "2022-04-01T00:38:10.711Z", "submitted": "2020-03-24T11:51:09.623Z", "characteristics": { "External Id": [ { "text": "SAMN14439608", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biomedical Statistics and Informatics, Mayo Clinic" } ], "INSDC first public": [ { "text": "2020-09-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-09-09T03:59:24.057Z" } ], "INSDC secondary accession": [ { "text": "SRS6366410" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6366410" } ], "cell type": [ { "text": "prostate cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001663" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit polyclonal anti-HDAC1 #ab7028", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "20-30", "tag": "attribute" } ], "source_name": [ { "text": "prostate", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0002367" ], "tag": "attribute" } ], "title": [ { "text": "PC3 control HDAC1 rep1" } ] }, "submittedVia": "JSON_API", "create": "2020-03-24T11:51:09.623Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14439608" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14439608{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14439608/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14439608/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14439608" } } }, { "name": "GSM4432408", "accession": "SAMN14444859", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-03-25T00:00:00Z", "update": "2022-04-01T00:39:47.170Z", "submitted": "2020-03-24T23:01:03.643Z", "characteristics": { "External Id": [ { "text": "SAMN14444859", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Princess Margaret Cancer Centre" } ], "INSDC first public": [ { "text": "2020-03-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-03-25T02:49:31.427Z" } ], "INSDC secondary accession": [ { "text": "SRS6374448" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6374448" } ], "cell line": [ { "text": "TEX", "tag": "attribute" } ], "cell type": [ { "text": "Acute Myeloid leukemia cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam#ab4729, Lot# GR3231937-1)", "tag": "attribute" } ], "genotype/variation": [ { "text": "MTCH2 knockdown", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "TEX_MTCH2_KD_C646", "tag": "attribute" } ], "title": [ { "text": "MTCH2_KD_C646_R2" } ], "treatment": [ { "text": "C646 (5 µM) for 3 days", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14444859", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-03-24T23:01:03.643Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14444859" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14444859{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14444859/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14444859/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14444859" } } }, { "name": "GSM4445842", "accession": "SAMN14488030", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-11-17T00:00:00Z", "update": "2022-04-01T00:53:18.636Z", "submitted": "2020-03-30T15:13:11.040Z", "characteristics": { "External Id": [ { "text": "SAMN14488030", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Human Genetics, McGill University" } ], "INSDC first public": [ { "text": "2020-11-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-11-17T03:18:23.797Z" } ], "INSDC secondary accession": [ { "text": "SRS6403094" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6403094" } ], "cell line": [ { "text": "HSJ-019", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3 (Cell Signaling Technology, #9733)", "tag": "attribute" } ], "genotype": [ { "text": "H3.3 (H3F3A) K27M", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "brain tumor derived cell line & S2 cells (spike in)", "tag": "attribute" } ], "title": [ { "text": "HSJ019-K27M3_H3K27me3" } ] }, "submittedVia": "JSON_API", "create": "2020-03-30T15:13:11.040Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14488030" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14488030{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14488030/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14488030/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14488030" } } }, { "name": "GSM4487095", "accession": "SAMN14648043", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-08-26T00:00:00Z", "update": "2022-04-01T01:42:46.427Z", "submitted": "2020-04-20T20:32:09.650Z", "characteristics": { "External Id": [ { "text": "SAMN14648043", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chang Lu, Chemical Engineering, Virginia Tech" } ], "INSDC first public": [ { "text": "2020-08-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-08-26T13:02:52.750Z" } ], "INSDC secondary accession": [ { "text": "SRS6507651" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6507651" } ], "cell type": [ { "text": "Breast luminal progenitors", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (abcam, Cat: ab4729, Lot: GR323132-1)", "tag": "attribute" } ], "genotype": [ { "text": "BRCAmut/+", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Breast luminal progenitors", "tag": "attribute" } ], "title": [ { "text": "MUT-3_LP_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14648043", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-20T20:32:09.650Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14648043" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14648043{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14648043/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14648043/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14648043" } } }, { "name": "GSM4489066", "accession": "SAMN14655115", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-17T00:00:00Z", "update": "2022-04-01T01:45:02.704Z", "submitted": "2020-04-21T14:36:07.430Z", "characteristics": { "External Id": [ { "text": "SAMN14655115", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "A8G2 Group - Rheumatology Service, Parc Taulí Research and Innovation Institute (I3PT)" } ], "INSDC first public": [ { "text": "2021-11-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-17T01:44:15.790Z" } ], "INSDC secondary accession": [ { "text": "SRS6512767" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6512767" } ], "cell line": [ { "text": "SCC-25", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006483" ], "tag": "attribute" } ], "cell type": [ { "text": "oral squamous cell carcinoma (OSCC) cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me1 (Abcam, ab8895)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "shrna": [ { "text": "control pLKO.1", "tag": "attribute" } ], "source_name": [ { "text": "SCC-25_post-PA 14D_H3K4me1_ChIPSeq", "tag": "attribute" } ], "title": [ { "text": "21909_SCC-25_H3K4me1_ChIPSeq" } ], "treatment": [ { "text": "post-PA 14D", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14655115", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-21T14:36:07.430Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655115" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655115{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655115/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655115/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14655115" } } }, { "name": "GSM4489528", "accession": "SAMN14655915", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-29T00:00:00Z", "update": "2022-04-01T01:45:19.855Z", "submitted": "2020-04-21T15:51:07.460Z", "characteristics": { "External Id": [ { "text": "SAMN14655915", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UCLouvain" } ], "INSDC first public": [ { "text": "2021-01-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-29T01:25:20.730Z" } ], "INSDC secondary accession": [ { "text": "SRS6514268" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6514268" } ], "cell type": [ { "text": "adipose precursor cells, omental preadipocytes (OPAs)", "tag": "attribute" } ], "chip antibody": [ { "text": "BMAL1 (Abcam, ab3350, GR3285166-5)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "2", "tag": "attribute" } ], "patient diagnosis": [ { "text": "non-obese", "tag": "attribute" } ], "source_name": [ { "text": "preadipocytes from non-obese patient 3", "tag": "attribute" } ], "title": [ { "text": "Non-Obese3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14655915", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14655915", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-21T15:51:07.460Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655915" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655915{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655915/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14655915/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14655915" } } }, { "name": "GSM4491260", "accession": "SAMN14671435", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-09T00:00:00Z", "update": "2022-04-01T01:53:55.100Z", "submitted": "2020-04-22T16:27:08.067Z", "characteristics": { "External Id": [ { "text": "SAMN14671435", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Chia-Lin Wei, Genome Technologies, The Jackson Laboratory" } ], "INSDC first public": [ { "text": "2021-04-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-09T01:50:16.417Z" } ], "INSDC secondary accession": [ { "text": "SRS6520020" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6520020" } ], "ip antibody": [ { "text": "H3K27ac (39133, Active Motif)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source": [ { "text": "Glioblastoma", "tag": "attribute" } ], "source_name": [ { "text": "Glioblastoma neurosphere cell suspensions", "tag": "attribute" } ], "title": [ { "text": "HF-3177_ChIP_H3K27ac.umi" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14671435", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-22T16:27:08.067Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671435" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671435{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671435/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14671435/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14671435" } } }, { "name": "GSM4492083", "accession": "SAMN14677857", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-02T00:00:00Z", "update": "2022-04-01T02:02:33.099Z", "submitted": "2020-04-23T11:03:07.310Z", "characteristics": { "External Id": [ { "text": "SAMN14677857", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Jabado Lab, Department of Pediatrics, McGill University" } ], "INSDC first public": [ { "text": "2020-10-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-02T07:26:29.540Z" } ], "INSDC secondary accession": [ { "text": "SRS6524765" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6524765" } ], "cell line": [ { "text": "Im-GCT-4072", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K36me3 (Mouse monoclonal/GeneTex MABI0333-GTX50908)", "tag": "attribute" } ], "genotype": [ { "text": "G34W repair to WT", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Tumor-derived cell-line", "tag": "attribute" } ], "title": [ { "text": "Im-GCT-4072__D6__p8__G34W-repair__H3K36me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14677857", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-23T11:03:07.310Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14677857" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14677857{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14677857/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14677857/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14677857" } } }, { "name": "GSM4508630", "accession": "SAMN14783516", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-02-09T00:00:00Z", "update": "2022-04-01T02:34:18.004Z", "submitted": "2020-04-30T16:27:08.470Z", "characteristics": { "External Id": [ { "text": "SAMN14783516", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Human Genetics, McGill University" } ], "INSDC first public": [ { "text": "2021-02-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-02-09T02:22:22.863Z" } ], "INSDC secondary accession": [ { "text": "SRS6576294" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6576294" } ], "cell line": [ { "text": "Cal-27", "tag": "attribute" } ], "cell type": [ { "text": "Patient-derived head and neck squamous cell carcinoma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Cell Signaling, 8173)", "tag": "attribute" } ], "genotype": [ { "text": "NSD1 knock-out", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cal-27 cells & S2 cells (spiked-in)", "tag": "attribute" } ], "title": [ { "text": "Cal27_KO1_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14783516", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14783516", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-04-30T16:27:08.470Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14783516" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14783516{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14783516/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14783516/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14783516" } } }, { "name": "GSM4518129", "accession": "SAMN14840221", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-21T00:00:00Z", "update": "2022-04-01T02:50:38.273Z", "submitted": "2020-05-06T08:28:05.563Z", "characteristics": { "External Id": [ { "text": "SAMN14840221", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Prof. Wendy Bickmore, Human Genetics Unit, MRC" } ], "INSDC first public": [ { "text": "2020-07-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-21T02:27:25.380Z" } ], "INSDC secondary accession": [ { "text": "SRS6599625" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6599625" } ], "antibody": [ { "text": "anti-DDX21 (Proteintech cat no. 10528-1-AP)", "tag": "attribute" } ], "cell line": [ { "text": "A375 cells expressing HA-tagged PRL3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cultured A375 melanoma cells", "tag": "attribute" } ], "title": [ { "text": "DDX21_IP_PRL3_1_SetB" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14840221", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-06T08:28:05.563Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14840221" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14840221{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14840221/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14840221/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14840221" } } }, { "name": "ChIP_AC_H3K27ac_rep2", "accession": "SAMN14854036", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-23T18:41:13.900Z", "update": "2023-05-14T19:36:07.875Z", "submitted": "2020-05-08T09:12:04.343Z", "characteristics": { "External Id": [ { "text": "SAMN14854036", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Xi'an Jiaotong University" } ], "INSDC first public": [ { "text": "2022-08-23T18:41:13.900Z" } ], "INSDC last update": [ { "text": "2022-08-23T18:41:13.900Z" } ], "INSDC secondary accession": [ { "text": "SRS6612666" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Human" } ], "NCBI submission package": [ { "text": "Human.1.0" } ], "SRA accession": [ { "text": "SRS6612666" } ], "age": [ { "text": "0", "tag": "attribute" } ], "antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "biomaterial_provider": [ { "text": "Shaanxi Stem Cell Institute/Xi'an Jiaotong University", "tag": "attribute" } ], "cell_type": [ { "text": "adipocytes differentiated from mesenchymal stem cells", "tag": "attribute" } ], "dev_stage": [ { "text": "D15", "tag": "attribute" } ], "isolate": [ { "text": "UC_1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "replicate 2", "tag": "attribute" } ], "sex": [ { "text": "male", "tag": "attribute" } ], "tissue": [ { "text": "umbilical cord", "tag": "attribute" } ], "title": [ { "text": "Human sample from Homo sapiens" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2020-05-08T09:12:04.343Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14854036" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14854036{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14854036/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14854036/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14854036" } } }, { "name": "GSM4550484", "accession": "SAMN14906822", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-05T00:00:00Z", "update": "2022-04-01T03:10:54.301Z", "submitted": "2020-05-12T16:36:06.503Z", "characteristics": { "External Id": [ { "text": "SAMN14906822", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wei Wei, Department of Molecular and Medical Pharmaacology, University of California, Los Angeles" } ], "INSDC first public": [ { "text": "2020-06-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-05T02:24:19.683Z" } ], "INSDC secondary accession": [ { "text": "SRS6652593" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6652593" } ], "cell line": [ { "text": "M397", "tag": "attribute" } ], "cell type": [ { "text": "Patient-derived melanoma cell lines", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (Millipore, 07-473)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "M397", "tag": "attribute" } ], "title": [ { "text": "M397_Drug_removal K4_H3K4me3_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN14906822", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-12T16:36:06.503Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14906822" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14906822{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14906822/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14906822/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14906822" } } }, { "name": "GSM4563926", "accession": "SAMN14992810", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-01T00:00:00Z", "update": "2022-04-01T03:41:41.082Z", "submitted": "2020-05-21T14:06:26.783Z", "characteristics": { "External Id": [ { "text": "SAMN14992810", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Neuroscience, UT Southwestern Medical Center" } ], "INSDC first public": [ { "text": "2021-05-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-01T02:39:17.523Z" } ], "INSDC secondary accession": [ { "text": "SRS6691756" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6691756" } ], "antibody": [ { "text": "H3K27ac (Abcam, Ab4729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "9-12", "tag": "attribute" } ], "source_name": [ { "text": "LX48 hPDX", "tag": "attribute" } ], "tissue/cell line": [ { "text": "JHU-LX48-SCLC PDX", "tag": "attribute" } ], "tissue/cell type": [ { "text": "Small cell lung cancer PDX flank", "tag": "attribute" } ], "title": [ { "text": "LX48 hPDX H3K27ac ChIP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN14992810", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-21T14:06:26.783Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14992810" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14992810{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14992810/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN14992810/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN14992810" } } }, { "name": "GSM4566043", "accession": "SAMN15000038", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-30T00:00:00Z", "update": "2022-04-01T03:44:09.322Z", "submitted": "2020-05-22T16:49:08.133Z", "characteristics": { "External Id": [ { "text": "SAMN15000038", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Ghent University" } ], "INSDC first public": [ { "text": "2020-07-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-30T01:55:19.610Z" } ], "INSDC secondary accession": [ { "text": "SRS6697319" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6697319" } ], "cell population": [ { "text": "DP CD3+", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Diagenode, C15410174)", "tag": "attribute" } ], "donor": [ { "text": "D1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005236" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sort phenotype": [ { "text": "CD4+ CD8+ CD3+", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005180" ], "tag": "attribute" } ], "source_name": [ { "text": "Human postnatal thymus", "tag": "attribute" } ], "tissue": [ { "text": "postnatal thymus", "tag": "attribute" } ], "title": [ { "text": "H3K27ac - DP CD3+ donor Th1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15000038", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-22T16:49:08.133Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15000038" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15000038{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15000038/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15000038/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15000038" } } }, { "name": "GSM4569863", "accession": "SAMN15032517", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-06-17T00:00:00Z", "update": "2022-04-01T03:53:46.861Z", "submitted": "2020-05-27T11:48:05.620Z", "characteristics": { "External Id": [ { "text": "SAMN15032517", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dana Faber Cancer Institute" } ], "INSDC first public": [ { "text": "2020-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-06-17T01:49:19.360Z" } ], "INSDC secondary accession": [ { "text": "SRS6718846" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6718846" } ], "chip antibody": [ { "text": "AR", "tag": "attribute" } ], "chip antibody vendor": [ { "text": "Santa Cruz Biotechnology", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CRPC PDX", "tag": "attribute" } ], "tissue": [ { "text": "CRPC pdx", "tag": "attribute" } ], "title": [ { "text": "AR_UW_PDX_167" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15032517", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-05-27T11:48:05.620Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15032517" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15032517{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15032517/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15032517/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15032517" } } }, { "name": "GSM4594329", "accession": "SAMN15159705", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-10T00:00:00Z", "update": "2022-04-01T05:07:26.336Z", "submitted": "2020-06-07T13:12:03.990Z", "characteristics": { "External Id": [ { "text": "SAMN15159705", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Michael T. Hemann, Koch Institute, Massachusetts Institute of Technology" } ], "INSDC first public": [ { "text": "2021-11-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-10T01:23:44.290Z" } ], "INSDC secondary accession": [ { "text": "SRS6787677" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6787677" } ], "cell line": [ { "text": "SUM-229PE", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006762" ], "tag": "attribute" } ], "cell type": [ { "text": "Triple-Negative Breast Cancer Cell Line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Active Motif cat. # 39133)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "15-18", "tag": "attribute" } ], "source_name": [ { "text": "Pleural effusion", "tag": "attribute" } ], "subpopulation": [ { "text": "POSR", "tag": "attribute" } ], "title": [ { "text": "POSR1 H3K27ac Replicate 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15159705", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-07T13:12:03.990Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15159705" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15159705{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15159705/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15159705/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15159705" } } }, { "name": "GSM4613171", "accession": "SAMN15222141", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-23T00:00:00Z", "update": "2022-04-01T05:32:38.544Z", "submitted": "2020-06-12T08:46:08.283Z", "characteristics": { "External Id": [ { "text": "SAMN15222141", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mitchell J. Weiss, Department of Hematology, St. Jude Children’s Research Hospital" } ], "INSDC first public": [ { "text": "2021-04-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-23T04:06:18.187Z" } ], "INSDC secondary accession": [ { "text": "SRS6831073" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6831073" } ], "antibody": [ { "text": "GATA1", "ontologyTerms": [ "http://www.orpha.net/ORDO/Orphanet_67044" ], "tag": "attribute" } ], "cell line": [ { "text": "Hudep2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "GATA1_13nt_rep2", "tag": "attribute" } ], "title": [ { "text": "GATA1_13nt_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15222141", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-06-12T08:46:08.283Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15222141" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15222141{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15222141/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15222141/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15222141" } } }, { "name": "GSM4648983", "accession": "SAMN15419857", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-29T00:00:00Z", "update": "2023-05-14T22:02:06.474Z", "submitted": "2020-07-01T16:51:03.207Z", "characteristics": { "External Id": [ { "text": "SAMN15419857", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Choi Lab, Pathology, The Children's Hospital of Philadelphia" } ], "INSDC first public": [ { "text": "2022-01-29T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-29T01:26:20.887Z" } ], "INSDC secondary accession": [ { "text": "SRS6934659" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6934659" } ], "antibody": [ { "text": "AR, Abcam, ab74272", "tag": "attribute" } ], "cell line": [ { "text": "LNCaP", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002071" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "LNCaP cells", "tag": "attribute" } ], "title": [ { "text": "shLacZ_AR-IP_Rep2" } ], "treatment": [ { "text": "shLacZ", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15419857", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-07-01T16:51:03.207Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15419857" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15419857{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15419857/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15419857/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15419857" } } }, { "name": "GSM4663988", "accession": "SAMN15496501", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-04T00:00:00Z", "update": "2022-04-01T07:39:48.751Z", "submitted": "2020-07-09T14:52:36.567Z", "characteristics": { "External Id": [ { "text": "SAMN15496501", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Genomic Regulation (CRG)" } ], "INSDC first public": [ { "text": "2021-09-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-04T01:19:16.220Z" } ], "INSDC secondary accession": [ { "text": "SRS6978732" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS6978732" } ], "chip antibody": [ { "text": "H3K4me3 (Diagenode # C15410003-50)", "tag": "attribute" } ], "drosophila spike-in": [ { "text": "YES", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3K4me3_CTL_HCTR13", "tag": "attribute" } ], "status": [ { "text": "CTL", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000625" ], "tag": "attribute" } ], "tissue": [ { "text": "visceral adipose tissue", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004765" ], "tag": "attribute" } ], "title": [ { "text": "H3K4me3_CTL_HCTR13" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15496501", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-07-09T14:52:36.567Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15496501" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15496501{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15496501/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15496501/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15496501" } } }, { "name": "GSM4684994", "accession": "SAMN15618047", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-09T00:00:00Z", "update": "2022-04-01T08:20:22.935Z", "submitted": "2020-07-23T09:41:06.957Z", "characteristics": { "External Id": [ { "text": "SAMN15618047", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "316H, Hematology, children's hospital of philadelphia" } ], "INSDC first public": [ { "text": "2020-12-09T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-09T02:09:16.567Z" } ], "INSDC secondary accession": [ { "text": "SRS7072215" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7072215" } ], "cell type": [ { "text": "Three-phase in vitro culture of CD34+ primay human cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam, ab4729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Primary CD34+ cell culture", "tag": "attribute" } ], "title": [ { "text": "CD34+ day9_H3K27ac rep2 (ChIP-seq)" } ], "treatment": [ { "text": "primary human CD34+ cell at day 9 of differentiation", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15618047", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-07-23T09:41:06.957Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15618047" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15618047{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15618047/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15618047/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15618047" } } }, { "name": "GSM4699150", "accession": "SAMN15664611", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-07-30T00:00:00Z", "update": "2022-04-01T08:40:59.400Z", "submitted": "2020-07-29T00:31:10.880Z", "characteristics": { "External Id": [ { "text": "SAMN15664611", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UCSF" } ], "INSDC first public": [ { "text": "2020-07-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-07-30T02:13:16.700Z" } ], "INSDC secondary accession": [ { "text": "SRS7104768" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7104768" } ], "antibody": [ { "text": "CTCF (Active Motif, catalog no. 61311)", "tag": "attribute" } ], "cell type": [ { "text": "Lymphoblast cells", "tag": "attribute" } ], "condition": [ { "text": "Normal", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CTCF-ChIP-seq-WT", "tag": "attribute" } ], "title": [ { "text": "CTCF-ChIP-seq-WT-rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15664611", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-07-29T00:31:10.880Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15664611" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15664611{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15664611/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15664611/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15664611" } } }, { "name": "GSM4703946", "accession": "SAMN15676166", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-22T00:00:00Z", "update": "2022-04-01T08:48:35.425Z", "submitted": "2020-07-29T23:43:12.793Z", "characteristics": { "External Id": [ { "text": "SAMN15676166", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Stem Cell Epigenomics, Oncology, Wayne State University" } ], "INSDC first public": [ { "text": "2021-01-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-22T02:47:26.997Z" } ], "INSDC secondary accession": [ { "text": "SRS7111341" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7111341" } ], "cell line": [ { "text": "EKVX", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006786" ], "tag": "attribute" } ], "cell type": [ { "text": "cancer cell", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-H4K20me3 antibody (Abcam; ab9053)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "EKVX", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006786" ], "tag": "attribute" } ], "title": [ { "text": "H4K20me3_LC_EKVX_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15676166", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN15676166", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-07-29T23:43:12.793Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15676166" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15676166{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15676166/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15676166/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15676166" } } }, { "name": "GSM4728709", "accession": "SAMN15825317", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-31T00:00:00Z", "update": "2022-04-01T09:43:02.851Z", "submitted": "2020-08-15T11:32:05.133Z", "characteristics": { "External Id": [ { "text": "SAMN15825317", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mayo Clinic" } ], "INSDC first public": [ { "text": "2021-12-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-31T02:35:22.650Z" } ], "INSDC secondary accession": [ { "text": "SRS7207180" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7207180" } ], "antibody": [ { "text": "H3K9me3_ChIP-seq", "tag": "attribute" } ], "cell line": [ { "text": "451Lu", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002828" ], "tag": "attribute" } ], "genotype": [ { "text": "vector; NT control", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Melanoma cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0000849" ], "tag": "attribute" } ], "title": [ { "text": "H3K9me3_451Lu_vector_NT_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15825317", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-08-15T11:32:05.133Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825317" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825317{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825317/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15825317/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15825317" } } }, { "name": "GSM4733295", "accession": "SAMN15865898", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-22T00:00:00Z", "update": "2022-04-01T09:52:10.386Z", "submitted": "2020-08-20T11:56:09.673Z", "characteristics": { "External Id": [ { "text": "SAMN15865898", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Room 1027B, GSRB1, Pathology, Duke University" } ], "INSDC first public": [ { "text": "2020-10-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-22T09:59:16.817Z" } ], "INSDC secondary accession": [ { "text": "SRS7231916" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7231916" } ], "cell line": [ { "text": "ESCC cell line KYSE410", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-NCOR2/SMRT antibody (ab24551) from abcam", "tag": "attribute" } ], "disease state": [ { "text": "esophageal squamous cell carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005922" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "human esophagus", "tag": "attribute" } ], "title": [ { "text": "SMART_ChIP_R1881_rep1" } ], "treatment": [ { "text": "R1881, 4h", "tag": "attribute" } ] }, "submittedVia": "JSON_API", "create": "2020-08-20T11:56:09.673Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15865898" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15865898{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15865898/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15865898/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15865898" } } }, { "name": "GSM4733754", "accession": "SAMN15866933", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-22T00:00:00Z", "update": "2022-04-01T09:52:39.616Z", "submitted": "2020-08-20T13:35:07.017Z", "characteristics": { "External Id": [ { "text": "SAMN15866933", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "William Carroll, Medicine, NYU Langone Health" } ], "INSDC first public": [ { "text": "2020-12-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-22T07:58:17.250Z" } ], "INSDC secondary accession": [ { "text": "SRS7232535" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7232535" } ], "age": [ { "text": "6", "tag": "attribute" } ], "cohort": [ { "text": "cohort B", "tag": "attribute" } ], "diagnosis/relapse": [ { "text": "relapse", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0004952" ], "tag": "attribute" } ], "ip antibody": [ { "text": "H3K9ac Millipore #Mi 06-942", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "patient id": [ { "text": "PAUVRA", "tag": "attribute" } ], "source_name": [ { "text": "B-ALL patient sample", "tag": "attribute" } ], "tissue": [ { "text": "bone marrow", "tag": "attribute" } ], "title": [ { "text": "PAUVRA-R-H3K9ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15866933", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-08-20T13:35:07.017Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15866933" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15866933{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15866933/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15866933/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15866933" } } }, { "name": "GSM4752897", "accession": "SAMN15934471", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-07T00:00:00Z", "update": "2023-05-15T00:08:42.253Z", "submitted": "2020-08-28T16:53:04.877Z", "characteristics": { "External Id": [ { "text": "SAMN15934471", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Applied Bioinformatics, St Jude Children's Research Hospital" } ], "INSDC first public": [ { "text": "2022-09-07T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-09-07T02:02:43.967Z" } ], "INSDC secondary accession": [ { "text": "SRS7282910" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7282910" } ], "cell line": [ { "text": "RH30", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9Me3 (Millipore, 07-442)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "cell line", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq_RH30-QC6352-Millipore.H3K9me3-02" } ], "treatment": [ { "text": "QC6352 200nM treatment", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN15934471", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-08-28T16:53:04.877Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15934471" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15934471{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15934471/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN15934471/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN15934471" } } }, { "name": "GSM4781028", "accession": "SAMN16130003", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-01T00:00:00Z", "update": "2022-04-01T11:32:37.206Z", "submitted": "2020-09-14T17:56:10.590Z", "characteristics": { "External Id": [ { "text": "SAMN16130003", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Translational Genomics Research Institute" } ], "INSDC first public": [ { "text": "2021-01-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-01T11:42:23.393Z" } ], "INSDC secondary accession": [ { "text": "SRS7363089" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7363089" } ], "antibody": [ { "text": "H3K27ac from Active Motif (Cat. #39133)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Isolated from a pancreatic tumor", "tag": "attribute" } ], "title": [ { "text": "Pancreatic cancer associated fibroblasts CAF08 - H3K27ac - untreated Input" } ], "treatment": [ { "text": "Input", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005031" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16130003", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN16130003", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-09-14T17:56:10.590Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16130003" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16130003{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16130003/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16130003/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16130003" } } }, { "name": "GSM4819852", "accession": "SAMN16380772", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-01T00:00:00Z", "update": "2022-04-01T12:52:37.920Z", "submitted": "2020-10-06T15:05:05.297Z", "characteristics": { "External Id": [ { "text": "SAMN16380772", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NDM Research Building, Nuffield Department of Medicine, University of Oxford" } ], "INSDC first public": [ { "text": "2021-05-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-01T02:46:21.477Z" } ], "INSDC secondary accession": [ { "text": "SRS7483632" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7483632" } ], "ambient o2": [ { "text": "21%", "tag": "attribute" } ], "cell line": [ { "text": "HeLa", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001185" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (cell signaling) rabbit mAb #9751", "tag": "attribute" } ], "genotype": [ { "text": "control", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Hela cells_control_CRISPR", "tag": "attribute" } ], "title": [ { "text": "S01_ControlNormoxiaChIP" } ], "treatment time": [ { "text": "6 hours", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_5417" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16380772", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-06T15:05:05.297Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16380772" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16380772{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16380772/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16380772/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16380772" } } }, { "name": "GSM4832376", "accession": "SAMN16475034", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-06-01T00:00:00Z", "update": "2022-04-01T13:17:27.428Z", "submitted": "2020-10-19T14:17:07.573Z", "characteristics": { "External Id": [ { "text": "SAMN16475034", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Wilbert Zwart Group, Oncogenomics, Netherlands Cancer Institute" } ], "INSDC first public": [ { "text": "2021-06-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-06-01T04:59:28.227Z" } ], "INSDC secondary accession": [ { "text": "SRS7534376" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7534376" } ], "chip antibody": [ { "text": "GR Ab", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "1", "tag": "attribute" } ], "source_name": [ { "text": "Lung cancer cell line", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002934" ], "tag": "attribute" } ], "title": [ { "text": "A549 Vehicle Rep 1 GR-ChIP seq" } ], "treatment": [ { "text": "Vehicle", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000732" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16475034", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-19T14:17:07.573Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16475034" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16475034{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16475034/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16475034/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16475034" } } }, { "name": "GSM4836843", "accession": "SAMN16483362", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-24T00:00:00Z", "update": "2023-05-15T04:04:31.033Z", "submitted": "2020-10-20T07:26:07.320Z", "characteristics": { "External Id": [ { "text": "SAMN16483362", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Azim Surani, Gurdon Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2022-01-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-24T01:26:15.477Z" } ], "INSDC secondary accession": [ { "text": "SRS7541214" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7541214" } ], "cell source": [ { "text": "hESC-derived", "tag": "attribute" } ], "cell type": [ { "text": "Human primordial germ cell-like cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Active Motif, 39134, lot 20017009)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Human primordial germ cell-like cells", "tag": "attribute" } ], "title": [ { "text": "H3K27ac_hPGCLC_d4_r1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16483362", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-10-20T07:26:07.320Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483362" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483362{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483362/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16483362/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16483362" } } }, { "name": "GSM4837713", "accession": "SAMN16485790", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-14T00:00:00Z", "update": "2022-04-01T13:22:10.707Z", "submitted": "2020-10-20T13:32:07.380Z", "characteristics": { "External Id": [ { "text": "SAMN16485790", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Leukemia Biology, Manchester Institute, Cancer Research UK" } ], "INSDC first public": [ { "text": "2021-08-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-14T05:37:16.083Z" } ], "INSDC secondary accession": [ { "text": "SRS7542515" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7542515" } ], "agent": [ { "text": "non-targeting control (NTC)", "tag": "attribute" } ], "antibody": [ { "text": "P300", "tag": "attribute" } ], "cell line": [ { "text": "Fujioka", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Fujioka cells", "tag": "attribute" } ], "title": [ { "text": "TS120_P300_NTC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16485790", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-20T13:32:07.380Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16485790" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16485790{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16485790/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16485790/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16485790" } } }, { "name": "GSM4838090", "accession": "SAMN16489400", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-10-21T00:00:00Z", "update": "2022-04-01T13:23:02.696Z", "submitted": "2020-10-20T15:56:19.990Z", "characteristics": { "External Id": [ { "text": "SAMN16489400", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Columbia University" } ], "INSDC first public": [ { "text": "2020-10-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-10-21T06:07:18.180Z" } ], "INSDC secondary accession": [ { "text": "SRS7543208" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7543208" } ], "chip antibody": [ { "text": "TOP2B", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Glioma cells", "tag": "attribute" } ], "title": [ { "text": "TOP2B_1523_ETO" } ] }, "submittedVia": "JSON_API", "create": "2020-10-20T15:56:19.990Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16489400" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16489400{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16489400/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16489400/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16489400" } } }, { "name": "GSM4849115", "accession": "SAMN16517495", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-26T00:00:00Z", "update": "2022-04-01T13:31:52.896Z", "submitted": "2020-10-22T15:49:12.837Z", "characteristics": { "External Id": [ { "text": "SAMN16517495", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "WIMM, Oxford University" } ], "INSDC first public": [ { "text": "2021-03-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-26T02:51:17.197Z" } ], "INSDC secondary accession": [ { "text": "SRS7567100" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7567100" } ], "antibody": [ { "text": "anti-trimethyl-Histone H3 (Lys4) antibody 07-473 (Merck Millipore)", "tag": "attribute" } ], "cell type": [ { "text": "Erythroid", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000232" ], "tag": "attribute" } ], "differentiation day": [ { "text": "Day 21", "tag": "attribute" } ], "genotype": [ { "text": "Wild type", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005168" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "iPSC diffrentiation to Erythroid cells", "tag": "attribute" } ], "title": [ { "text": "ChIP_H3K4me3_Ery_iPSC_WT_SBAD02_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16517495", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-22T15:49:12.837Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517495" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517495{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517495/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16517495/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16517495" } } }, { "name": "GSM4851833", "accession": "SAMN16532773", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-04T00:00:00Z", "update": "2022-04-01T13:33:58.480Z", "submitted": "2020-10-23T14:26:05.887Z", "characteristics": { "External Id": [ { "text": "SAMN16532773", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Computational Biology, Center for Brain and Disease Research, VIB" } ], "INSDC first public": [ { "text": "2021-03-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-04T01:54:19.193Z" } ], "INSDC secondary accession": [ { "text": "SRS7574042" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7574042" } ], "cell line": [ { "text": "MM099", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005724" ], "tag": "attribute" } ], "cell type": [ { "text": "melanoma cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0000849" ], "tag": "attribute" } ], "chip antibody": [ { "text": "c-Fos antibody (sc-166940 X, Santa Cruz Biotechnology)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MM099 ChIP-seq cFos", "tag": "attribute" } ], "title": [ { "text": "MM099 ChIP-seq cFos" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16532773", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN16532773", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-10-23T14:26:05.887Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16532773" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16532773{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16532773/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16532773/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16532773" } } }, { "name": "GSM4874839", "accession": "SAMN16607276", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-19T00:00:00Z", "update": "2023-05-15T04:31:45.962Z", "submitted": "2020-10-30T13:51:15.103Z", "characteristics": { "External Id": [ { "text": "SAMN16607276", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Porse lab, Finsen Laboratory and BRIC, University of Copenhagen" } ], "INSDC first public": [ { "text": "2022-03-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-19T01:32:46.640Z" } ], "INSDC secondary accession": [ { "text": "SRS7624689" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7624689" } ], "antibody": [ { "text": "H3K9me3 (C15500003, Diagenode)", "tag": "attribute" } ], "cell line": [ { "text": "U937", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001257" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "U937_SUV39H1 shRNA", "tag": "attribute" } ], "title": [ { "text": "shRNA1_rep1_h3k9me3" } ], "treatment": [ { "text": "SUV39H1 shRNA #1", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16607276", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-10-30T13:51:15.103Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16607276" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16607276{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16607276/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16607276/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16607276" } } }, { "name": "GSM4948685", "accession": "SAMN16949844", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-04-01T00:00:00Z", "update": "2022-04-01T15:55:11.294Z", "submitted": "2020-11-28T15:01:07.770Z", "characteristics": { "External Id": [ { "text": "SAMN16949844", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Cancer Research UK Cambridge Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2021-04-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-04-01T15:33:22.730Z" } ], "INSDC secondary accession": [ { "text": "SRS7804820" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7804820" } ], "cell line": [ { "text": "K562 cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002067" ], "tag": "attribute" } ], "chip antibody": [ { "text": "BG4", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "cultured K562 cells", "tag": "attribute" } ], "title": [ { "text": "no_TPL_1hr_rep2.bio4" } ], "treatment": [ { "text": "treated with DMSO (0.1% v/v) for 1 hr", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16949844", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-11-28T15:01:07.770Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16949844" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16949844{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16949844/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16949844/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16949844" } } }, { "name": "GSM4955625", "accession": "SAMN16989373", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-01-05T00:00:00Z", "update": "2022-04-01T16:04:52.135Z", "submitted": "2020-12-03T15:01:08.957Z", "characteristics": { "External Id": [ { "text": "SAMN16989373", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics, University of North Carolina Chapel Hill" } ], "INSDC first public": [ { "text": "2021-01-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-01-05T02:59:17.413Z" } ], "INSDC secondary accession": [ { "text": "SRS7829232" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7829232" } ], "antibody": [ { "text": "c-Jun", "tag": "attribute" } ], "cell line": [ { "text": "SCCOHT-1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SCCOHT-1 Ovarian Cancer Cell Line", "tag": "attribute" } ], "title": [ { "text": "HT1_BRG1_c-Jun_JR646" } ], "transfected vector": [ { "text": "BRG1", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN16989373", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN16989373", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-03T15:01:08.957Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16989373" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16989373{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16989373/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN16989373/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN16989373" } } }, { "name": "GSM4971624", "accession": "SAMN17061504", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2020-12-12T00:00:00Z", "update": "2022-04-01T16:24:11.627Z", "submitted": "2020-12-11T13:21:05.953Z", "characteristics": { "External Id": [ { "text": "SAMN17061504", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for Genomic Medicine, Nationwide Children's Hospital" } ], "INSDC first public": [ { "text": "2020-12-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2020-12-12T11:58:22.020Z" } ], "INSDC secondary accession": [ { "text": "SRS7873278" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7873278" } ], "antibody": [ { "text": "Cell Signaling #2880", "tag": "attribute" } ], "cell type": [ { "text": "Immortalized myoblast", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Dbt/iP3F", "tag": "attribute" } ], "title": [ { "text": "Dbt/iP3F - 24 hr Dox - PAX3-FOXO1 ChIP" } ], "treatment": [ { "text": "500 ng/mL doxycycline, 24 hr", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17061504", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17061504", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-11T13:21:05.953Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17061504" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17061504{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17061504/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17061504/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17061504" } } }, { "name": "GSM4974196", "accession": "SAMN17078476", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-25T00:00:00Z", "update": "2022-04-01T16:27:13.569Z", "submitted": "2020-12-14T13:08:05.003Z", "characteristics": { "External Id": [ { "text": "SAMN17078476", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Edinburgh" } ], "INSDC first public": [ { "text": "2021-03-25T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-25T02:58:22.770Z" } ], "INSDC secondary accession": [ { "text": "SRS7881945" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7881945" } ], "cell line": [ { "text": "GBM002", "tag": "attribute" } ], "cell type": [ { "text": "Paediatric glioblastoma cell", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85045" ], "tag": "attribute" } ], "disease state": [ { "text": "Cancer", "tag": "attribute" } ], "genotype": [ { "text": "G34R KO", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "pHGG", "tag": "attribute" } ], "tissue": [ { "text": "pHGG", "tag": "attribute" } ], "title": [ { "text": "Paediatric glioblastoma cell GBM002-P1C8 H3K27me3 G34R KO rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17078476", "duo": [] } ], "submittedVia": "JSON_API", "create": "2020-12-14T13:08:05.003Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17078476" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17078476{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17078476/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17078476/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17078476" } } }, { "name": "GSM4979930", "accession": "SAMN17113237", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-12T00:00:00Z", "update": "2023-05-15T09:37:01.620Z", "submitted": "2020-12-18T11:02:12Z", "characteristics": { "External Id": [ { "text": "SAMN17113237", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Vanharanta, MRC Cancer Unit, University of Cambridge" } ], "INSDC first public": [ { "text": "2022-03-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-12T01:13:05.340Z" } ], "INSDC secondary accession": [ { "text": "SRS7898210" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7898210" } ], "cell line": [ { "text": "OS-LM1", "tag": "attribute" } ], "chip antibody": [ { "text": "PAX8 (ProteinTech 10336-1-AP)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ccRCC xenograft", "tag": "attribute" } ], "tissue": [ { "text": "ccRCC xenograft", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq_PAX8_OS-LM1_3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17113237", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-12-18T11:02:12Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113237" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113237{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113237/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17113237/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17113237" } } }, { "name": "GSM4986963", "accession": "SAMN17147423", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-12-02T00:00:00Z", "update": "2023-05-15T10:00:51.151Z", "submitted": "2020-12-23T13:38:05.780Z", "characteristics": { "External Id": [ { "text": "SAMN17147423", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Berger, CDB, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-12-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-12-02T01:37:34.470Z" } ], "INSDC secondary accession": [ { "text": "SRS7917477" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7917477" } ], "cell line": [ { "text": "lung avleolar type 2 cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "AT2 SARS-CoV2 infection replicate r4 ChIP of K27m3", "tag": "attribute" } ], "title": [ { "text": "AT2 SARS-CoV2 infection replicate r4 ChIP of K27m3" } ], "treatment": [ { "text": "SARS-CoV2 infection", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17147423", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-12-23T13:38:05.780Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17147423" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17147423{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17147423/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17147423/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17147423" } } }, { "name": "GSM4989350", "accession": "SAMN17168536", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-30T00:00:00Z", "update": "2023-05-15T10:08:40.010Z", "submitted": "2020-12-27T16:51:08.163Z", "characteristics": { "External Id": [ { "text": "SAMN17168536", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MGH" } ], "INSDC first public": [ { "text": "2022-06-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-30T01:52:39.490Z" } ], "INSDC secondary accession": [ { "text": "SRS7937407" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS7937407" } ], "cell type": [ { "text": "MSC", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27Ac antibody (Active motif, cat#39133, lot#16119013)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3K27Ac ChIP in MSC transduced with EWS-FLI1", "tag": "attribute" } ], "title": [ { "text": "H3K27Ac ChIP in MSC transduced with EWS-FLI1_replicate1" } ], "treatment": [ { "text": "transduced with EWS-FLI1", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17168536", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2020-12-27T16:51:08.163Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17168536" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17168536{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17168536/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17168536/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17168536" } } }, { "name": "GSM5013866", "accession": "SAMN17283437", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-01T00:00:00Z", "update": "2022-04-01T17:36:39.683Z", "submitted": "2021-01-11T10:21:06.227Z", "characteristics": { "External Id": [ { "text": "SAMN17283437", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "IEO" } ], "INSDC first public": [ { "text": "2021-12-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-01T06:07:30.833Z" } ], "INSDC secondary accession": [ { "text": "SRS8004250" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8004250" } ], "cell type": [ { "text": "NB4 transduced with the lentiviral pLEX_307-GSE1 construct, which contains the GSE1 transcript variant 2 (NM_001134473.3)", "tag": "attribute" } ], "chip antibody": [ { "text": "V5 antibody (Abcam, ab9116)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "NB4 cell line", "tag": "attribute" } ], "title": [ { "text": "V5 GSE1 DMSO ChIP" } ], "treatment": [ { "text": "treated for 24h with DMSO (control)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17283437", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-11T10:21:06.227Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17283437" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17283437{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17283437/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17283437/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17283437" } } }, { "name": "GSM5017148", "accession": "SAMN17298123", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-12T00:00:00Z", "update": "2023-05-15T11:55:12.135Z", "submitted": "2021-01-12T14:54:05.600Z", "characteristics": { "External Id": [ { "text": "SAMN17298123", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Colorado, Denver - Anschutz Medical Campus" } ], "INSDC first public": [ { "text": "2022-01-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-12T01:27:48.800Z" } ], "INSDC secondary accession": [ { "text": "SRS8018532" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8018532" } ], "cell line": [ { "text": "D458", "tag": "attribute" } ], "chip antibody": [ { "text": "Myc; Cell Signaling Technology; Cat. #13987;RRID:AB_2631168", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Medulloblastoma", "tag": "attribute" } ], "title": [ { "text": "Myc_D458_with_THZ1" } ], "treatment": [ { "text": "THZ1 (10nM)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17298123", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-01-12T14:54:05.600Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17298123" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17298123{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17298123/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17298123/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17298123" } } }, { "name": "GSM5020869", "accession": "SAMN17315697", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-06T00:00:00Z", "update": "2022-04-01T17:48:58.403Z", "submitted": "2021-01-14T12:37:14.380Z", "characteristics": { "External Id": [ { "text": "SAMN17315697", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Northwestern University" } ], "INSDC first public": [ { "text": "2021-03-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-07T16:19:25.713Z" } ], "INSDC secondary accession": [ { "text": "SRS8031517" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8031517" } ], "cell line": [ { "text": "Kasumi-3", "tag": "attribute" } ], "chip antibody": [ { "text": "Acetyl-Histone H3 (Lys27) (D5E4) XP Rabbit mAb #8173 (Cell Signaling Technologies)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H3K27Ac_24hpi GFP+ rep_3", "tag": "attribute" } ], "title": [ { "text": "H3K27Ac_24hpi_Rep3" } ], "treatment": [ { "text": "live GFP+ infected, 24hpi", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17315697", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17315697", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-14T12:37:14.380Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17315697" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17315697{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17315697/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17315697/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17315697" } } }, { "name": "GSM5021091", "accession": "SAMN17316251", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-08T00:00:00Z", "update": "2022-04-01T17:49:06.256Z", "submitted": "2021-01-14T13:36:05.700Z", "characteristics": { "External Id": [ { "text": "SAMN17316251", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Genetics and Genome Sciences, Case Western Reserve University" } ], "INSDC first public": [ { "text": "2021-10-08T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-08T02:40:22.667Z" } ], "INSDC secondary accession": [ { "text": "SRS8032255" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8032255" } ], "cell line": [ { "text": "16HBE14o-", "tag": "attribute" } ], "cell type": [ { "text": "Human bronchial epithelial cells", "tag": "attribute" } ], "chip antibody": [ { "text": "Santa Cruz sc-398470", "tag": "attribute" } ], "growth media": [ { "text": "DMEM + 10% FBS", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "16HBE14o- KLF5 ChIP-seq", "tag": "attribute" } ], "title": [ { "text": "16HBE14o- KLF5 ChIP-seq rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17316251", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-14T13:36:05.700Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17316251" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17316251{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17316251/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17316251/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17316251" } } }, { "name": "GSM5024541", "accession": "SAMN17372974", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-20T00:00:00Z", "update": "2022-04-01T17:54:24.534Z", "submitted": "2021-01-18T10:21:05.200Z", "characteristics": { "External Id": [ { "text": "SAMN17372974", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Mullighan, Pathology, St Jude Children's Research Institute" } ], "INSDC first public": [ { "text": "2021-05-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-20T02:21:21.137Z" } ], "INSDC secondary accession": [ { "text": "SRS8046668" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8046668" } ], "cell type": [ { "text": "primary T cell", "tag": "attribute" } ], "chip antibody": [ { "text": "BCL11B (Cell Signaling Technologies 12120, Abcam ab18465, Bethyl Laboratories A300-383A and A300-385A)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "primary TALL", "tag": "attribute" } ], "title": [ { "text": "SJTALL005006 cells - BCL11B, rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17372974", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-18T10:21:05.200Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17372974" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17372974{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17372974/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17372974/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17372974" } } }, { "name": "GSM5029778", "accession": "SAMN17493275", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-13T00:00:00Z", "update": "2023-05-15T12:44:00.713Z", "submitted": "2021-01-22T09:14:12.680Z", "characteristics": { "External Id": [ { "text": "SAMN17493275", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Guangdong Provincial People's Hospital" } ], "INSDC first public": [ { "text": "2022-05-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-13T01:38:16.230Z" } ], "INSDC secondary accession": [ { "text": "SRS8094746" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8094746" } ], "condition": [ { "text": "dilated cardiomyopathy", "tag": "attribute" } ], "factor": [ { "text": "H3K27ac", "tag": "attribute" } ], "method": [ { "text": "ChIP-Seq", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002692" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "heart tissue", "tag": "attribute" } ], "tissue": [ { "text": "heart", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000948" ], "tag": "attribute" } ], "title": [ { "text": "DCM-8_ChIP" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17493275", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-01-22T09:14:12.680Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493275" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493275{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493275/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17493275/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17493275" } } }, { "name": "GSM5049898", "accession": "SAMN17677682", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-14T00:00:00Z", "update": "2022-04-01T19:27:46.316Z", "submitted": "2021-01-29T10:21:08.510Z", "characteristics": { "External Id": [ { "text": "SAMN17677682", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Computational Biology and Bioinformatics, Broad Institute" } ], "INSDC first public": [ { "text": "2021-05-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-14T03:01:07.010Z" } ], "INSDC secondary accession": [ { "text": "SRS8147745" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8147745" } ], "cell line": [ { "text": "A673", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002106" ], "tag": "attribute" } ], "cell type": [ { "text": "Ewing sarcoma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit anti-SMC1A Bethyl Cat# A300-055A RRID AB_2192467", "tag": "attribute" } ], "genotype/variation": [ { "text": "STAG2 wild-type", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "A673 clones with STAG2 wild type", "tag": "attribute" } ], "title": [ { "text": "SMC1A on A673 STAG2 WT [BA_A673_STAG2WT_SMC1A]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17677682", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-01-29T10:21:08.510Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17677682" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17677682{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17677682/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17677682/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17677682" } } }, { "name": "GSM5058808", "accession": "SAMN17730306", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-10T00:00:00Z", "update": "2023-05-15T13:33:13.408Z", "submitted": "2021-02-01T16:46:06.650Z", "characteristics": { "External Id": [ { "text": "SAMN17730306", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Center for Omics Sciences, IRCCS San Raffaele Scientific Institute" } ], "INSDC first public": [ { "text": "2022-05-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-10T01:38:35.490Z" } ], "INSDC secondary accession": [ { "text": "SRS8169924" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8169924" } ], "antibody": [ { "text": "Anti H3K27ac (Abcam, ab4729)", "tag": "attribute" } ], "cell type": [ { "text": "MiaPaCa2 cell line", "tag": "attribute" } ], "growth protocol": [ { "text": "DMEM supplemented with 10% Fetal Bovine Serum, 2mM L-Glutamine and 1% Pen/Strep", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Pancreatic Ductal Adenocarcinoma (PDAC) cell line", "tag": "attribute" } ], "title": [ { "text": "H3K27Ac_MiaPaCa2_IFN_2" } ], "treatment": [ { "text": "Bulk cell line, treated with 1000 U/ml of human IFNbeta for 2 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17730306", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-02-01T16:46:06.650Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730306" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730306{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730306/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17730306/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17730306" } } }, { "name": "GSM5059285", "accession": "SAMN17734298", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-20T00:00:00Z", "update": "2023-05-15T13:34:11.485Z", "submitted": "2021-02-01T20:36:16.610Z", "characteristics": { "External Id": [ { "text": "SAMN17734298", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Laboratory of Stem Cell Epigenomics, Oncology, Wayne State University" } ], "INSDC first public": [ { "text": "2022-05-20T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-20T01:35:24.507Z" } ], "INSDC secondary accession": [ { "text": "SRS8170920" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8170920" } ], "cell line": [ { "text": "NCI-H322M", "tag": "attribute" } ], "cell type": [ { "text": "cancer cell", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-H3K4me3 antibody (Millipore; 17-614)", "tag": "attribute" } ], "knockdown": [ { "text": "shLuc", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CCRF-CEM", "tag": "attribute" } ], "title": [ { "text": "H3K4me3_CCRF-CEM_shLuc_ctrl_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17734298", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-02-01T20:36:16.610Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17734298" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17734298{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17734298/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17734298/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17734298" } } }, { "name": "GSM5065126", "accession": "SAMN17795665", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-14T00:00:00Z", "update": "2022-04-01T19:40:38.560Z", "submitted": "2021-02-04T13:20:04.727Z", "characteristics": { "External Id": [ { "text": "SAMN17795665", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UT Southwestern Medical Center" } ], "INSDC first public": [ { "text": "2021-10-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-14T02:28:27.773Z" } ], "INSDC secondary accession": [ { "text": "SRS8197569" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8197569" } ], "antibody": [ { "text": "FOXA1", "tag": "attribute" } ], "biological replicate": [ { "text": "Replicate 2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000180" ], "tag": "attribute" } ], "cell line": [ { "text": "MCF-7", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001203" ], "tag": "attribute" } ], "genotype": [ { "text": "PARP-1KD", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "MCF-7", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001203" ], "tag": "attribute" } ], "title": [ { "text": "ChIP-seq PARP-1KD Veh Rep2 FOXA1" } ], "treatment": [ { "text": "Vehicle", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000732" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17795665", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-04T13:20:04.727Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17795665" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17795665{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17795665/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17795665/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17795665" } } }, { "name": "GSM5066565", "accession": "SAMN17804413", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-18T00:00:00Z", "update": "2022-04-01T19:42:42.250Z", "submitted": "2021-02-04T22:06:19.783Z", "characteristics": { "External Id": [ { "text": "SAMN17804413", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Zhang lab, Huntsman Cancer Institute" } ], "INSDC first public": [ { "text": "2021-10-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-18T01:14:19.350Z" } ], "INSDC secondary accession": [ { "text": "SRS8202182" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8202182" } ], "cell line": [ { "text": "KYSE140", "tag": "attribute" } ], "cell type": [ { "text": "Esophageal squamous cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam ab4729)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "KYSE140_H3K27ac", "tag": "attribute" } ], "title": [ { "text": "KYSE140_H3K27ac" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17804413", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-04T22:06:19.783Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17804413" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17804413{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17804413/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17804413/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17804413" } } }, { "name": "GSM5092650", "accession": "SAMN17987828", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-01T00:00:00Z", "update": "2022-04-01T20:26:26.496Z", "submitted": "2021-02-19T10:47:05.563Z", "characteristics": { "External Id": [ { "text": "SAMN17987828", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UCLA" } ], "INSDC first public": [ { "text": "2021-03-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-02T15:24:25.333Z" } ], "INSDC secondary accession": [ { "text": "SRS8285830" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8285830" } ], "ad5 mutant": [ { "text": "wt E1A", "tag": "attribute" } ], "cell type": [ { "text": "Primary Human Bronchial/Tracheal Epithelial Cells (HBTEC)", "tag": "attribute" } ], "chip antibody": [ { "text": "Rabbit polyclonal anti-AF9 Genetex Cat#GTX102835", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passage": [ { "text": "<10", "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source_name": [ { "text": "Primary Human Bronchial/Tracheal Epithelial Cells (HBTEC)", "tag": "attribute" } ], "title": [ { "text": "dmso_af9" } ], "treatment": [ { "text": "DMSO", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN17987828", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN17987828", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-02-19T10:47:05.563Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17987828" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17987828{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17987828/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN17987828/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN17987828" } } }, { "name": "GSM5124009", "accession": "SAMN18105867", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-10T00:00:00Z", "update": "2022-04-01T21:06:45.373Z", "submitted": "2021-03-02T09:16:05.403Z", "characteristics": { "External Id": [ { "text": "SAMN18105867", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dana Faber Cancer Institute" } ], "INSDC first public": [ { "text": "2021-09-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-12T12:19:46.620Z" } ], "INSDC secondary accession": [ { "text": "SRS8351741" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8351741" } ], "cell line": [ { "text": "CAL-120", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005356" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "chip antibody catalog number": [ { "text": "C15410196", "tag": "attribute" } ], "chip antibody manufacturer": [ { "text": "Diagenode", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "breast cancer cells", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002885" ], "tag": "attribute" } ], "title": [ { "text": "K27ac_ChIP_CAL-120_DMSO_1" } ], "treatment": [ { "text": "DMSO", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18105867", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-02T09:16:05.403Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18105867" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18105867{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18105867/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18105867/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18105867" } } }, { "name": "GSM5130213", "accession": "SAMN18128455", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-07-02T00:00:00Z", "update": "2022-04-01T21:12:15.788Z", "submitted": "2021-03-03T12:47:15.277Z", "characteristics": { "External Id": [ { "text": "SAMN18128455", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Departments of Internal Medicine and Epidemiology, University of Iowa and Iowa City Veterans Affairs Health Care System" } ], "INSDC first public": [ { "text": "2021-07-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-07-02T05:54:42.180Z" } ], "INSDC secondary accession": [ { "text": "SRS8371735" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8371735" } ], "cell type": [ { "text": "HFF", "tag": "attribute" } ], "chip antibody": [ { "text": "Pol II antibody (Santa Cruz Biotechnology, catalog# sc-55492, lot# H2019)", "tag": "attribute" } ], "fraction": [ { "text": "nascent RNA", "tag": "attribute" } ], "infection": [ { "text": "HCMV strain TB40 BAC4", "tag": "attribute" } ], "infection duration": [ { "text": "72 hours", "tag": "attribute" } ], "ltf depletion": [ { "text": "UL79", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HCMV-infected primary human foreskin fibroblast", "tag": "attribute" } ], "title": [ { "text": "UL79HF Pol II ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18128455", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-03T12:47:15.277Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18128455" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18128455{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18128455/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18128455/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18128455" } } }, { "name": "GSM5133642", "accession": "SAMN18132881", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-04T00:00:00Z", "update": "2022-04-01T21:12:41.090Z", "submitted": "2021-03-03T19:04:08.830Z", "characteristics": { "External Id": [ { "text": "SAMN18132881", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Hideo Watanabe, Department of Medicine, Division of Pulmonary, Critical Care and Sleep Medicine, Icahn School of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2021-03-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-04T08:00:15.880Z" } ], "INSDC secondary accession": [ { "text": "SRS8375161" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8375161" } ], "cell line": [ { "text": "H69M", "tag": "attribute" } ], "cell type": [ { "text": "Small cell lung cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000702" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27Me3 (Cell Signaling Technologies, clone C36B1)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H69M cell line", "tag": "attribute" } ], "title": [ { "text": "H69M_K27Me3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18132881", "duo": [] }, { "url": "https://www.ebi.ac.uk/ena/data/view/SAMN18132881", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-03T19:04:08.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132881" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132881{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132881/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18132881/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18132881" } } }, { "name": "GSM5154426", "accession": "SAMN18243552", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-01T00:00:00Z", "update": "2023-05-15T19:48:35.381Z", "submitted": "2021-03-10T12:47:42.947Z", "characteristics": { "External Id": [ { "text": "SAMN18243552", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Morey lab, Human Genetics, University of Miami" } ], "INSDC first public": [ { "text": "2022-08-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-08-01T04:51:25.843Z" } ], "INSDC secondary accession": [ { "text": "SRS8427817" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8427817" } ], "cell source": [ { "text": "ATCC #HTB-133", "tag": "attribute" } ], "cell type": [ { "text": "Mammary gland ductal carcarcinoma epithelial cells derived from metastatic site", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-Histone H3 (acetyl K27) antibody - ChIP Grade (ab4729)", "tag": "attribute" } ], "modifications": [ { "text": "Parental estrogen deprived for 9 months", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "T47D", "tag": "attribute" } ], "title": [ { "text": "T47D_LTED9M_H3K27ac_ChIPseq" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-03-10T12:47:42.947Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18243552" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18243552{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18243552/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18243552/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18243552" } } }, { "name": "ENCODE biosample ENCBS557HKC", "accession": "SAMN18513615", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-03-26T00:00:00Z", "update": "2022-04-01T22:53:51.165Z", "submitted": "2021-03-26T17:55:18.410Z", "characteristics": { "External Id": [ { "text": "SAMN18513615", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "ENCODE" } ], "INSDC first public": [ { "text": "2021-03-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-03-30T12:31:29.457Z" } ], "INSDC secondary accession": [ { "text": "SRS8604980" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8604980" } ], "age": [ { "text": "15 year", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000036" ], "tag": "attribute" } ], "cell line": [ { "text": "HepG2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001187" ], "tag": "attribute" } ], "description": [ { "text": "Homo sapiens HepG2 cell line genetically modified (insertion) using CRISPR targeting SIX4" } ], "dev stage": [ { "text": "child", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UBERON_0000112" ], "tag": "attribute" } ], "donor id": [ { "text": "ENCDO000AAC", "tag": "attribute" } ], "health state": [ { "text": "hepatocellular carcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000182" ], "tag": "attribute" } ], "lab": [ { "text": "Richard Myers, HAIB", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "sex": [ { "text": "male", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000384" ], "tag": "attribute" } ], "source": [ { "text": "Richard Myers", "tag": "attribute" } ], "title": [ { "text": "ENCODE biosample ENCBS557HKC" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18513615", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-26T17:55:18.410Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18513615" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18513615{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18513615/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18513615/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18513615" } } }, { "name": "GSM5218283", "accession": "SAMN18527290", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-13T00:00:00Z", "update": "2022-04-01T22:57:59.007Z", "submitted": "2021-03-29T12:39:10.090Z", "characteristics": { "External Id": [ { "text": "SAMN18527290", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Epigenetics Research Laboratory, Genomics and Epigenetics Division, Garvan Institute of Medical Research" } ], "INSDC first public": [ { "text": "2021-12-13T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-13T01:26:07.017Z" } ], "INSDC secondary accession": [ { "text": "SRS8598915" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8598915" } ], "chip antibody": [ { "text": "ER (Millipore SC-543X)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "5", "tag": "attribute" } ], "source_name": [ { "text": "Gar15-13 Decitabine tumour", "tag": "attribute" } ], "tissue": [ { "text": "Breast cancer PDX model Gar15-13", "tag": "attribute" } ], "title": [ { "text": "Gar15-13 Decitabine 5 ER" } ], "treatment": [ { "text": "Decitabine", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_50131" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18527290", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-03-29T12:39:10.090Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18527290" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18527290{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18527290/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18527290/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18527290" } } }, { "name": "GSM5241220", "accession": "SAMN18741402", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-08-31T00:00:00Z", "update": "2022-04-02T00:43:46.345Z", "submitted": "2021-04-14T11:31:09.293Z", "characteristics": { "External Id": [ { "text": "SAMN18741402", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Shilatifard Lab, Department of Biochemistry and Molecular Genetics, Northwestern University Feinberg School of Medicine" } ], "INSDC first public": [ { "text": "2021-08-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-08-31T08:09:17.317Z" } ], "INSDC secondary accession": [ { "text": "SRS8702413" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8702413" } ], "antibody": [ { "text": "RPB1 NTD (Cell signaling # 14958S)", "tag": "attribute" } ], "cell line": [ { "text": "DLD-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006389" ], "tag": "attribute" } ], "cell type": [ { "text": "Colorectal adenocarcinoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000365" ], "tag": "attribute" } ], "genotype": [ { "text": "SPT5-AID7 AtAFB2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DLD-1", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006389" ], "tag": "attribute" } ], "title": [ { "text": "ChIP-seq-D-Pol2-SPT5AID7-shNT-Vehicle" } ], "treatment": [ { "text": "shNT-Vehicle", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18741402", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-04-14T11:31:09.293Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18741402" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18741402{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18741402/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18741402/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18741402" } } }, { "name": "GSM5271669", "accession": "SAMN18926557", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-04T00:00:00Z", "update": "2023-05-16T07:47:22.992Z", "submitted": "2021-04-29T15:35:09.670Z", "characteristics": { "External Id": [ { "text": "SAMN18926557", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Scott Armstrong/CPCT, Pediatric Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2022-03-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-04T02:09:26.240Z" } ], "INSDC secondary accession": [ { "text": "SRS8805701" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8805701" } ], "agent": [ { "text": "250nM EPZ5676", "tag": "attribute" } ], "antibody": [ { "text": "HA", "ontologyTerms": [ "http://purl.obolibrary.org/obo/MONDO_0005129" ], "tag": "attribute" } ], "antibody catalog number": [ { "text": "23724", "tag": "attribute" } ], "antibody manufacturer": [ { "text": "CST", "tag": "attribute" } ], "cell line": [ { "text": "HCB1", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HCB1_ChIP_HA_EPZ_250nM_4d_REP1_200908_AGTCAA_S13", "tag": "attribute" } ], "timepoint": [ { "text": "4 days", "ontologyTerms": [ "http://purl.obolibrary.org/obo/UO_0000033" ], "tag": "attribute" } ], "title": [ { "text": "HCB1_ChIP_HA_EPZ_250nM_4d_REP1_200908_AGTCAA_S13" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18926557", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-04-29T15:35:09.670Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18926557" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18926557{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18926557/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18926557/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18926557" } } }, { "name": "GSM5278078", "accession": "SAMN18988606", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-12T00:00:00Z", "update": "2022-04-02T02:28:13.767Z", "submitted": "2021-05-03T16:39:28.483Z", "characteristics": { "External Id": [ { "text": "SAMN18988606", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Peter MacCallum Cancer Centre" } ], "INSDC first public": [ { "text": "2021-05-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-12T02:50:15.850Z" } ], "INSDC secondary accession": [ { "text": "SRS8844929" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8844929" } ], "cell line": [ { "text": "MM1.S", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0005724" ], "tag": "attribute" } ], "chip antibody": [ { "text": "P300 (SantaCruz, sc-585)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Multiple Myeloma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001378" ], "tag": "attribute" } ], "timepoint": [ { "text": "2 hours", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_5417" ], "tag": "attribute" } ], "title": [ { "text": "ChIPseq_P300_MM1S_2hours_A485" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN18988606", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-03T16:39:28.483Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18988606" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18988606{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18988606/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN18988606/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN18988606" } } }, { "name": "GSM5282067", "accession": "SAMN19014223", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-22T00:00:00Z", "update": "2023-05-16T08:38:50.338Z", "submitted": "2021-05-04T18:48:53.313Z", "characteristics": { "External Id": [ { "text": "SAMN19014223", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Faryabi, Pathology, University of Pennsylvania" } ], "INSDC first public": [ { "text": "2022-02-22T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-22T02:39:18.077Z" } ], "INSDC secondary accession": [ { "text": "SRS8861683" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8861683" } ], "cell line": [ { "text": "DND41 cell line", "tag": "attribute" } ], "cell type": [ { "text": "T-ALL cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "TCF1", "tag": "attribute" } ], "drug treatment": [ { "text": "DMSO", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_28262" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DND41 cell line", "tag": "attribute" } ], "title": [ { "text": "DND41_DMSO_TCF1_ChIPseq_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19014223", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-05-04T18:48:53.313Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014223" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014223{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014223/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19014223/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19014223" } } }, { "name": "GSM5285453", "accession": "SAMN19068356", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-06T00:00:00Z", "update": "2023-05-16T09:16:47.180Z", "submitted": "2021-05-07T13:21:06.900Z", "characteristics": { "External Id": [ { "text": "SAMN19068356", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tongji University" } ], "INSDC first public": [ { "text": "2022-10-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-10-06T01:28:21.580Z" } ], "INSDC secondary accession": [ { "text": "SRS8900642" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8900642" } ], "cell type": [ { "text": "iRPE", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "FLAG-C-MYC", "tag": "attribute" } ], "title": [ { "text": "FLAG-C-MYC-1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19068356", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-05-07T13:21:06.900Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19068356" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19068356{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19068356/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19068356/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19068356" } } }, { "name": "GSM5311606", "accession": "SAMN19190436", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-05-15T00:00:00Z", "update": "2022-04-02T03:33:57.134Z", "submitted": "2021-05-14T15:06:10.680Z", "characteristics": { "External Id": [ { "text": "SAMN19190436", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Smurfit Institute of Genetics, Trinity College Dublin" } ], "INSDC first public": [ { "text": "2021-05-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-05-15T13:04:26.677Z" } ], "INSDC secondary accession": [ { "text": "SRS8989875" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS8989875" } ], "cell line": [ { "text": "G401", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002179" ], "tag": "attribute" } ], "chip antibody": [ { "text": "BRD9", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Kidney", "tag": "attribute" } ], "title": [ { "text": "BRD9_DOX_G401" } ], "treatment": [ { "text": "DOX", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19190436", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-14T15:06:10.680Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19190436" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19190436{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19190436/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19190436/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19190436" } } }, { "name": "GSM5345379", "accession": "SAMN19405427", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-28T00:00:00Z", "update": "2022-04-02T04:25:19.067Z", "submitted": "2021-05-28T13:06:06.943Z", "characteristics": { "External Id": [ { "text": "SAMN19405427", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2021-09-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-28T04:00:19.233Z" } ], "INSDC secondary accession": [ { "text": "SRS9089218" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9089218" } ], "cell cycle phase": [ { "text": "early S", "tag": "attribute" } ], "cell type": [ { "text": "Retinal Pigmented Epithelial", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me1", "tag": "attribute" } ], "genotype/variation": [ { "text": "Ctrl", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0007937" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Retinal Pigmented Epithelial", "tag": "attribute" } ], "title": [ { "text": "RPE.Ctrl.H3K4me1.ES.rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19405427", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-05-28T13:06:06.943Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19405427" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19405427{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19405427/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19405427/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19405427" } } }, { "name": "GSM5387593", "accession": "SAMN19729820", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-21T00:00:00Z", "update": "2022-04-02T06:01:42.438Z", "submitted": "2021-06-16T11:52:10.800Z", "characteristics": { "External Id": [ { "text": "SAMN19729820", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Majumder, Oncology, University of Wisconsin" } ], "INSDC first public": [ { "text": "2021-10-21T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-21T01:32:49.823Z" } ], "INSDC secondary accession": [ { "text": "SRS9219218" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9219218" } ], "cell type": [ { "text": "Epithelial", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "chip antibody": [ { "text": "Mouse anti-Rep monoclonal (6 ug)", "tag": "attribute" } ], "disease": [ { "text": "Osteosarcoma", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0000637" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Epithelial", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000066" ], "tag": "attribute" } ], "tissue": [ { "text": "Bone", "tag": "attribute" } ], "title": [ { "text": "U2OS_24hpd_hu_rep_1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19729820", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-06-16T11:52:10.800Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19729820" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19729820{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19729820/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19729820/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19729820" } } }, { "name": "GSM5399513", "accession": "SAMN19909874", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-29T01:14:38Z", "update": "2022-07-16T11:37:48.974Z", "submitted": "2022-04-29T01:14:38Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-29", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-29", "tag": "attribute" } ], "External Id": [ { "text": "GSM5399513", "tag": "Namespace:BioSample" }, { "text": "SAMN19909874", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-29T01:14:38Z" } ], "INSDC last update": [ { "text": "2022-04-29T01:14:38Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS9291733" } ], "Submitter Id": [ { "text": "GSM5399513" } ], "antibody": [ { "text": "c-MYC (abcam, ab32072-Y69)", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "cancer cell line", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "22Rv1", "tag": "attribute" } ], "title": [ { "text": "1hr_MYC_Rep1" } ], "treatment": [ { "text": "1hr MYCi - 10 µM", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN19909874", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-29T01:14:38Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909874" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909874{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909874/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN19909874/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN19909874" } } }, { "name": "GSM5426277", "accession": "SAMN20109697", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-02-15T00:00:00Z", "update": "2022-04-02T07:50:23.034Z", "submitted": "2021-07-07T16:21:10.243Z", "characteristics": { "External Id": [ { "text": "SAMN20109697", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "University of Massachusetts Boston" } ], "INSDC first public": [ { "text": "2022-02-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-02-15T01:38:24.583Z" } ], "INSDC secondary accession": [ { "text": "SRS9421369" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9421369" } ], "cell line": [ { "text": "C4-2", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002071" ], "tag": "attribute" } ], "cell type": [ { "text": "prostate cancer cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-MYC (Cell Signaling)", "tag": "attribute" } ], "medium condition": [ { "text": "In RPMI 1640 medium with 5% charcoal-stripped FBS (CSS)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "C4-2 cell", "tag": "attribute" } ], "title": [ { "text": "MYC-C4-2-DHT_rep1" } ], "treatment": [ { "text": "10nM dihydrotestosterone (DHT) for 4 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20109697", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-07T16:21:10.243Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20109697" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20109697{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20109697/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20109697/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20109697" } } }, { "name": "GSM5444475", "accession": "SAMN20188952", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-28T00:00:00Z", "update": "2022-06-30T19:19:32.836Z", "submitted": "2021-07-13T08:21:09.643Z", "characteristics": { "External Id": [ { "text": "SAMN20188952", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "MMG- U1251, Aix-Marseille Université - Marseille Medical Genetics" } ], "INSDC first public": [ { "text": "2022-05-28T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-05-28T01:40:16.557Z" } ], "INSDC secondary accession": [ { "text": "SRS9465978" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9465978" } ], "chip antibody": [ { "text": "Diagenode C15410195", "tag": "attribute" } ], "disease": [ { "text": "FSHD2", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "neural crest stem cells", "tag": "attribute" } ], "title": [ { "text": "H3K27me3 FSHD2 rep1 [neural crest stem cells]" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20188952", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-13T08:21:09.643Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20188952" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20188952{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20188952/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20188952/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20188952" } } }, { "name": "GSM5444548", "accession": "SAMN20189112", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-14T00:00:00Z", "update": "2022-07-22T19:59:42.568Z", "submitted": "2021-07-13T08:56:12.190Z", "characteristics": { "External Id": [ { "text": "SAMN20189112", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Saarland University" } ], "INSDC first public": [ { "text": "2022-07-14T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-14T02:03:49.830Z" } ], "INSDC secondary accession": [ { "text": "SRS9466385" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9466385" } ], "agent": [ { "text": "DMSO", "tag": "attribute" } ], "antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "cell line": [ { "text": "differentiated HepaRG cells day 30", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HepaRG cell line", "tag": "attribute" } ], "title": [ { "text": "HepaRG d30DMSO H3K27ac Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20189112", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-13T08:56:12.190Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20189112" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20189112{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20189112/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20189112/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20189112" } } }, { "name": "GSM5455034", "accession": "SAMN20248383", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-05T00:00:00Z", "update": "2022-04-02T08:45:34.071Z", "submitted": "2021-07-15T14:42:31.257Z", "characteristics": { "External Id": [ { "text": "SAMN20248383", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institut universitaire de pathologie, Département de Pathologie Expérimentale, CHUV" } ], "INSDC first public": [ { "text": "2022-03-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-05T02:30:22.160Z" } ], "INSDC secondary accession": [ { "text": "SRS9509650" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9509650" } ], "cell line": [ { "text": "DTC1 (CVCL_0J31)", "tag": "attribute" } ], "cell type": [ { "text": "Derived from malignant pleural effusion of a patient with a chest wall CCS tumor", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (#07-473, Millipore)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell line", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CL_0000010" ], "tag": "attribute" } ], "title": [ { "text": "DTC1_siCTL_96h_H3K4me3_1" } ], "treatment": [ { "text": "Transfected with CTRL siRNA", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20248383", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-07-15T14:42:31.257Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20248383" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20248383{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20248383/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20248383/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20248383" } } }, { "name": "GSM5466901", "accession": "SAMN20350178", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-12-12T00:00:00Z", "update": "2022-12-13T04:18:35.608Z", "submitted": "2021-07-22T14:53:05.420Z", "characteristics": { "External Id": [ { "text": "SAMN20350178", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stem Cells and Cancer, Cancer Research, Institut Hospital del Mar d'Investigacions Mèdiques" } ], "INSDC first public": [ { "text": "2022-12-12T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-12-12T01:23:21.843Z" } ], "INSDC secondary accession": [ { "text": "SRS9560285" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9560285" } ], "cell type": [ { "text": "RPMI8402 T-ALL cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "β-catenin, R&D Systems AF1329", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RPMI8402 T-ALL cell line", "tag": "attribute" } ], "strain": [ { "text": "Cell line", "tag": "attribute" } ], "title": [ { "text": "β-catenin ChIP-seq from RPMI8402 cell line treated with LiCl BRL2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20350178", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-07-22T14:53:05.420Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20350178" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20350178{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20350178/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20350178/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20350178" } } }, { "name": "GSM5506039", "accession": "SAMN20600888", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-05T00:00:00Z", "update": "2022-10-06T00:46:44.160Z", "submitted": "2021-08-06T11:38:07.320Z", "characteristics": { "External Id": [ { "text": "SAMN20600888", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stegmaier Lab., Pediatric Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2022-10-05T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-10-05T01:49:20.487Z" } ], "INSDC secondary accession": [ { "text": "SRS9694244" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9694244" } ], "cell line": [ { "text": "EW8", "tag": "attribute" } ], "chip anti-body": [ { "text": "HA (Abcam, # ab9110)", "tag": "attribute" } ], "modification": [ { "text": "ETV6 dTAG", "tag": "attribute" } ], "modification type": [ { "text": "dTAG", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "EW8 Ewing sarcoma cell line", "tag": "attribute" } ], "time": [ { "text": "24 hours", "tag": "attribute" } ], "title": [ { "text": "EW8 ETV6 dTAG cells - 24 hour dTAGV-1 treated - HA-tag ChIP-seq" } ], "treatment": [ { "text": "dTAGV-1", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20600888", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-08-06T11:38:07.320Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20600888" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20600888{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20600888/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20600888/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20600888" } } }, { "name": "GSM5518551", "accession": "SAMN20793198", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-01T00:00:00Z", "update": "2022-07-04T00:10:34.855Z", "submitted": "2021-08-14T12:47:30.750Z", "characteristics": { "External Id": [ { "text": "SAMN20793198", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Job Dekker, Systems Biology, University of Massachusetts Medical School" } ], "INSDC first public": [ { "text": "2022-07-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-01T02:31:32.110Z" } ], "INSDC secondary accession": [ { "text": "SRS9821073" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9821073" } ], "Sex": [ { "text": "male", "tag": "attribute" } ], "antibody": [ { "text": "anti-CTCF (CST:#3418)", "tag": "attribute" } ], "cell type": [ { "text": "colon cancer cell line", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "DKO", "tag": "attribute" } ], "title": [ { "text": "DKO_ChIPseq_CTCF rep2" } ], "treatment": [ { "text": "none", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20793198", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-08-14T12:47:30.750Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20793198" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20793198{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20793198/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20793198/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20793198" } } }, { "name": "GSM5526974", "accession": "SAMN20845859", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-19T00:00:00Z", "update": "2022-04-02T12:31:49.252Z", "submitted": "2021-08-18T08:32:06.657Z", "characteristics": { "External Id": [ { "text": "SAMN20845859", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Tianjin Medical University" } ], "INSDC first public": [ { "text": "2022-01-19T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-19T01:48:20.930Z" } ], "INSDC secondary accession": [ { "text": "SRS9822387" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9822387" } ], "cell line": [ { "text": "SKOV3 possessing homozygous mutation (C/C) at rs1192691", "tag": "attribute" } ], "cell type": [ { "text": "ovarian cancer", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001075" ], "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 (ab8580, Abcam)", "tag": "attribute" } ], "genotype": [ { "text": "CC", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SKOV3 possessing homozygous mutation (C/C) at rs1192691", "tag": "attribute" } ], "title": [ { "text": "SKOV3(CC)_H3K4me3_IP_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20845859", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-08-18T08:32:06.657Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20845859" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20845859{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20845859/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20845859/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20845859" } } }, { "name": "GSM5530232", "accession": "SAMN20867082", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-04T00:00:00Z", "update": "2023-05-18T17:16:48.232Z", "submitted": "2021-08-20T09:43:10.483Z", "characteristics": { "External Id": [ { "text": "SAMN20867082", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Charité - Universitätsmedizin Berlin" } ], "INSDC first public": [ { "text": "2023-04-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-04T01:15:32.290Z" } ], "INSDC secondary accession": [ { "text": "SRS9846413" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9846413" } ], "cell type": [ { "text": "umbilical cord derived mesenchymal stromal cells", "tag": "attribute" } ], "chip antibody": [ { "text": "Anti-H3K27ac (Diagenode c15410174)", "tag": "attribute" } ], "donor id": [ { "text": "UC0025", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "UC", "tag": "attribute" } ], "title": [ { "text": "UC_H3K27ac_rep2" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-08-20T09:43:10.483Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867082" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867082{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867082/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20867082/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20867082" } } }, { "name": "GSM5530973", "accession": "SAMN20923902", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-09-23T00:00:00Z", "update": "2022-04-02T12:58:32.945Z", "submitted": "2021-08-21T14:11:07.280Z", "characteristics": { "External Id": [ { "text": "SAMN20923902", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biochemistry and Molecular Biology, Thomas Jefferson University" } ], "INSDC first public": [ { "text": "2021-09-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-09-23T05:11:08.467Z" } ], "INSDC secondary accession": [ { "text": "SRS9870159" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS9870159" } ], "antibodies": [ { "text": "ARID1A GeneTex GTX129433", "tag": "attribute" } ], "cell type": [ { "text": "Induced_Pluripotent_Stem_Cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Control_Line_2 (GM23716 line)", "tag": "attribute" } ], "title": [ { "text": "CTRL_LINE2_iPSC_ARID1A" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN20923902", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-08-21T14:11:07.280Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20923902" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20923902{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20923902/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN20923902/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN20923902" } } }, { "name": "GSM5573412", "accession": "SAMN21384095", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-11T00:00:00Z", "update": "2022-04-02T17:20:35.749Z", "submitted": "2021-09-10T11:49:05.510Z", "characteristics": { "External Id": [ { "text": "SAMN21384095", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Neurology, Brigham and Women's Hospital" } ], "INSDC first public": [ { "text": "2021-11-11T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-11T02:23:25.013Z" } ], "INSDC secondary accession": [ { "text": "SRS10109760" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10109760" } ], "cell type": [ { "text": "low-passage glioma-initiating stem-like cells (GBM8)", "tag": "attribute" } ], "chip antibody": [ { "text": "Rad21 (ab992, Abcam)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "low-passage glioma-initiating stem-like cells (GBM8)", "tag": "attribute" } ], "title": [ { "text": "GBM8_Rad21_siRNA_LINC01116_KD_rep2" } ], "treatment": [ { "text": "treated with Pool of 4 siRNA against LINC01116 for 48 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21384095", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-09-10T11:49:05.510Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21384095" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21384095{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21384095/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21384095/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21384095" } } }, { "name": "GSM5576943", "accession": "SAMN21418585", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-30T00:00:00Z", "update": "2023-05-18T17:45:17.744Z", "submitted": "2021-09-13T17:21:09.270Z", "characteristics": { "External Id": [ { "text": "SAMN21418585", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "POB, NCI" } ], "INSDC first public": [ { "text": "2023-03-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-30T01:25:33.533Z" } ], "INSDC secondary accession": [ { "text": "SRS10150606" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10150606" } ], "cell line": [ { "text": "IMR32", "tag": "attribute" } ], "cell type": [ { "text": "Neuroblastoma", "tag": "attribute" } ], "chip antibody": [ { "text": "HAND2 (Abcam ab204000)", "tag": "attribute" } ], "genotype/variation": [ { "text": "siMYCN", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "IMR32_HAND2_ChIPSeq", "tag": "attribute" } ], "title": [ { "text": "IMR32_7_siMYCN_HAND2_72h" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2021-09-13T17:21:09.270Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21418585" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21418585{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21418585/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21418585/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21418585" } } }, { "name": "GSM5593668", "accession": "SAMN21555182", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-01T00:00:00Z", "update": "2023-05-18T18:11:55.126Z", "submitted": "2021-09-22T15:36:04.017Z", "characteristics": { "External Id": [ { "text": "SAMN21555182", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2023-03-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-01T03:10:33.533Z" } ], "INSDC secondary accession": [ { "text": "SRS10272895" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10272895" } ], "cell type": [ { "text": "growth factor dependent erythroblast", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "TF1 cell line", "tag": "attribute" } ], "title": [ { "text": "TF1_R2HG_250_R1_H3K4me3_ChIPseq" } ], "treatment": [ { "text": "250 uM R2HG", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21555182", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-09-22T15:36:04.017Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21555182" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21555182{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21555182/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21555182/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21555182" } } }, { "name": "GSM5602450", "accession": "SAMN21889458", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-29T01:33:00Z", "update": "2022-09-29T01:55:27.389Z", "submitted": "2022-09-29T01:33:00Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-09-29", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-29", "tag": "attribute" } ], "External Id": [ { "text": "SAMN21889458", "tag": "Namespace:BioSample" }, { "text": "GSM5602450", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-09-29T01:33:00Z" } ], "INSDC last update": [ { "text": "2022-09-29T01:33:00Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS10361609" } ], "Submitter Id": [ { "text": "GSM5602450" } ], "antibody": [ { "text": "anti-THAP1 (Proteintech, 12584-1-AP)", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "SHSY5Y cells", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "conditions": [ { "text": "Wild-type", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SHSY5Y cells", "tag": "attribute" } ], "title": [ { "text": "SHSY5Y THAP1 ChIP-seq Rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN21889458", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-29T01:33:00Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21889458" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21889458{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21889458/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN21889458/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN21889458" } } }, { "name": "GSM5623089", "accession": "SAMN22227079", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-10-15T00:00:00Z", "update": "2022-04-02T22:26:34.973Z", "submitted": "2021-10-12T13:11:04.770Z", "characteristics": { "External Id": [ { "text": "SAMN22227079", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "​Gastrointestinal Cancer Research, Department of Medical Oncology, Dana Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2021-10-15T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-10-15T01:49:52.847Z" } ], "INSDC secondary accession": [ { "text": "SRS10534411" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10534411" } ], "cell line": [ { "text": "HT115", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006442" ], "tag": "attribute" } ], "cell type": [ { "text": "Colorectal Cancer cells", "ontologyTerms": [ "http://purl.obolibrary.org/obo/BTO_0001615" ], "tag": "attribute" } ], "chip antibody": [ { "text": "V5 Tag Antibody (Invitrogen Cat# R96025 Lot# 1949337)", "tag": "attribute" } ], "doxycycline induction": [ { "text": "-", "tag": "attribute" } ], "expression": [ { "text": "No doxycycline induced overexpression of V5-tagged wildtype SOX9", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "HT115", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0006442" ], "tag": "attribute" } ], "title": [ { "text": "V5-tag ChIP - SOX9_dox_neg_rep1" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22227079", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-10-12T13:11:04.770Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22227079" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22227079{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22227079/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22227079/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22227079" } } }, { "name": "GSM5654895", "accession": "SAMN22560682", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-11-03T00:00:00Z", "update": "2022-04-03T00:17:16.235Z", "submitted": "2021-10-25T10:49:03.960Z", "characteristics": { "External Id": [ { "text": "SAMN22560682", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Immunogenetics, Medical University of Lodz" } ], "INSDC first public": [ { "text": "2021-11-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-11-03T23:04:39.183Z" } ], "INSDC secondary accession": [ { "text": "SRS10711565" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS10711565" } ], "cell type": [ { "text": "highly purified peripheral blood neutrophils", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-trimethyl-Histone H3 (Lys4) (MC315, Merck Millipore, cat. 04-745", "tag": "attribute" } ], "disease state": [ { "text": "healthy volunteer", "ontologyTerms": [ "http://purl.obolibrary.org/obo/PATO_0000461" ], "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "highly purified peripheral blood neutrophils", "tag": "attribute" } ], "title": [ { "text": "HC-3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_48028" ] } ], "treatment": [ { "text": "2x106 freshly isolated neutrophils (without stimulation)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN22560682", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-10-25T10:49:03.960Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22560682" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22560682{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22560682/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN22560682/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN22560682" } } }, { "name": "GSM5683714", "accession": "SAMN23009692", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-01T00:00:00Z", "update": "2022-11-02T10:41:17.164Z", "submitted": "2021-11-09T13:32:06.536Z", "characteristics": { "External Id": [ { "text": "SAMN23009692", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Brigham and Women's Hospital" } ], "INSDC first public": [ { "text": "2022-11-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-11-01T01:31:06.657Z" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "antibody": [ { "text": "H3K27ac anitbody, Diagenode C15410196", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Chromophobe", "tag": "attribute" } ], "title": [ { "text": "RT1059_H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23009692", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2021-11-09T13:32:06.536Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23009692" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23009692{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23009692/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23009692/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23009692" } } }, { "name": "GSM5695683", "accession": "SAMN23297536", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-01-18T00:00:00Z", "update": "2022-04-03T03:46:37.218Z", "submitted": "2021-11-19T09:13:08.760Z", "characteristics": { "External Id": [ { "text": "SAMN23297536", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Health Data Science Unit, Medical Faculty, University Heidelberg" } ], "INSDC first public": [ { "text": "2022-01-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-01-18T18:06:05.679Z" } ], "INSDC secondary accession": [ { "text": "SRS11101698" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11101698" } ], "cell line": [ { "text": "GI-ME-N", "tag": "attribute" } ], "cell type": [ { "text": "Neuroblastoma", "tag": "attribute" } ], "chip antibody": [ { "text": "K3K4me1; rabbit polyclonal; Abcam; ab 8895", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Neuroblastoma cell lines", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0002717" ], "tag": "attribute" } ], "title": [ { "text": "GI-ME-N H3K4me1" } ], "treatment": [ { "text": "untreated", "ontologyTerms": [ "http://www.ebi.ac.uk/efo/EFO_0001461" ], "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23297536", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-19T09:13:08.760Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23297536" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23297536{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23297536/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23297536/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23297536" } } }, { "name": "GSM5696075", "accession": "SAMN23309372", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-03T00:00:00Z", "update": "2022-04-03T03:49:13.189Z", "submitted": "2021-11-19T14:23:04.996Z", "characteristics": { "External Id": [ { "text": "SAMN23309372", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Vanderbilt University Medical Center" } ], "INSDC first public": [ { "text": "2022-03-03T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-03T14:51:25.180Z" } ], "INSDC secondary accession": [ { "text": "SRS11108004" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11108004" } ], "antibody": [ { "text": "WDR5", "tag": "attribute" } ], "cell line": [ { "text": "TTC549 cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "TTC549 cells", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq TTC549 WDR5 C16 rep1" } ], "treatment": [ { "text": "500 nM C16 for 4 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23309372", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-19T14:23:04.996Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23309372" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23309372{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23309372/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23309372/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23309372" } } }, { "name": "GSM5708716", "accession": "SAMN23514753", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2021-12-01T00:00:00Z", "update": "2022-04-03T04:29:27.769Z", "submitted": "2021-11-30T10:14:14.830Z", "characteristics": { "External Id": [ { "text": "SAMN23514753", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Canada's Michael Smith Genome Sciences Centre" } ], "INSDC first public": [ { "text": "2021-12-01T00:00:00Z" } ], "INSDC last update": [ { "text": "2021-12-01T06:45:11.200Z" } ], "INSDC secondary accession": [ { "text": "SRS11183959" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11183959" } ], "cell type": [ { "text": "Immortalized Astrocyte Cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9me3", "tag": "attribute" } ], "genotype": [ { "text": "CIC-KO, IDH1-R132H", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "CIC-KO1 (IDH1-R132H) H3K9me3", "tag": "attribute" } ], "title": [ { "text": "CIC-KO1 (IDH1-R132H) H3K9me3 rep 2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN23514753", "duo": [] } ], "submittedVia": "JSON_API", "create": "2021-11-30T10:14:14.830Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23514753" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23514753{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23514753/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN23514753/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN23514753" } } }, { "name": "GSM5745703", "accession": "SAMN24273144", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-16T00:00:00Z", "update": "2022-07-22T21:10:38.884Z", "submitted": "2021-12-21T10:53:09.520Z", "characteristics": { "External Id": [ { "text": "SAMN24273144", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Medicine, University of California, San Diego (UCSD)" } ], "INSDC first public": [ { "text": "2022-07-16T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-07-16T01:33:24.733Z" } ], "INSDC secondary accession": [ { "text": "SRS11363672" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11363672" } ], "chip antibody": [ { "text": "H3K4me3 04-745 Millipore", "tag": "attribute" } ], "differentiation time": [ { "text": "day00", "tag": "attribute" } ], "genotype": [ { "text": "H9 MLC2v:H2B", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "perturbation": [ { "text": "wild type", "tag": "attribute" } ], "source_name": [ { "text": "Embryonic stem cell", "tag": "attribute" } ], "tissue": [ { "text": "Embryonic stem cell", "tag": "attribute" } ], "title": [ { "text": "day00.H3K4me3.Rep1" } ] }, "submittedVia": "JSON_API", "create": "2021-12-21T10:53:09.520Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273144" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273144{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273144/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24273144/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24273144" } } }, { "name": "GSM5790347", "accession": "SAMN24776693", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-26T01:29:33Z", "update": "2022-07-16T10:31:56.014Z", "submitted": "2022-04-26T01:29:33Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-26", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-26", "tag": "attribute" } ], "External Id": [ { "text": "GSM5790347", "tag": "Namespace:BioSample" }, { "text": "SAMN24776693", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-26T01:29:33Z" } ], "INSDC last update": [ { "text": "2022-04-26T01:29:33Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS11560082" } ], "Submitter Id": [ { "text": "GSM5790347" } ], "antibody": [ { "text": "H3.3 (09-838)", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "crosslinking": [ { "text": "single step cross-linking", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "affected", "tag": "attribute" } ], "source_name": [ { "text": "human lymphoblastoid cell line", "tag": "attribute" } ], "title": [ { "text": "Case3_LCL_H33" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN24776693", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-26T01:29:33Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776693" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776693{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776693/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN24776693/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN24776693" } } }, { "name": "GSM5880550", "accession": "SAMN25810158", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-03-02T00:00:00Z", "update": "2022-04-03T11:27:54.597Z", "submitted": "2022-02-09T11:38:04.810Z", "characteristics": { "External Id": [ { "text": "SAMN25810158", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "UNIVERSITY OF PADUA" } ], "INSDC first public": [ { "text": "2022-03-02T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-03-02T10:36:10.102Z" } ], "INSDC secondary accession": [ { "text": "SRS11934896" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS11934896" } ], "antibody": [ { "text": "H3K4me3", "ontologyTerms": [ "http://purl.obolibrary.org/obo/CHEBI_85043" ], "tag": "attribute" } ], "disease state": [ { "text": "severe Alzheimer’s disease", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Enthorinal Cortex", "tag": "attribute" } ], "tissue": [ { "text": "Enthorinal Cortex", "tag": "attribute" } ], "title": [ { "text": "Severe_AD H3K4me3 rep3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN25810158", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-02-09T11:38:04.810Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25810158" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25810158{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25810158/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN25810158/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN25810158" } } }, { "name": "GSM5917228", "accession": "SAMN26245508", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-28T00:50:15.943Z", "update": "2022-09-29T00:43:21.641Z", "submitted": "2022-02-25T07:56:05.950Z", "characteristics": { "External Id": [ { "text": "SAMN26245508", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Lu Wang, Biochemistry and Molecular Genetics, Northwestern University" } ], "INSDC first public": [ { "text": "2022-09-28T00:50:15.943Z" } ], "INSDC last update": [ { "text": "2022-09-28T00:50:15.943Z" } ], "INSDC secondary accession": [ { "text": "SRS12104560" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12104560" } ], "cell type": [ { "text": "small cell lung cancer", "tag": "attribute" } ], "chip antibody": [ { "text": "anti-POU2F3 (CST #36135)", "tag": "attribute" } ], "genotype": [ { "text": "normal cells", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "passages": [ { "text": "Low passages (6-10)", "tag": "attribute" } ], "source_name": [ { "text": "NCI-H526", "tag": "attribute" } ], "strain": [ { "text": "POU2F3", "tag": "attribute" } ], "title": [ { "text": "H526_POU2F3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26245508", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-02-25T07:56:05.950Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245508" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245508{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245508/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26245508/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26245508" } } }, { "name": "GSM5962503", "accession": "SAMN26814360", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-30T01:12:40Z", "update": "2022-07-16T12:02:49.792Z", "submitted": "2022-04-30T01:12:40Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-30", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-05-01", "tag": "attribute" } ], "External Id": [ { "text": "GSM5962503", "tag": "Namespace:BioSample" }, { "text": "SAMN26814360", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-30T01:12:40Z" } ], "INSDC last update": [ { "text": "2022-05-01T01:14:01Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12323376" } ], "Submitter Id": [ { "text": "GSM5962503" } ], "antibody": [ { "text": "FOXA2", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "differentiation stages": [ { "text": "Pancreatic progenitor 2", "tag": "attribute" } ], "genotype": [ { "text": "wild type", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ES-derived progenitors", "tag": "attribute" } ], "title": [ { "text": "FOXA2_PP2_WT_2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN26814360", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-30T01:12:40Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26814360" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26814360{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26814360/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN26814360/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN26814360" } } }, { "name": "GSM5987627", "accession": "SAMN27110794", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-02-08T00:50:13.697Z", "update": "2023-05-19T08:13:52.751Z", "submitted": "2022-03-30T15:55:04.203Z", "characteristics": { "External Id": [ { "text": "SAMN27110794", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Chemistry and Chemical Biology, Harvard University" } ], "INSDC first public": [ { "text": "2023-02-08T00:50:13.697Z" } ], "INSDC last update": [ { "text": "2023-02-08T00:50:13.697Z" } ], "INSDC secondary accession": [ { "text": "SRS12438730" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS12438730" } ], "antibody": [ { "text": "EZH2", "tag": "attribute" } ], "cell type": [ { "text": "non-hodgkin's lymphoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Karpas-422 CXCdel", "tag": "attribute" } ], "title": [ { "text": "Karpas_CXCdel_EZH2" } ], "treatment": [ { "text": "Karpas-422 CXCdel cells grown in 1 μM GSK343 were subjected to drug withdrawal with DMSO (0.1% v/v) for 72 hours", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN27110794", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-03-30T15:55:04.203Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27110794" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27110794{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27110794/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27110794/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN27110794" } } }, { "name": "GSM6043300", "accession": "SAMN27567848", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-16T01:13:57Z", "update": "2022-07-16T01:51:37.240Z", "submitted": "2022-04-16T01:13:57Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-16", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-16", "tag": "attribute" } ], "External Id": [ { "text": "SAMN27567848", "tag": "Namespace:BioSample" }, { "text": "GSM6043300", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-16T01:13:57Z" } ], "INSDC last update": [ { "text": "2022-04-16T01:13:57Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12600555" } ], "Submitter Id": [ { "text": "GSM6043300" } ], "antibody": [ { "text": "anti-H3K27ac (Diagenode C15410196)", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "hTSC CT27", "tag": "attribute" } ], "cell type": [ { "text": "Human trophoblast stem cells", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "hTSC CT27", "tag": "attribute" } ], "title": [ { "text": "hTSC, ChIP, H3K27ac" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN27567848", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-16T01:13:57Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27567848" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27567848{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27567848/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27567848/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN27567848" } } }, { "name": "GSM6043496", "accession": "SAMN27570519", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-04-16T01:14:00Z", "update": "2022-07-16T01:51:39.573Z", "submitted": "2022-04-16T01:14:00Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-04-16", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-04-16", "tag": "attribute" } ], "External Id": [ { "text": "GSM6043496", "tag": "Namespace:BioSample" }, { "text": "SAMN27570519", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-04-16T01:14:00Z" } ], "INSDC last update": [ { "text": "2022-04-16T01:14:00Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS12601892" } ], "Submitter Id": [ { "text": "GSM6043496" } ], "broker name": [ { "text": "NCBI" } ], "cell type": [ { "text": "ALL", "tag": "attribute" } ], "chip antibody": [ { "text": "ATF4 Rabbit mAb (Cell singal #11815)", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "SUPB15 (ALL cell line)", "tag": "attribute" } ], "title": [ { "text": "SUPB15_NT_Rep1" } ], "treatment": [ { "text": "None", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN27570519", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-04-16T01:14:00Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27570519" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27570519{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27570519/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN27570519/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN27570519" } } }, { "name": "GSM6176093", "accession": "SAMN28590829", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-05-25T00:50:18.580Z", "update": "2022-06-30T22:44:52.392Z", "submitted": "2022-05-22T15:42:05.467Z", "characteristics": { "External Id": [ { "text": "SAMN28590829", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Massachusetts General Hospital" } ], "INSDC first public": [ { "text": "2022-05-25T00:50:18.580Z" } ], "INSDC last update": [ { "text": "2022-05-25T00:50:18.580Z" } ], "INSDC secondary accession": [ { "text": "SRS13134950" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13134950" } ], "cell line": [ { "text": "WM1205", "tag": "attribute" } ], "cell type": [ { "text": "melanoma", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Abcam, Cambridge, UK; catalog no. AB4729A)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "phenotype": [ { "text": "vemurafenib-resistant", "tag": "attribute" } ], "source_name": [ { "text": "melanoma cell line", "tag": "attribute" } ], "title": [ { "text": "WM1205, P (ChIP-seq)" } ], "treatment": [ { "text": "vemurafenib", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN28590829", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-05-22T15:42:05.467Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28590829" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28590829{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28590829/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN28590829/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN28590829" } } }, { "name": "GSM6239155", "accession": "SAMN29017063", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-24T00:00:00Z", "update": "2023-05-19T22:38:22.033Z", "submitted": "2022-06-13T16:46:31.206Z", "characteristics": { "External Id": [ { "text": "SAMN29017063", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NDM Research Building, Nuffield Department of Medicine, University of Oxford" } ], "INSDC first public": [ { "text": "2023-01-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-01-24T14:42:12.135Z" } ], "INSDC secondary accession": [ { "text": "SRS13388094" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13388094" } ], "ambient o2 concentration": [ { "text": "21.00%", "tag": "attribute" } ], "cell type": [ { "text": "renal cell carcinoma cell line", "tag": "attribute" } ], "chip antibody": [ { "text": "HIF-1a (rabbit polyclonal, PM14)", "tag": "attribute" } ], "duration of treatment": [ { "text": "0.5 hours", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "RCC4+VA (empty vector) renal cell carcinoma cell line", "tag": "attribute" } ], "title": [ { "text": "RCC4/VA Nx/DMSO HIF-1a ChIP rep2" } ], "treatment": [ { "text": "DMSO", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29017063", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-06-13T16:46:31.206Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29017063" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29017063{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29017063/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29017063/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29017063" } } }, { "name": "GSM6244263", "accession": "SAMN29058346", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-06-17T00:00:00Z", "update": "2022-07-01T23:39:39.899Z", "submitted": "2022-06-15T09:05:05.070Z", "characteristics": { "External Id": [ { "text": "SAMN29058346", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Institute for Quantitative Biosciences, The University of Tokyo" } ], "INSDC first public": [ { "text": "2022-06-17T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-06-17T14:37:09.921Z" } ], "INSDC secondary accession": [ { "text": "SRS13404969" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13404969" } ], "antibody": [ { "text": "Rad21 (PMID: 26051894)", "tag": "attribute" } ], "cell line/type": [ { "text": "RPE", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "ChIPseq_RPE_Rad21", "tag": "attribute" } ], "title": [ { "text": "RPE_Rad21_2" } ], "treatment": [ { "text": "NT", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29058346", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-06-15T09:05:05.070Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29058346" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29058346{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29058346/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29058346/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29058346" } } }, { "name": "GSM6287650", "accession": "SAMN29494169", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-08-18T01:38:44Z", "update": "2022-08-19T00:41:54.176Z", "submitted": "2022-08-18T01:38:44Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-08-18", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-08-18", "tag": "attribute" } ], "External Id": [ { "text": "SAMN29494169", "tag": "Namespace:BioSample" }, { "text": "GSM6287650", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-08-18T01:38:44Z" } ], "INSDC last update": [ { "text": "2022-08-18T01:38:44Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS13697417" } ], "Submitter Id": [ { "text": "GSM6287650" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "GSC23", "tag": "attribute" } ], "cell type": [ { "text": "GBM", "tag": "attribute" } ], "chip antibody": [ { "text": "ubH2Ak", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "GSC23", "tag": "attribute" } ], "title": [ { "text": "H3" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29494169", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-18T01:38:44Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29494169" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29494169{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29494169/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29494169/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29494169" } } }, { "name": "GSM6290773", "accession": "SAMN29506915", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-07-12T00:50:33.053Z", "update": "2022-07-22T22:27:22.338Z", "submitted": "2022-07-05T15:18:08.053Z", "characteristics": { "External Id": [ { "text": "SAMN29506915", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stony Brook Cancer Center" } ], "INSDC first public": [ { "text": "2022-07-12T00:50:33.053Z" } ], "INSDC last update": [ { "text": "2022-07-12T00:50:33.053Z" } ], "INSDC secondary accession": [ { "text": "SRS13709058" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS13709058" } ], "cell line": [ { "text": "MDA-MB-231", "tag": "attribute" } ], "cell type": [ { "text": "MDA-MB 231 WT", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9me3 Active Motif Cat # 39161", "tag": "attribute" } ], "genotype": [ { "text": "Triple negative breast cancer", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Breast ( Breast Cancer)", "tag": "attribute" } ], "tissue": [ { "text": "Breast ( Breast Cancer)", "tag": "attribute" } ], "title": [ { "text": "H3K9me3_WT_ChIPSeq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN29506915", "duo": [] } ], "submittedVia": "JSON_API", "create": "2022-07-05T15:18:08.053Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29506915" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29506915{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29506915/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN29506915/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN29506915" } } }, { "name": "GSM6421553", "accession": "SAMN30058156", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-40894", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-25T02:03:07Z", "update": "2022-11-28T02:21:36.126Z", "submitted": "2022-11-25T02:03:07Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-11-25", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-11-25", "tag": "attribute" } ], "External Id": [ { "text": "SAMN30058156", "tag": "Namespace:BioSample" }, { "text": "GSM6421553", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-11-25T02:03:07Z" } ], "INSDC last update": [ { "text": "2022-11-25T02:03:07Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS14367264" } ], "Submitter Id": [ { "text": "GSM6421553" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "H446", "tag": "attribute" } ], "cell type": [ { "text": "small cell lung cancer SCLC-N subtype", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27Ac (Abcam, #ab4729)", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "NEUROD1 knockout", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H446", "tag": "attribute" } ], "title": [ { "text": "H446 ND1-KO, H3K27Ac, Abcam" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30058156", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-11-25T02:03:07Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30058156" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30058156{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30058156/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30058156/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30058156" } } }, { "name": "GSM6423445", "accession": "SAMN30078849", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-842", "taxId": 9606, "status": "PUBLIC", "release": "2022-09-07T01:37:23Z", "update": "2022-09-08T01:06:35.280Z", "submitted": "2022-09-07T01:37:23Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-09-07", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-09-07", "tag": "attribute" } ], "External Id": [ { "text": "SAMN30078849", "tag": "Namespace:BioSample" }, { "text": "GSM6423445", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-09-07T01:37:23Z" } ], "INSDC last update": [ { "text": "2022-09-07T01:37:23Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS14377340" } ], "Submitter Id": [ { "text": "GSM6423445" } ], "antibody": [ { "text": "anti-histone H3.1/3.2 (61629, Active Motif)", "tag": "attribute" } ], "broker name": [ { "text": "NCBI" } ], "common name": [ { "text": "human" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "12Z endometriotic epithelial cells", "tag": "attribute" } ], "title": [ { "text": "12Z_shARID1A_H3.1_rep2_ChIP" } ], "treatment/condition": [ { "text": "shARID1A (lentiviral ARID1A shRNA particles)", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30078849", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-07T01:37:23Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30078849" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30078849{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30078849/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30078849/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30078849" } } }, { "name": "GSM6431181", "accession": "SAMN30129308", "domain": "self.BiosampleImportENA", "webinSubmissionAccountId": "Webin-40894", "taxId": 9606, "status": "PUBLIC", "release": "2022-11-03T13:32:33Z", "update": "2022-11-04T06:31:00.244Z", "submitted": "2022-11-03T13:32:33Z", "characteristics": { "ENA-FIRST-PUBLIC": [ { "text": "2022-11-03", "tag": "attribute" } ], "ENA-LAST-UPDATE": [ { "text": "2022-11-03", "tag": "attribute" } ], "External Id": [ { "text": "SAMN30129308", "tag": "Namespace:BioSample" }, { "text": "GSM6431181", "tag": "Namespace:BioSample" } ], "INSDC first public": [ { "text": "2022-11-03T13:32:33Z" } ], "INSDC last update": [ { "text": "2022-11-03T13:32:33Z" } ], "INSDC status": [ { "text": "public" } ], "SRA accession": [ { "text": "SRS14440087" } ], "Submitter Id": [ { "text": "GSM6431181" } ], "broker name": [ { "text": "NCBI" } ], "cell line": [ { "text": "Eahy926", "tag": "attribute" } ], "cell type": [ { "text": "Endothelial", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "common name": [ { "text": "human" } ], "genotype": [ { "text": "parental", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Vascular", "tag": "attribute" } ], "tissue": [ { "text": "Vascular", "tag": "attribute" } ], "title": [ { "text": "Eahy926, TNFa, ChIP, 1.2" } ], "treatment": [ { "text": "growth media supplemented with 10ng/ml TNF-alpha for 24hrs", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30129308", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-11-03T13:32:33Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30129308" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30129308{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30129308/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30129308/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30129308" } } }, { "name": "GSM6431462", "accession": "SAMN30135366", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-26T00:00:00Z", "update": "2023-06-01T11:31:57.889Z", "submitted": "2022-08-03T20:16:05.107Z", "characteristics": { "External Id": [ { "text": "SAMN30135366", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pathology, Weill Cornell Medical College" } ], "INSDC first public": [ { "text": "2023-05-26T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-26T01:25:40.487Z" } ], "INSDC secondary accession": [ { "text": "SRS14443688" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14443688" } ], "chip antibody": [ { "text": "abcam #ab4729", "tag": "attribute" } ], "developmental stage": [ { "text": "Mature B cell", "tag": "attribute" } ], "disease": [ { "text": "Mantle cell lymphoma", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "sample type": [ { "text": "H3K27Ac ChIP", "tag": "attribute" } ], "source_name": [ { "text": "CCMCL1 MCL cells", "tag": "attribute" } ], "tissue": [ { "text": "blood", "tag": "attribute" } ], "title": [ { "text": "H3K27Ac-vehicle" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-03T20:16:05.107Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30135366" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30135366{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30135366/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30135366/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30135366" } } }, { "name": "GSM6459669", "accession": "SAMN30319254", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-03-06T00:00:00Z", "update": "2023-05-20T12:37:40.708Z", "submitted": "2022-08-15T13:56:17.180Z", "characteristics": { "External Id": [ { "text": "SAMN30319254", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Biological Sciences, KAIST" } ], "INSDC first public": [ { "text": "2023-03-06T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-03-08T12:52:10.297Z" } ], "INSDC secondary accession": [ { "text": "SRS14660523" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS14660523" } ], "chip antibody": [ { "text": "H3K27ac (Active Motif, 39133)", "tag": "attribute" } ], "genotype": [ { "text": "PDSN01", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Substantia nigra", "tag": "attribute" } ], "tissue": [ { "text": "Substantia nigra", "tag": "attribute" } ], "title": [ { "text": "PDSN01.H3K27ac, bulk ChIP-seq" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30319254", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-08-15T13:56:17.180Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30319254" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30319254{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30319254/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30319254/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30319254" } } }, { "name": "GSM6574315", "accession": "SAMN30812687", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-10T00:00:00Z", "update": "2023-05-20T15:53:49.918Z", "submitted": "2022-09-12T16:04:03.340Z", "characteristics": { "External Id": [ { "text": "SAMN30812687", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "天津医科大学" } ], "INSDC first public": [ { "text": "2023-05-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-11T23:58:46.303Z" } ], "INSDC secondary accession": [ { "text": "SRS15085987" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15085987" } ], "cell line": [ { "text": "H460 cells", "tag": "attribute" } ], "cell type": [ { "text": "lung cancer", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9me3 (ab8898, Abcam)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "H460 cells", "tag": "attribute" } ], "title": [ { "text": "CC_H3K9me3_IP_rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN30812687", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-09-12T16:04:03.340Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30812687" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30812687{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30812687/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN30812687/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN30812687" } } }, { "name": "GSM6631119", "accession": "SAMN31247264", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-18T00:50:12.630Z", "update": "2023-05-20T19:58:13.071Z", "submitted": "2022-10-11T23:46:04.273Z", "characteristics": { "External Id": [ { "text": "SAMN31247264", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Azim Surani, Gurdon Institute, University of Cambridge" } ], "INSDC first public": [ { "text": "2023-01-18T00:50:12.630Z" } ], "INSDC last update": [ { "text": "2023-01-18T00:50:12.630Z" } ], "INSDC secondary accession": [ { "text": "SRS15374882" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15374882" } ], "Sex": [ { "text": "male", "tag": "attribute" } ], "cell type": [ { "text": "Gonadal somatic cells", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K9me3(Abcam,cat#ab8898,lot#GR257230-1)", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Gonad", "tag": "attribute" } ], "tissue": [ { "text": "Gonad", "tag": "attribute" } ], "title": [ { "text": "H3K9me3_Soma_wk10_M_r2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31247264", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-11T23:46:04.273Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247264" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247264{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247264/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31247264/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31247264" } } }, { "name": "GSM6671238", "accession": "SAMN31420899", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2022-10-23T00:00:00Z", "update": "2022-10-25T08:02:41.414Z", "submitted": "2022-10-23T16:57:17.453Z", "characteristics": { "External Id": [ { "text": "SAMN31420899", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Stanford University" } ], "INSDC first public": [ { "text": "2022-10-23T00:00:00Z" } ], "INSDC last update": [ { "text": "2022-10-23T18:57:34.623Z" } ], "INSDC secondary accession": [ { "text": "SRS15508514" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15508514" } ], "antibody": [ { "text": "V5 (Abcam ab15828)", "tag": "attribute" } ], "cell line": [ { "text": "H9 hESC", "tag": "attribute" } ], "cell type": [ { "text": "hESC-derived P4 cranial neural crest cells (CNCCs)", "tag": "attribute" } ], "differentiation batch": [ { "text": "R21", "tag": "attribute" } ], "genotype": [ { "text": "S9CC13", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "relative sox9 level": [ { "text": "100", "tag": "attribute" } ], "source_name": [ { "text": "H9 hESC", "tag": "attribute" } ], "title": [ { "text": "C13R21_0nM_V5" } ], "treatment": [ { "text": "dTAGV-1", "tag": "attribute" } ], "treatment time": [ { "text": "48h", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31420899", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-10-23T16:57:17.453Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31420899" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31420899{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31420899/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31420899/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31420899" } } }, { "name": "GSM6751567", "accession": "SAMN31836779", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-24T00:00:00Z", "update": "2023-05-21T02:17:25.944Z", "submitted": "2022-11-22T12:03:05.520Z", "characteristics": { "External Id": [ { "text": "SAMN31836779", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "NGS Analysis Center, University of Regensburg" } ], "INSDC first public": [ { "text": "2023-04-24T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-04-24T07:37:06.666Z" } ], "INSDC secondary accession": [ { "text": "SRS15836777" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15836777" } ], "cell line": [ { "text": "U2OS", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac", "tag": "attribute" } ], "hours post_infection": [ { "text": "T0h", "tag": "attribute" } ], "integrated construct": [ { "text": "H3.3 FLAG", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "U2OS", "tag": "attribute" } ], "title": [ { "text": "U2OS33_T0h_H3K27ac_Rep2" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN31836779", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-11-22T12:03:05.520Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31836779" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31836779{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31836779/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31836779/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31836779" } } }, { "name": "GSM6775425", "accession": "SAMN31976306", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-01-30T00:00:00Z", "update": "2023-05-21T03:33:34.079Z", "submitted": "2022-12-01T15:33:06.196Z", "characteristics": { "External Id": [ { "text": "SAMN31976306", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Scott Armstrong/CPCT, Pediatric Oncology, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2023-01-30T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-01-30T14:42:40.854Z" } ], "INSDC secondary accession": [ { "text": "SRS15933689" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15933689" } ], "agent": [ { "text": "DMSO", "tag": "attribute" } ], "antibody": [ { "text": "MEN1", "tag": "attribute" } ], "antibody catalog number": [ { "text": "A300-105A", "tag": "attribute" } ], "antibody manufacturer": [ { "text": "Bethyl", "tag": "attribute" } ], "cell line": [ { "text": "OCIAML-3", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Cell Line OCI-AML3", "tag": "attribute" } ], "timepoint": [ { "text": "4 days", "tag": "attribute" } ], "title": [ { "text": "OCIAML3_ChIP_MEN1_DMSO_4d_REP1_220301_TTAGGC_S3" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2022-12-01T15:33:06.196Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31976306" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31976306{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31976306/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN31976306/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN31976306" } } }, { "name": "GSM6781723", "accession": "SAMN32010992", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-07-18T00:00:00Z", "update": "2023-07-20T02:05:10.521Z", "submitted": "2022-12-02T16:41:21.103Z", "characteristics": { "External Id": [ { "text": "SAMN32010992", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Psychiatry, Icahn School Of Medicine at Mount Sinai" } ], "INSDC first public": [ { "text": "2023-07-18T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-07-18T01:40:34.167Z" } ], "INSDC secondary accession": [ { "text": "SRS15950217" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS15950217" } ], "Sex": [ { "text": "female", "tag": "attribute" } ], "cell type": [ { "text": "neurons (NeuN+)", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K27ac (Active Motif #39133)", "tag": "attribute" } ], "disease": [ { "text": "Control", "tag": "attribute" } ], "donor id": [ { "text": "C11", "tag": "attribute" } ], "genotype": [ { "text": "N/A", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "motor cortex", "tag": "attribute" } ], "tissue": [ { "text": "motor cortex", "tag": "attribute" } ], "title": [ { "text": "ChIP-seq H3K27ac, Control donor C11, Motor cortex, Neurons" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN32010992", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2022-12-02T16:41:21.103Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32010992" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32010992{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32010992/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32010992/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN32010992" } } }, { "name": "GSM7008813", "accession": "SAMN32953939", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-07-10T00:00:00Z", "update": "2023-07-16T17:47:49.441Z", "submitted": "2023-01-29T11:53:03.813Z", "characteristics": { "External Id": [ { "text": "SAMN32953939", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Department of Data Science, Dana-Farber Cancer Institute" } ], "INSDC first public": [ { "text": "2023-07-10T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-07-11T04:27:12.290Z" } ], "INSDC secondary accession": [ { "text": "SRS16617849" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS16617849" } ], "cell line": [ { "text": "SUM149", "tag": "attribute" } ], "chip antibody": [ { "text": "RelA", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "replicate": [ { "text": "Rep2", "tag": "attribute" } ], "source_name": [ { "text": "SUM149", "tag": "attribute" } ], "title": [ { "text": "SUM149_WT_RelA_ChIP_Rep2" } ], "treatment": [ { "text": "WT", "tag": "attribute" } ] }, "externalReferences": [ { "url": "https://www.ebi.ac.uk/ena/browser/view/SAMN32953939", "duo": [] } ], "submittedVia": "PIPELINE_IMPORT", "create": "2023-01-29T11:53:03.813Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32953939" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32953939{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32953939/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN32953939/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN32953939" } } }, { "name": "GSM7152458", "accession": "SAMN34091162", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-04-10T00:50:22.533Z", "update": "2023-05-24T21:04:01.673Z", "submitted": "2023-04-06T08:03:05.077Z", "characteristics": { "External Id": [ { "text": "SAMN34091162", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Pennsylvania State University" } ], "INSDC first public": [ { "text": "2023-04-10T00:50:22.533Z" } ], "INSDC last update": [ { "text": "2023-04-10T00:50:22.533Z" } ], "INSDC secondary accession": [ { "text": "SRS17246450" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17246450" } ], "cell type": [ { "text": "Human Umbilical Cord Blood-Derived Erythroid Progenitor cell line 1, abbreviated HUDEP1, expresses gamma-globin upon induced differentiation", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "umbilical cord blood", "tag": "attribute" } ], "target": [ { "text": "H3K4me1", "tag": "attribute" } ], "tissue": [ { "text": "umbilical cord blood", "tag": "attribute" } ], "title": [ { "text": "H3K4me1_H1_1" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-04-06T08:03:05.077Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34091162" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34091162{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34091162/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34091162/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN34091162" } } }, { "name": "GSM7246589", "accession": "SAMN34426038", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-04T00:00:00Z", "update": "2023-05-25T08:32:07.307Z", "submitted": "2023-04-28T17:02:12.080Z", "characteristics": { "External Id": [ { "text": "SAMN34426038", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Gardini Lab, The Wistar Institute" } ], "INSDC first public": [ { "text": "2023-05-04T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-04T05:26:07.193Z" } ], "INSDC secondary accession": [ { "text": "SRS17463320" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17463320" } ], "cell line": [ { "text": "Neuron", "tag": "attribute" } ], "cell type": [ { "text": "cortical neurons differentated from pluripotent stem cells", "tag": "attribute" } ], "chip antibody": [ { "text": "INTS10 (proteintech 15271-1-AP)", "tag": "attribute" } ], "genotype": [ { "text": "wt", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Neuron", "tag": "attribute" } ], "title": [ { "text": "Neuron, WT, INTS10, biol rep2" } ], "treatment": [ { "text": "No treatment", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-04-28T17:02:12.080Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34426038" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34426038{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34426038/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN34426038/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN34426038" } } }, { "name": "GSM7429017", "accession": "SAMN35369678", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-05-31T00:00:00Z", "update": "2023-06-06T04:31:32.320Z", "submitted": "2023-05-25T20:24:04.136Z", "characteristics": { "External Id": [ { "text": "SAMN35369678", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Markey Cancer Center" } ], "INSDC first public": [ { "text": "2023-05-31T00:00:00Z" } ], "INSDC last update": [ { "text": "2023-05-31T22:36:10.074Z" } ], "INSDC secondary accession": [ { "text": "SRS17829270" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17829270" } ], "cell line": [ { "text": "UK022", "tag": "attribute" } ], "cell type": [ { "text": "malignant epithelial lung", "tag": "attribute" } ], "chip antibody": [ { "text": "H3K4me3 Active Motif", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "genotype": [ { "text": "WT", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "lung tumoroids", "tag": "attribute" } ], "tissue": [ { "text": "lung tumoroids", "tag": "attribute" } ], "title": [ { "text": "UK022 EPZ H3K4me3" } ], "treatment": [ { "text": "EPZ6438 5uM", "tag": "attribute" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-05-25T20:24:04.136Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35369678" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35369678{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35369678/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35369678/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN35369678" } } }, { "name": "GSM7431744", "accession": "SAMN35448386", "domain": "self.BiosampleImportNCBI", "taxId": 9606, "status": "PUBLIC", "release": "2023-06-01T00:53:11.633Z", "update": "2023-06-06T04:40:53.122Z", "submitted": "2023-05-28T11:53:05.987Z", "characteristics": { "External Id": [ { "text": "SAMN35448386", "tag": "Namespace:BioSample" } ], "INSDC center name": [ { "text": "Huangfu Lab, Developmental Biology, Memorial Sloan Kettering Cancer Center" } ], "INSDC first public": [ { "text": "2023-06-01T00:53:11.633Z" } ], "INSDC last update": [ { "text": "2023-06-01T00:53:11.633Z" } ], "INSDC secondary accession": [ { "text": "SRS17840802" } ], "INSDC status": [ { "text": "live" } ], "NCBI submission model": [ { "text": "Generic" } ], "NCBI submission package": [ { "text": "Generic.1.0" } ], "SRA accession": [ { "text": "SRS17840802" } ], "cell line": [ { "text": "HUES8", "tag": "attribute" } ], "cell type": [ { "text": "Embryonic Stem Cells", "tag": "attribute" } ], "chip antibody": [ { "text": "SOX2 SC-365823", "tag": "attribute" } ], "collection_date": [ { "text": "missing", "tag": "attribute" } ], "genotype": [ { "text": "WildType", "tag": "attribute" } ], "geo_loc_name": [ { "text": "missing", "tag": "attribute" } ], "organism": [ { "text": "Homo sapiens", "ontologyTerms": [ "http://purl.obolibrary.org/obo/NCBITaxon_9606" ] } ], "source_name": [ { "text": "Embryonic Stem Cells", "tag": "attribute" } ], "tissue": [ { "text": "Embryonic Stem Cells", "tag": "attribute" } ], "title": [ { "text": "WT-SOX2-R2" } ] }, "submittedVia": "PIPELINE_IMPORT", "create": "2023-05-28T11:53:05.987Z", "_links": { "self": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35448386" }, "curationDomain": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35448386{?curationdomain}", "templated": true }, "curationLinks": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35448386/curationlinks" }, "curationLink": { "href": "https://www.ebi.ac.uk/biosamples/samples/SAMN35448386/curationlinks/{hash}", "templated": true }, "structuredData": { "href": "https://www.ebi.ac.uk/biosamples/structureddata/SAMN35448386" } } } ]