--------------------
GENERAL INFORMATION 
--------------------
This readme file was generated on [2024-08-12] by [Ariadna Laguna]

Title of Dataset: Modelling human neuronal catecholaminergic pigmentation in rodents recapitulates age-related multisystem neurodegenerative deficits
Description of Dataset: Raw Data and statistics of all figures included in the manuscript
Principal Investigator: Miquel Vila, miquel.vila@vhir.org, ORCID: 0000-0002-1352-989X
Date of Data Collection: 2024-10-01 to 2023-12-20 
Software Dependencies: n/a

-------------
FILE OVERVIEW 
-------------
Directory of Files: 
Source Data File_Figure 2
Source Data File_Figure 3
Source Data File_Figure 4
Source Data File_Figure 5
Source Data File_Figure 6
Source Data File_Figure 7
Source Data File_Figure 8
Source Data File_Figure S1
Source Data File_Figure S2
Source Data File_Figure S3
Source Data File_Figure S4
Source Data File_Figure S5
Source Data File_Figure S6
Source Data File_Figure S7
Source Data File_Figure S9
Source Data File_Statistics
Source Data File_UPLC

Relationship Between Files: -
File Formats: Excel files
File Naming Convention: Source Data File_Figure X or _Statistics or _UPLC

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 2] 
----------------------------------------
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 2
Number of Variables: 1
Variable List:
	A. [Intracellular NM density] NM = neuromelanin
	Description: optical densitometry value corresponding to intracellular NM density (arbitrary units)
Number of Rows: 3726
Column Names: 
	A. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	B. [Brain Region] A9, substantia nigra; A10, ventral tegmental area; A6, locus coeruleus; A2, dorsal vagal complex
	C. [Cell Number ID]
	D. [Intracellular NM density] NM = neuromelanin; arbitrary units
Missing data codes: N/A
	
----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 3] 
----------------------------------------
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel A
Number of Variables: 1
Variable List:
	A. [Time to cross the beam] s, seconds
	Description: Time in seconds that a mouse takes to cross the horizontal beam	
Number of Rows: 82
Column Names: 
	A. [Test] Beam test
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] Seconds (s)
Missing data codes: N/A
	
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel B
Number of Variables: 1
Variable List:
	A. [Discrimination index] 
	Description: : (Time exploring lemon essence–Time exploring water) / (Time exploring lemon essence+Time exploring water)	
Number of Rows: 88
Column Names: 
	A. [Test] Olfaction test
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] Discrimination index
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel C
Number of Variables: 1
Variable List:
	A. [Vocalization] 
	Description: Percentage of animals that vocalized during the 6 min trial of the tail suspension test registered with a yes/no score	
Number of Rows: 12
Column Names: 
	A. [Test] Vocalization test
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Result] Yes/No
	E. [Result] Percentage (%)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel E
Number of Variables: 2
Variable List:
	A. [SNpc TH-positive cells] 
	Description: Absolute number of Tyrosine Hydroxylase (TH)-positive cells counted in the Substantia Nigra pars compacta (SNpc) 
	B. [VTA TH-positive cells] 
	Description: Absolute number of Tyrosine Hydroxylase (TH)-positive cells counted in the Ventral Tegmental Area (VTA)
Number of Rows: 130
Column Names: 
	A. [Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Result] SNpc or VTA TH-positive cells	
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel F
Number of Variables: 2
Variable List:
	A. [SN % of TH- within NM+ cells] 
	Description: Percentage of Tyrosine Hydroxylase (TH) negative cells containing Neuromelanin (NM) counted in the Substantia Nigra (SN) 
	B. [VTA % of TH- within NM+ cells] 
	Description: Percentage of Tyrosine Hydroxylase (TH) negative cells containing Neuromelanin (NM) counted in the Ventral Tegmental Area (VTA)
Number of Rows: 72
Column Names: 
	A. [Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [Age] Adult (8-12 months), Old (18-20 months)
	C. [Genotype] TH+NM+ or TH-NM+
	D. [Result] Percentage (%)	
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 3 - panel G
Number of Variables: 2
Variable List:
	A. [SNpc Total DA neurons] 
	Description: Absolute number of Total dopaminergic (DA) neurons counted in the Substantia Nigra pars compacta (SNpc) 
	B. [VTA Total DA neurons] 
	Description: Absolute number of Total dopaminergic (DA) neurons counted in the Ventral Tegmental Area (VTA)
Number of Rows: 100
Column Names: 
	A. [Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [Age] Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Result] SNpc or VTA Total DA neurons	
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 4] 
----------------------------------------
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 4 - panel A
Number of Variables: 2
Variable List:
	A. [SNpc neurons with cyt. inclusions] 
	Description: Number of neurons with cytoplasmic (cyt.) inclusions immunopositive for p62 counted in the Substantia Nigra pars compacta (SNpc) 
	B. [VTA neurons with cyt. inclusions] 
	Description: Number of neurons with cytoplasmic (cyt.) inclusions immunopositive for p62 counted in the Ventral Tegmental Area (VTA)
Number of Rows: 34
Column Names: 
	A. [Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [[Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID] 
	D. [Result] Cytoplasmic inclusions
Missing data codes: N/A
	
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 4 - panel B
Number of Variables: 2
Variable List:
	A. [SNpc neurons with MB] 
	Description: Number of neurons with Marinesco Bodies (MB) counted in the Substantia Nigra pars compacta (SNpc) 
	B. [VTA neurons with cyt. inclusions] 
	Description: Number of neurons with Marinesco Bodies (MB) counted in the Ventral Tegmental Area (VTA)
Number of Rows: 34
Column Names: 
	A. [Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [[Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID] 
	D. [Result] Nuclear inclusions
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 4 - panel C
Number of Variables: 2
Variable List:
	A. [SNpc Syn-positive cytoplasmic inclusions (%)] 
	Description: Percentage (%) of neurons in the Substantia Nigra pars compacta (SNpc) with cytoplasmic inclusions immunopositive for synculein (Syn) 
	B. [VTA Syn-positive cytoplasmic inclusions (%)] 
	Description: Percentage (%) of neurons in the Ventral Tegmental Area (VTA) with cytoplasmic inclusions immunopositive for synculein (Syn)  
Number of Rows: 68
Column Names: 
	A. [Brain Region] SN, substantia nigra; VTA, ventral tegmental area
	B. [[Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID] 
	D. [Result] Percentage (%) Synuclein (Sun) cytoplasmic inclusions
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 4 - panel D
Number of Variables: 4
Variable List:
	A. [SNpc Reactive Iba1+ cells] 
	Description: Number of Iba1-positive cells in the Substantia Nigra pars compacta (SNpc) with a reactive morphology
	B. [VTA Reactive Iba1+ cells] 
	Description: Number of Iba1-positive cells in the Ventral Tegmental Area (VTA) with with a reactive morphology 
	C. [SNpc GFAP+ cells] 
	Description: Number of GFAP-positive cells in the Substantia Nigra pars compacta (SNpc) 
	D. [VTA GFAP+ cells] 
	Description: Number of GFAP-positive cells in the Ventral Tegmental Area (VTA) 
Number of Rows: 138
Column Names: 
	A. [Stain] Iba1; GFAP
	B. [Brain Region] SN, substantia nigra; VTA, ventral tegmental area
	C. [Genotype] wild-type (wt) or tgNM
	D. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	E. [Animal Id]
	F. [Result] Positive cells
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 5] 
----------------------------------------
Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel A
Number of Variables: 2
Variable List:
	A. [Time in periphery (% vs centre)] 
	Description: Percentage of time spent by the animal in the periphery vs the centre of an open field arena 
	B. [Distance in periphery (% vs centre)] 
	Description: Percentage of distance travelled by the animal in the periphery vs the centre of an open field arena 	
Number of Rows: 116
Column Names: 
	A. [Test] Open field
	B. [Parameter] Time in periphery; Distance in periphery
	C. [Genotype] wild-type (wt) or tgNM
	D. [[Age] Adult (8-12 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Percentage 
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel B
Number of Variables: 1
Variable List:
	A. [Time on the platform (s)] s, seconds 
	Description: Time spent by the animal on the platform of a step down apparatus in seconds (s) 	
Number of Rows: 55
Column Names: 
	A. [Test] Fear Conditioning
	B. [Genotype] wild-type (wt) or tgNM
	C. [[Age] Adult (8-12 months), Old (18-20 months)
	D. [Animal ID]
	E. [Result] Seconds (s) 
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel C
Number of Variables: 2
Variable List:
	A. [Daily number of PS bouts] PS, paradoxical sleep  
	Description: Daily number of paradoxical sleep bouts counted during polysomnography experiments
	B. [Mean duration of PS bouts (s)] PS, paradoxical sleep; seconds (s)
	Description: Mean duration of paradoxical sleep bouts during polysomnography experiments
Number of Rows: 44
Column Names: 
	A. [Test] Polysomnography
	B. [Parameter] Daily number of PS bouts; Mean duration of PS bouts
	C. [Genotype] wild-type (wt) or tgNM
	D. [[Age] Adult (8-12 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Number; Seconds 
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel D
Number of Variables: 2
Variable List:
	A. [LC TH-positive neurons] LC, Locus Coeruleus; TH, tyrosine hydroxylase  
	Description: Absolute number of Tyrosine Hydroxylase (TH)-positive neurons counted in the Locus Coeruleus (LC) 
	B. [LC total NA neurons] LC, Locus Coeruleus; NA, noradrenergic
	Description: Absolute number of noradrenergic (NA) neurons counted in the Locus Coeruleus (LC)
Number of Rows: 63
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Genotype] wild-type (wt) or tgNM 
	C. [[Age] Pubertal (1m), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	D. [Animal ID]
	E. [Result] TH positive cells
	F. [Result] NA cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel E
Number of Variables: 1
Variable List:
	A. [LC eNM granules] LC, Locus Coeruleus; eNM, extracellular neuromelanin 
	Description: Absolute number of extracellular neuromelanin granules counted in the Locus Coeruleus (LC) 
Number of Rows: 24
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Age] Pubertal (1m), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	E. [Result] number of extracellular neuromelanin granules
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel F
Number of Variables: 1
Variable List:
	A. [NA (% wt)] NA, noradrenaline; wt, wild-type 
	Description: Percentage of noradrenaline levels measured in the Locus Coeruleus (LC) of tgNm mice compared to wild-type mice
Number of Rows: 74
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus; PFC, prefrontal cortex
	B. [[Age] Young (3-4 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM 
	D. [Animal ID]
	E. [Result] NA levels
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel G
Number of Variables: 1
Variable List:
	A. [LC neurons with cytoplasmic inclusions] LC, Locus Coeruleus 
	Description: Number of Locus Coeruleus neurons with cytoplasmic inclusions immunostained for p62 
Number of Rows: 24
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [[Age] Pubertal (1m), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Number of cytoplasmic inclusions
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 5 - panel H
Number of Variables: 2
Variable List:
	A. [LC Reactive Iba1+ cells] 
	Description: Number of Iba1-positive cells in the Locus Coeruleus (LC) with a reactive morphology
	B. [LC GFAP+ cells] 
	Description: Number of GFAP-positive cells in the Locus Coeruleus (LC)
Number of Rows: 65
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Stain] Iba1; GFAP
	C. [Genotype] wild-type (wt) or tgNM
	D. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Positive cells
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 6] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel A
Number of Variables: 1
Variable List:
	A. [NBM total ChAT+ neurons] NBM, Nucleus Basalis of Meyner; ChAT, choline acetyltransferase 
	Description: Absolute number of cholinergic (ChAT)-positive neurons counted in the Nucleus Basalis of Meyner
Number of Rows: 15
Column Names: 
	A. [Brain Region] NBM, Nucleus Basalis of Meyner
	B. [Age] Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] ChAT-Positive cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel B
Number of Variables: 1
Variable List:
	A. [PPN total ChAT+ neurons] PPN, Pedunculopontine Nucleus; ChAT, choline acetyltransferase 
	Description: Absolute number of cholinergic (ChAT)-positive neurons counted in the Pedunculopontine Nucleus
Number of Rows: 14
Column Names: 
	A. [Brain Region] PPN, Pedunculopontine Nucleus
	B. [Age] Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] ChAT-Positive cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel C
Number of Variables: 1
Variable List:
	A. [Ach (% wt)] Ach, achetylcholine; wt, wild-type 
	Description: Percentage of achetylcholine (Ach) levels measured in the Pedunculopontine Nucleus (PPN) and Prefrontal cortex (PFC) of tgNM mice compared to wild-type (wt)
Number of Rows: 72
Column Names: 
	A. [Brain Region] PPN, Pedunculopontine Nucleus; PFC, Prefrontal Cortex
	B. [Age] Young (3-4 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] Ach levels
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel D
Number of Variables: 1
Variable List:
	A. [Total TPH+ cells] TPH, tryptophan hydroxylase 
	Description: Absolute number of serotoninergic neurons immunopositive for tryptophan hydroxylase (TPH) counted in the Dorsal Raphe (DR) nucleus
Number of Rows: 10
Column Names: 
	A. [Brain Region] DR (Dorsal Raphe)
	B. [Age] Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] TPH-Positive cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel E
Number of Variables: 1
Variable List:
	A. [5HT (% wt)] 5HT, serotonin; wt, wild-type 
	Description: Percentage of serotonin (5HT) levels measured in the Dorsal Raphe Nucleus (DR) and Prefrontal cortex (PFC) of tgNM mice compared to wild-type (wt)
Number of Rows: 69
Column Names: 
	A. [Brain Region] DR, Dorsal Raphe; PFC, Prefrontal Cortex
	B. [Age] Young (3-4 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] 5HT levels
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 6 - panel F
Number of Variables: 1
Variable List:
	A. [Immobilisation time (s)] s, seconds 
	Description: Time the animals spend without moving (i.e. fore and hind limbs movement) quantified during six minutes when suspended by their tails into a suspension bar 
Number of Rows: 69
Column Names: 
	A. [Test] Tail suspension test
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt) or tgNM
	D. [Animal ID]
	E. [Result] seconds (s)
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 7] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 7 - panel B
Number of Variables: 1
Variable List:
	A. [DVC total TH+ pigmented cells] DVC, dorso-vagal complex; TH, tyrosine hydroxylase
	Description: Absolute number of tyrosine hydroxylase (TH)-positive pigmented neurons counted in the Dorso-Vagal Complex (DVC)
Number of Rows: 18
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] TH-positive pigmented neurons
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 7 - panel C
Number of Variables: 1
Variable List:
	A. [DVC total pigmented cells] DVC, dorso-vagal complex
	Description: Absolute number of pigmented neurons counted in the Dorso-Vagal Complex (DVC)
Number of Rows: 18
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] total number of pigmented neurons
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 7 - panel D
Number of Variables: 1
Variable List:
	A. [DVC eNM granules] DVC, dorso-vagal complex; eNM, extracellular neuromelanin
	Description: Number of extracellular neuromelanin granules counted in the Dorso-Vagal Complex (DVC)
Number of Rows: 18
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] number of extracellular neuromelanin granules
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 7 - panel E
Number of Variables: 1
Variable List:
	A. [DVC reactive Iba1+ cells] DVC, dorso-vagal complex
	Description: Number of reactive Iba1 immunostained cells counted in the Dorso-Vagal Complex (DVC)
Number of Rows: 30
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Genotype] wild-type (wt) or tgNM
	C. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	D. [Animal ID]
	E. [Result] Iba1-positive reactive cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 7 - panel F
Number of Variables: 1
Variable List:
	A. [DVC neurons with cytoplasmic inclusions] DVC, dorso-vagal complex
	Description: Number of neurons with cytoplasmic inclusions immunopositive for p62 counted in the Dorso-Vagal Complex (DVC)
Number of Rows: 24
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Age] Pubertal (1 month), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Cytoplasmic inclusions
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure 8] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel B
Number of Variables: 1
Variable List:
	A. [Heart Rate (bpm)] bpm, beats per minute
	Description: heart rate measurements in beats per minute
Number of Rows: 79
Column Names: 
	A. [Genotype] wild-type (wt) or tgNM
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Heart rate (beats per minute)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel C
Number of Variables: 2
Variable List:
	A. [Systolic BP (mmHg)] BP, blood pressure; mmHg, millimetres of mercury
	Description: systolic blood pressure in millimetres of mercury
	B. [Diastolic BP (mmHg)] BP, blood pressure; mmHg, millimetres of mercury
	Description: diastolic blood pressure in millimetres of mercury
Number of Rows: 68
Column Names: 
	A. [Parameter] Systolic or diastolic blood pressure
	B. [Genotype] wild-type (wt) or tgNM
	C. [Animal ID]
	D. [Result] millimetres of mercury
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel D
Number of Variables: 1
Variable List:
	A. [Respiratory rate (beats/min)] min, minute
	Description: respiratory rate measured in beats/minute
Number of Rows: 25
Column Names: 
	A. [Genotype] wild-type (wt) or tgNM
	B. [Animal ID]
	C. [Result] respiratory rate (beats/min)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel E
Number of Variables: 1
Variable List:
	A. [Intestinal Transit time (min)] min, minute
	Description: time until the animal defecates the first dyed feces after administration of a red dye by oral garage
Number of Rows: 30
Column Names: 
	A. [Genotype] wild-type (wt) or tgNM
	B. [Animal ID]
	C. [Result] intestinal transit time (min)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel F
Number of Variables: 3
Variable List:
	A. [DA (% wt)] DA, dopamine; wt, wild-type 
	Description: Percentage of dopamine (DA) levels measured in the Dorso-vagal complex (DVC), in the Heart and in the intestine of tgNM mice compared to wild-type (wt)
	B. [NA (% wt)] NA, noradrenaline; wt, wild-type 
	Description: Percentage of noradrenaline (NA) levels measured in the Dorso-vagal complex (DVC), in the Heart and in the intestine of tgNM mice compared to wild-type (wt)
	C. [Ach (% wt)] Ach, acetylcholine; wt, wild-type 
	Description: Percentage of acetylcholine (Ach) levels measured in the Dorso-vagal complex (DVC), in the Heart and in the intestine of tgNM mice compared to wild-type (wt)
Number of Rows: 393
Column Names: 
	A. [Metabolite] Dopamine (DA), Noradrenaline (NA) and acetylcholine (Ach) 
	B. [Brain Region] DVC, Dorso vagal complex; Heart; Intestine
	C. [Genotype] wild-type (wt) or tgNM
	D. [Age] Young (3-4 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] neurotransmitters level
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure 8 - panel G
Number of Variables: 1
Variable List:
	A. [Percent survival] 
	Description: Survival analysis (log-rank test and Gehan-Breslow-Wilcoxon test)
Number of Rows: 3158
Column Names: 
	A. [Genotype] wild-type (wt) or tgNM
	B. [Age] m, months
	C. [Survival analysis] 1, natural deaths; 0, registered animals used for experimental purposes and thus not included in future follow-ups that are designated as censored animals for the survival analysis
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S1] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S1 - panel A
Number of Variables: 1
Variable List:
	A. [TYR expression] TYR, tyrosinase
	Description: tyrosinase gene expression levels in different brain regions assessed by qPCR
Number of Rows: 36
Column Names: 
	A. [Gene] hTyr, human tyrosinase
	B. [Age] 12 months (m)
	C. [Brain Region] LC, Locus Coeruleus; SN, substantia nigra; VTA, ventral tegmental area; OB, olfactory bulb; DVC, dorso-vagal complex; HIP, hippocampus; PFC, prefrontal cortex
	D. [Result]  Expression levels (2^-deltaCT)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S1 - panel B
Number of Variables: 2
Variable List:
	A. [TYR expression] TYR, tyrosinase
	Description: tyrosinase gene expression levels in different brain regions assessed by qPCR
	B. [TH expression] TH, tyrosine hydroxilase
	Description: tyrosine hydroxilase gene expression levels in different brain regions assessed by qPCR
Number of Rows: 36
Column Names: 
	A. [Gene] hTyr, human tyrosinase
	B. [Age] 12 months (m)
	C. [Brain Region] LC, Locus Coeruleus; SN, substantia nigra; VTA, ventral tegmental area; OB, olfactory bulb; DVC, dorso-vagal complex; HIP, hippocampus; PFC, prefrontal cortex
	D. [Result]  Expression levels (deltaCT)
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S2] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S2 - panel A
Number of Variables: 1
Variable List:
	A. [Intracellular NM density (OD)] NM, neuromelanin; OD, optical densitometry
	Description: Levels of intracellular neuromelanin density in different brain regions and at different ages
Number of Rows: 3725
Column Names: 
	A. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	B. [Brain Region] A9, substantia nigra; A10, ventral tegmental area; A6, Locus Coeruleus; A2, dorso-vagal complex
	C. [Cell ID] 
	D. [Result]  Optical Densitometry of intracellular neuromelanin
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S2 - panel B
Number of Variables: 1
Variable List:
	A. [NM-occupied cytosolic area (%)] NM, neuromelanin
	Description: Percentage of the cytosolic area of cells occupied by neuromelanin in different brain regions and at different ages
Number of Rows: 1657
Column Names: 
	A. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	B. [Brain Region] A9, substantia nigra; A10, ventral tegmental area; A6, Locus Coeruleus; A2, dorso-vagal complex
	C. [Cell ID] 
	D. [Result]  Cytosolic area occupied by neuromelanin
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S3] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S3 - panel B
Number of Variables: 1
Variable List:
	A. [Grip Latency (s)] s, seconds
	Description:  Time the mice manage to hold a series of increasing weights 
Number of Rows: 109
Column Names: 
	A. [Test] Grip Strength
	B. [Genotype] wild-type (wt); tgNM
	C. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	D. [Result]  time in seconds
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S3 - panel C
Number of Variables: 1
Variable List:
	A. [Discrimination Index] 
	Description:  Time exploring the new object]-[time exploring the familiar object]/total time 
Number of Rows: 59
Column Names: 
	A. [Test] Novel Object Recognition
	B. [Genotype] wild-type (wt); tgNM
	C. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	D. [Result]  discrimination index
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S4] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S4 - panel A
Number of Variables: 1
Variable List:
	A. [cDNA expression] 
	Description:  Levels of expression of different target genes at different ages 
Number of Rows: 114
Column Names: 
	A. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	B. [Genotype] wild-type (wt); tgNM
	C. [Probe] Th, tyrosine hydroxilase; Dat, dopamine transporter; Vmat2, vesicular monoamine transporter 2
	D. [Animal ID]
	E. [Result] Expression levels (2^-deltaCT)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S4 - panel B
Number of Variables: 1
Variable List:
	A. [Total Number of eNM granules] eNM, extracellular neuromelanin 
	Description:  Total number of extracellular neuromelanin granules counted in the substantia nigra pars compacta (SNpc) and the Ventral Tegmental Area (VTA) at different ages 
Number of Rows: 50
Column Names: 
	A. [Brain region] SNpc; substantia nigra pars compacta; VTA, Ventral Tegmental Area 
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] number of granules
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S4 - panel C
Number of Variables: 1
Variable List:
	A. [Str protein levels (AU) normalised to Actin] Str, striatal;  AU, arbitrary units
	Description:  Levels of expression of different target proteins in striatal tissue normalised to Actin 
Number of Rows: 28
Column Names: 
	A. [Antibody] TH; tyrosine hydroxilase; DAT, dopamine transporter
	B. [Genotype] wild-type (wt); tgNM
	C. [Animal ID]
	D. [Result] protein levels normalised to Actin
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S4 - panel D
Number of Variables: 1
Variable List:
	A. [OD] OD, optical densitometry
	Description:  Levels of different proteins in immunostained striatal tissue quantified by optical densitometry
Number of Rows: 433
Column Names: 
	A. [Antibody] TH; tyrosine hydroxilase; DAT, dopamine transporter; VMAT2, vesicular monoamine transporter
	B. [Brain Region] CPu, caudate-putamen; NAcc, nucleus accumbens; OT, olfactory tubercle
	C. [Genotype] wild-type (wt); tgNM
	D. [Age] Adult (8-12 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] optical densitometry
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S5] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S5 - panel A
Number of Variables: 1
Variable List:
	A. [DA (% wt)] DA, dopamine; wt, wild-type 
	Description:  Percentage of dopamine levels in the substantia nigra and the striatum of tgNM at different ages compared to wild-type mice 
Number of Rows: 71
Column Names: 
	A. [Brain region] SN, substantia nigra; Str, striatum
	B. [Genotype] wild-type (wt); tgNM
	C. [Age] Young (3-4 months), Old (18-20 months)
	D. [Animal ID]
	E. [Result] Dopamine levels (% to wild-type)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S5 - panel B
Number of Variables: 2
Variable List:
	A. [DA synthesis (% wt)] DA, dopamine; wt, wild-type 
	Description:  Ratio to calculate the rate of dopamine synthesis compared to wild-type mice using the formula DA+NE+DOMA+VMA+ 3MT+DOPAC /L- DOPA 
	B. [DA degradation (% wt)] DA, dopamine; wt, wild-type 
	Description:  Ratio to calculate the rate of dopamine degradation compared to wild-type mice using the formula DOPAC+3MT/DA
Number of Rows: 66
Column Names: 
	A. [Brain region] SN, substantia nigra
	B. [Ratio] DA synthesis; DA degradation
	C. [Genotype] wild-type (wt); tgNM
	D. [Age] Young (3-4 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Ratio (% to wild-type)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S5 - panel C
Number of Variables: 1
Variable List:
	A. [Catechol oxidation (% wt)] wt, wild-type 
	Description:  Percentage of catechol oxidation compared to wild-type mice using the formula AC+5SCDA+5SCDA-PB/DA + 5SCD+5SCD-PB/L-DOPA
Number of Rows: 33
Column Names: 
	A. [Brain region] SN, substantia nigra
	B. [Ratio] Catechol oxidation
	C. [Genotype] wild-type (wt); tgNM
	D. [Age] Young (3-4 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Catechol oxidation (% to wild-type)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S5 - panel D
Number of Variables: 1
Variable List:
	A. [Extracellular DA (% of baseline)] DA, dopamine 
	Description:  Levels of striatal extracellular dopamine measured by in vivo microdialysis after nomifensine intrastriatal administration (percentage to baseline levels before administration) 
Number of Rows: 168
Column Names: 
	A. [Brain region] Str, striatum
	B. [Time (h)] h, hour
	C. [Genotype] wild-type (wt); tgNM
	D. [Age] Young (3-4 months), Old (18-20 months)
	E. [Animal ID]
	F. [Result] Extracellular dopamine levels (% of baseline)
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S6] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S6 - panel A
Number of Variables: 1
Variable List:
	A. [Protein expression (AU) normalised to Actin] AU, arbitrary units
	Description:  Levels of expression of different target proteins in Substantia Nigra and Ventral Tegmental Area tissue
Number of Rows: 42
Column Names: 
	A. [Brain region] SN, substantia nigra; VTA, ventral tegmental area
	B. [Protein] LC3, ProCathepsin D, Cathepsin D, Actin
	C. [Age] Adult (8-12 months)
	D. [Genotype] wild-type (wt); tgNM
	E. [Animal ID]
	F. [Result] Protein expression normalised to Actin
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S6 - panel B
Number of Variables: 1
Variable List:
	A. [Non-reactive Iba1+ cells] 
	Description:  Number of non-reactive Iba1 immunostained cells in Substantia Nigra and and Ventral Tegmental Area regions
Number of Rows: 68
Column Names: 
	A. [Brain region] SN, substantia nigra; VTA, ventral tegmental area
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt); tgNM
	D. [Animal ID]
	E. [Result] Number of non-reactive Iba1 cells
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S7] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel B
Number of Variables: 1
Variable List:
	A. [Mean speed (cm/s)] cm, centimetre; s, second
	Description:  Mean speed of the animals during the open field test
Number of Rows: 58
Column Names: 
	A. [Test] Open field
	B. [Parameter] Mean speed
	C. [Age] Adult (8-12 months), Old (18-20 months)
	D. [Genotype] wild-type (wt); tgNM
	E. [Animal ID]
	F. [Result] Mean speed (cm/s)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel C
Number of Variables: 3
Variable List:
	A. [Daily PS amounts (min)] PS, paradoxical sleep; min, minute
	Description:  Daily amount of paradoxical sleep recorded in polysomnography experiments
	B. [Daily SWS amounts (min)] SWS, Slow Wave Sleep ; min, minute
	Description:  Daily amount of Slow Wave Sleep recorded in polysomnography experiments
	C. [Daily Wake amounts (min)] min, minute
	Description:  Daily amount of wake time recorded in polysomnography experiments
Number of Rows: 66
Column Names: 
	A. [Test] Polysomnography
	B. [Parameter] Daily PS amounts; Daily SWS amounts; Daily Wake amounts
	C. [Age] Adult (8-12 months), Old (18-20 months)
	D. [Genotype] wild-type (wt); tgNM
	E. [Animal ID]
	F. [Result] Amount in minutes
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel D
Number of Variables: 2
Variable List:
	A. [NA synthesis (% wt)] NA, noradrenaline; wt, wild-type 
	Description:  Ratio to calculate the rate of noradrenaline synthesis compared to wild-type mice using the formula NA/DA.   
	B. [NA degradation (% wt)] NA, noradrenaline; wt, wild-type 
	Description:  Ratio to calculate the rate of noradrenaline degradation compared to wild-type mice using the formula  DOMA+ VMA / NA.
Number of Rows: 72
Column Names: 
	A. [Brain region] LC, Locus Coeruleus
	B. [Parameter] NA synthesis; NA degradation
	C. [Age] Young (3-4 months), Old (18-20 months)
	D. [Genotype] wild-type (wt); tgNM 
	E. [Animal ID]
	F. [Result] Ratio (% to wild-type)
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel E
Number of Variables: 1
Variable List:
	A. [LC neurons with MB] LC, Locus Coeruleus; MB, Marinesco Bodies
	Description:  Number of neurons in the Locus Coeruleus with Marinesco Bodies 
Number of Rows: 24
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Age] Pubertal (1 month), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Number
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel F
Number of Variables: 1
Variable List:
	A. [LC Syn-positive cytoplasmic inclusions (%)] LC, Locus Coeruleus; Syn, synuclein
	Description:  Percentage of Synuclein-positive or negative cytoplasmic inclusions in the Locus Coeruleus
Number of Rows: 30
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Synuclein] Positive, Negative
	B. [Age] Pubertal (1 month), Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Percentage of Synuclein-positive cytoplasmic inclusions
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S7 - panel E
Number of Variables: 1
Variable List:
	A. [LC Non-reactive Iba1+ cells] LC, Locus Coeruleus
	Description:  Number of non-reactive immunostained Iba1 microglial cells in the Locus Coeruleus
Number of Rows: 32
Column Names: 
	A. [Brain Region] LC, Locus Coeruleus
	B. [Genotype] wild-type (wt); tgNM 
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Animal ID]
	D. [Result] Number of Iba1-positive non-reactive cells
Missing data codes: N/A

----------------------------------------
DATA SPECIFIC INFORMATION FOR [Source Data File_Figure S9] 
----------------------------------------

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S9 - panel B
Number of Variables: 2
Variable List:
	A. [DVC TH-positive neurons)] DVC, dorso-vagal complex; TH, tyrosine hydroxylase
	Description:  Absolute number of TH-positive cells counted in the DVC region
	B. [DVC Total Catecholaminergic neurons)] DVC, dorso-vagal complex; TH, tyrosine hydroxylase
	Description:  Absolute number of total catecholaminergic neurons counted in the DVC region
Number of Rows: 72
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Parameter] TH-positive cells; Total Catecholaminergic neurons
	C. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	D. [Genotype] wild-type (wt); tgNM
	E. [Animal ID]
	F. [Result] Number
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S9 - panel C
Number of Variables: 2
Variable List:
	A. [DVC Non-reactive Iba1+ cells] DVC, dorso-vagal complex
	Description:  Number of non-reactive immunostained Iba1 microglial cells in the dorso-vagal complex
	B. [DVC GFAP+ cells] DVC, dorso-vagal complex
	Description:  Number of immunostained GFAP glial cells in the dorso-vagal complex
Number of Rows: 62
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Parameter] Non-reactive Iba1+cells; GFAP+cells
	C. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)  
	D. [Genotype] wild-type (wt); tgNM
	E. [Animal ID]
	F. [Result] Number of cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S9 - panel D
Number of Variables: 1
Variable List:
	A. [DVC ChAT-positive neurons)] DVC, dorso-vagal complex; ChAT, choline acetyltransferase 
	Description:  Absolute number of ChAT-positive cells counted in the DVC region
Number of Rows: 37
Column Names: 
	A. [Brain Region] DVC, dorso-vagal complex
	B. [Age] Young (3-4 months), Adult (8-12 months), Old (18-20 months)
	C. [Genotype] wild-type (wt); tgNM
	D. [Animal ID]
	E. [Result] Number of ChAT-positive cells
Missing data codes: N/A

Date of Creation: 2024-08-12
Description of Data: Raw Data corresponding to Figure S9 - panel E
Number of Variables: 4
Variable List:
	A. [DVC DA synthesis (% wt)] DVC, dorso-vagal complex; DA, dopamine; wt, wild-type 
	Description:  Ratio to calculate the rate of dopamine synthesis compared to wild-type mice using the formula DA+NE+DOMA+VMA+ 3MT+DOPAC /L- DOPA 
	B. [DVC DA degradation (% wt)] DVC, dorso-vagal complex; DA, dopamine; wt, wild-type 
	Description:  Ratio to calculate the rate of dopamine degradation compared to wild-type mice using the formula DOPAC+3MT/DA
	C. [DVC NA synthesis (% wt)] DVC, dorso-vagal complex; NA, noradrenaline; wt, wild-type 
	Description:  Ratio to calculate the rate of noradrenaline synthesis compared to wild-type mice using the formula NA/DA
	D. [DVC NA degradation (% wt)] DVC, dorso-vagal complex; NA, noradrenaline; wt, wild-type 
	Description:  Ratio to calculate the rate of noradrenaline degradation compared to wild-type mice using the formula  DOMA+ VMA/NA
Number of Rows: 152
Column Names: 
	A. [Brain region] DVC, dorso-vagal complex
	B. [Metabolite] DA, dopamine; NA, noradrenaline
	C. [Parameter] synthesis; degradation
	D. [Age] Young (3-4 months), Old (18-20 months)
	E. [Genotype] wild-type (wt); tgNM
	F. [Animal ID]
	G. [Result] Ratio (% to wild-type)
Missing data codes: N/A

-----------
METHODOLOGY
-----------
Description of methods used for data collection and data processing: 

Human post-mortem brain tissue. For NM characterization in the human brain paraffin-embedded midbrain sections from healthy control subjects (n=4, mean age=80.75±1.65 years) were provided by the Neurological Tissue BioBank at IDIBAPS-Hospital Clinic (Barcelona) and the Biobanco en Red de la Región de Murcia (BIOBANC-MUR). Standard hematoxylin-eosin and Masson-Fontana staining (see below) were performed on 5 µm-thick paraffin-embedded SNpc and LC sections. NM-MRI images were provided by Dr. Alex Rovira (Neuroradiology section, Vall d’Hebron Hospital, Barcelona, Spain). Autopsy representative images from midbrain and pons (control subjects aged 62 and 51 years, respectively) were provided by Dr. Ellen Gelpi (Division of Neuropathology and Neurochemistry, Department of Neurology, Medical University of Vienna, Austria).
TgNM mouse colony. Transgenic mice were obtained by pronuclear microinjection of the human tyrosinase complementary DNA (cDNA) fused to the rat tyrosine hydroxylase promoter (Figure S10) into C57Bl6-SJL (RRID:MGI:5656718) mouse zygotes (Centre for Animal Biotechnology and gene Therapy [CBATEG]). The plasmid containing the cDNA for TYR was kindly provided by Dr. Takafumi Hasegawa (Department of Neurology, Tohoku University School of medicine, Sendai, Japan)88. Animals exhibited a normal reproductive performance (litter size ± SD=6.2 ± 4.5). Adult/old TgNM mice exhibited an increased body weight of 21% (average) compared to wt littermates. Mice were backcrossed for 8-10 generations using C57BL/6J mice (Charles River; RRID:MGI:3028467) and maintained in heterozygosis. Animals were housed two to five per cage with ad libitum access to food and water during a 12 hours (h) light/dark cycle (light-on 8 a.m.). To reduce the number of animals used for the study, age variable was prioritized over sex variable, the latter not being included in the experimental design. Male and female mice were evenly assigned to all experimental groups to avoid sex bias. No post hoc sex analysis was performed because of low sample size. 
Genotyping. DNA was routinely extracted from mouse ear punches with the kit AccuStart™ II Mouse Genotyping Kit (QuantaBio, #95135) and a PCR was performed by mixing 1ul of DNA with the primers TYR-Forward (TTCAGACCCAGACTCTTTTCAA), TYR-Reverse (GCTGCTTTCTCTTGTGACGA) at a concentration of 500nM using a 9800 Fast Thermal Cycler (Applied Biosystems). Amplification product was loaded into 1.8% agarose gel and visualized using a GelDoc XR (BioRad). Male and female wt and tgNM mice were randomly distributed into the different experimental groups and wt/tgNM animals were processed at once to minimize bias. 
Survival analysis and reproduction. All animals were followed throughout their lifespan and a survival analysis (log-rank test and Gehan-Breslow-Wilcoxon test) was performed considering all-natural deaths as positive events and all animals used for experimental purposes as censored data. Animals used for experimental purposes were chosen randomly and for reasons unrelated to their health status, thus avoiding a potential bias due to censoring89. For reproduction assessment, all heterozygous matings (n=147) were registered with a mean of 6.2 ± 4.5 pups per litter (mean ± SD).
Brain processing. Animals were deeply anesthetized with sodium pentobarbital intraperitoneally and then perfused through the left ventricle with saline (0.9% [wt/vol]) at room temperature (RT), followed by ice-cold formaldehyde solution 4% phosphate buffered for histology (Panreac). Brains were removed and post-fixed for 24 h in the same fixative and subsequently processed for paraffin embedding following standard procedures or cryoprotected for 24-48 h in 30% sucrose at 4°C and frozen. Sectioning was performed with a sliding microtome (Leica, Germany) at 5 µm-thickness for paraffin samples or in a cryostat at 30 µm-thickness for frozen samples (Leica, Germany).
Brain clarification. The protocol used was modified from 90. Briefly, brains were embedded in 1% low melting point agarose and dehydrated in methanol. Once dehydrated the brains were incubated during 4 hours shaking in 66% dichloromethane (DCM) /33% methanol at room temperature. Then the brains were incubated with shaking in 100% DCM 30 minutes twice to complete the delipidation process. Finally, the brains were chemically cleared with BABB (a combination of 1 part of benzyl alcohol and 2 parts of benzyl benzoate). The brains were subsequently immersed in a BABB-filled chamber for Optical projection tomography (OPT) imaging. The brains were scanned with transmission light with three different filters (a cyan fluorescent protein -CFP-filter: emission 460-500nm, a green fluorescent protein -GFP- filter: emission 500-550nm and a DSR filter: emission 610nm) using a home-built OPT imaging system mounted on a Leica MZ 16 FA microscope91. The brain images were visualized using the open source software Fiji92 (RRID:SCR_002285; http://fiji.sc/). 
Immunohistochemistry. Deparaffinized sections or mouse brain cryosections were quenched for 10 min in 3% H2O2-10% (vol/vol) methanol. Antigen retrieval in deparaffinized sections was performed with a 10 mM citric acid solution at pH 6.0 at 95ºC for 20 min. Sections were rinsed 3 times in 0.1 M Tris buffered saline (TBS) between each incubation period. Blocking for 1 h with 5% (vol/vol) normal goat or rabbit serum (NGS or NRS) (Vector Laboratories, #S-1000; RRID:AB_2336615 and #S-5000; RRID:AB_2336619) was followed by incubation with the primary antibody (Table S2) at 4ºC for 24 or 48h in 2% (vol/vol) serum and with the corresponding biotinylated antibody (Vector Laboratories) or alkaline-phosphatase antibody (ab6722; RRID:AB_954595) for 1h at room temperature. Sections were visualized by incubation with avidin-biotin-peroxidase complex (Thermo Fisher Scientific, ABC Peroxidase Standard Staining Kit #32020 or Ultra-Sensitive ABC Peroxidase Standard Staining Kit #32050), VectorSG Peroxidase Substrate Kit (Vector Laboratories, #SK-4700; RRID:AB_2314425) or ImmPACT Vector Red Substrate (Vector, #SK-5105; RRID:AB_2336524) and then mounted and coverslipped with DPX mounting medium (Sigma-Aldrich #06522). Bright-field section images were examined with Zeiss Imager.D1 microscope coupled to an AxioCam MRc camera and with Pannoramic 250 Flash III (3D Histech), and processed with ZEN 2011 software (Zeiss, Germany; RRID:SCR_013672; https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html) and Caseviewer 3D HISTECH Ltd (RRID:SCR_017654; https://www.3dhistech.com/caseviewer), respectively. 
Immunofluorescence. Deparaffinized sections were blocked with 5% (vol/vol) NGS and 0.1% (vol/vol) Triton X-100 (Sigma-Aldrich) in phosphate buffered saline (PBS) solution. Corresponding primary antibodies (Table S2) were incubated together overnight at 4°C in 2% (vol/vol) NGS and adequate Alexa 488, 594, and 647-conjugated secondary antibodies (1:1000, Thermo Fisher Scientific; RRID:AB_2534117; RRID:AB_2534079; RRID:AB_2534073; RRID:AB_2536183), together with Hoechst 33342 (1:10000, Cell Signaling Technology; RRID:AB_10626776) to stain nuclei, were incubated simultaneously for 1h at RT in 2% (vol/vol) serum. Sections were coverslipped using the DakoCytomation Fluorescent Mounting Medium (Dako, S302380-2). Immunofluorescence section images were examined using ZEISS LSM 980 with Airyscan 2 and processed with ZEN 2011 software (Zeiss, Germany; RRID:SCR_013672; https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html).
Nissl and hematoxylin-eosin staining. To perform the NM brain map, standard Nissl staining was performed for each animal in serial 30 µm-thick cryosections spanning the whole brain from the olfactory bulb to the beginning of the spinal cord. Areas from A16 to A12 were imaged with Zeiss Imager.D1 microscope coupled to an AxioCam MRc camera. Standard hematoxylin-eosin staining was performed in 5 µm-thick paraffin-embedded sections covering the SN/VTA and LC regions for each animal. In these sections, catecholaminergic neurons were identified by the visualization of unstained NM pigment.
Intracellular NM quantification. Five µm-thick paraffin-embedded hematoxylin-eosin-stained sections or 30µm-thick unstained cryopreserved sections representative of the different regions of interest (SN, VTA, LC, DVC) at different ages were selected from different animals (n=5-8 tgNM per age) and all pigmented neurons per section were analyzed. Melanized catecholaminergic neurons were identified by the visualization of unstained NM brown pigment. H&E sections were scanned using the Pannoramic Midi II FL, HQ SCIENTIFIC 60x and section images were acquired with CaseViewer software at an objective magnification of 63x. Alternatively, bright-field pictures from unstained sections were taken with the Zeiss Imager.D1 microscope coupled to an AxioCam MRc camera. All NM-positive neurons from each brain nuclei were analyzed by means of optical densitometry using ImageJ software (NIH, USA; RRID:SCR_003070; https://imagej.net/) to quantify the percentage (%) of cytosolic area occupied by NM pigment in hematoxylin-eosin-stained sections and the intracellular optical density (OD) of NM in unstained sections as previously reported19. For NM pigment OD measurements, the pixel brightness values for all individual NM-positive cells (excluding the nucleus) in all acquired images were measured and corrected for non-specific background staining by subtracting values obtained from the neuropil in the same images. All quantifications were performed by an investigator blinded to the experimental groups.
Stereological cell counting. Assessment of (i) the total number of SNpc, VTA, LC and DVC TH-positive neurons, (ii) the number of NM-laden neurons, (iii) the total number of DA/NA neurons in the different regions of interest, (iv) the total number of ChAT-positive neurons in DVC, PPN and NBM, and (v) the total number of TPH-positive neurons in the DR, was performed according to the fractionator principle, using the MBF Bioscience StereoInvestigator 11 (64 bits) Software (Micro Brightfield; RRID:SCR_002526; https://www.mbfbioscience.com/products/stereo-investigator). Serial 30 µm-thick cryosections (every fourth section for SNpc, VTA, LC; every sixth section for PPN, NBM and DVC), or 5 µm-thick paraffin sections for the DR (every tenth section), covering the entire nuclei were included in the counting procedure. For SNpc, VTA, LC, PPN and NBM a 25% of the area was analyzed with the following sampling parameters: (i) a fixed counting frame with a width and length of 50 µm; (ii) a sampling grid size of 125 x 100 µm. The counting frames were placed randomly by the software at the intersections of the grid within the outlined structure of interest. For DR and DVC, the 100% of the area was analyzed. Cells in both brain hemispheres were counted following the unbiased sampling rule using a 100x lens and included in the measurement when they came into focus within the dissector. A coefficient error of <0.10 was accepted. Data for the total numbers of TH-positive neurons, TPH-positive and ChAT-positive neurons are expressed as absolute numbers. The total number of catecholaminergic SNpc, VTA, LC and DVC neurons was calculated by considering all TH+NM+, TH-NM+ and TH+NM- neurons. The percentage of TH down-regulation was calculated by considering the total number of TH+NM+ and the total number of TH-NM+ with respect to the total number of neurons containing NM in the different experimental groups. The number of tgNM and wt mice analyzed at each age is as follows: SNpc and VTA Young (n=7 wt, n=7 tgNM), Adult (n=13 wt, n=6 tgNM), Old (n=19 wt, n=12 tgNM); LC Pubertal (n=7 wt, n=4 tgNM), Young (n=5 wt, n=6 tgNM), Adult (n=14 wt, n=5 tgNM), Old (n=12 wt, n=7 tgNM); NBM Old (n=8 wt, n= 7 tgNM); PPN Old (n= 6 wt, n=6 tgNM); DR Old (n= 6 wt, n=5 tgNM); DVC Young (n=5 [TH] / 6 [ChAT] wt, n=6 tgNM), Adult (n=6 wt, n=6 tgNM), Old (n=6 wt, n=6 tgNM). All quantifications were performed by an investigator blinded to the experimental groups.
Quantification of neuropathological parameters. The absolute number of extracellular NM (eNM) aggregates was estimated using the stereological parameters used for the stereological cell counting and in the same sections in which neurodegeneration was assessed (SNpc, VTA, LC and DVC). The number of p62-immunopositive Marinesco bodies and Lewy body-like inclusions were counted from SNpc, VTA, LC and DVC sections fluorescently immunostained with guinea pig anti-p62 (1:500, Progen #GP62-C), mouse anti-α-synuclein (1:500, BD Biosciences #610786) and TH (1:1000, Calbiochem #657012). The total number of p62-positive inclusions falling into each category was counted from one representative coronal section of the SNpc, VTA, LC and DVC nuclei in each animal. TgNM and wt mice were analyzed at different ages: 1m (n=5 for LC and DVC), 3m (n=6), 12m (n=7 for all regions), 20m (n=6 for LC and DVC, n=4 for SN and VTA). All quantifications were performed by an investigator blinded to the experimental groups.
Optical densitometry of neuronal fibers. The density of TH/DAT/VMAT2-positive fibers in the striatum, nucleus accumbens and olfactory tubercle was measured by densitometry in serial coronal sections covering the whole regions (4 sections/animal). TH-immunostained 30 µm-thick cryosections were scanned with an Epson Perfection v750 Pro scanner and the resulting images were quantified using ImageJ. Densitometry values were corrected for non-specific background staining by subtracting densitometric values obtained from the cortex. Data are expressed as optical density or absorbance defined by the logarithmic intensity of the light transmitted through the material using the formula: -log10 (Striatum Intensity/Cortex Intensity). TgNM and wt mice were analyzed at different ages: Adult TH (n=14 wt, n=6 tgNM), DAT (n=12 wt, n=6 tgNM), VMAT (n=7-9 wt, n=4-6 tgNM); Old TH (n=20 wt, n=13 tgNM), DAT (n=20 wt, n=13 tgNM), VMAT (n=12-15 wt, n=13-14 tgNM).
Quantification of neuroinflammation parameters. Quantification of Iba-1 and GFAP-positive cells was performed in one SNpc, VTA, LC, and DVC representative section. Sections were scanned using the Panoramic Midi II FL, HQ SCIENTIFIC 60x scanner and section images were acquired with CaseViewer software (RRID:SCR_017654; https://www. 3dhistech.com/caseviewer). For quantification of Iba-1 and GFAP-positive cells, specific AI-based algorithms were implemented using the Aiforia 5.3 platform (RRID:SCR_022739, https://www. aiforia.com) as previously described 20. Iba-1-positive cells were counted separately in two different groups according to their activation state: non-reactive (branched) and reactive (amoeboid). GFAP-positive cells were counted individually. All quantifications were performed by an investigator blinded to the experimental groups. SN and VTA sections: Young (n=8 wt, n= 6 tgNM), Adult (n=4 wt, n=5 [Iba1] / 6 [GFAP] tgNM), Old (n=6 wt, n=5 tgNM); LC sections: Young (n=8 wt, n=6 tgNM), Adult (n=4 wt, n=5 tgNM), Old (n=5 wt, n=4 tgNM); DVC sections: Young (n=7 [Iba1] / 8 [GFAP] wt, n=6 tgNM), Adult (n=4 wt, n=5 tgNM), Old (n=4 [Iba1] / 5 [GFAP] wt, n=4 tgNM).
Gene expression of human tyrosinase and dopaminergic markers. Total RNA was extracted from dissected ventral midbrain (vMB), comprising the SN and VTA regions, from young (n=4 wt, n=5 tgNM), adult (n=6 wt, n=6 tgNM) and old (n=6 wt, n=12 tgNM) mice. To assess whole-brain TYR expression, total RNA was also extracted from additional dissected brain regions (i.e. LC, OB, DVC, PFC, HIP) of adult mice (n=6 wt, n=6 tgNM). MirVana PARIS RNA and Native Protein Purification Kit (Thermo Fisher Scientific # AM1556) was used for total RNA extraction and RNA concentration was determined using a NanoDrop ND-1000 Spectrophotometer. 0.5 µg of total RNA were retrotranscribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific # 4368814). qPCR was performed with 10 ng of cDNA per well in technical triplicates mixed with Taqman Gene Expression Master Mix (Applied Biosystems, # 4369016) and Taqman gene expression assays (human tyrosinase [TYR] Hs00165976_m1; mouse TH Mm00447557_m1; Slc6A3 [DAT] Mm00438388_m1; Slc18a2 [VMAT2] Mm00553058_m1, Applied Biosystems) using standard procedures in a 7900HT Fast Real Time Instrument (Applied Biosystems). Threshold cycles (Cts) for each target gene were normalized to the geometric mean of three endogenous reference genes (Gapdh Mm99999915_g1, Rpl19 Mm02601633_g1 and Ppia Mm02342430_g1). Water was included in the reaction as a non-template (negative) control. The relative expression was calculated with the ΔCt-method.
Immunoblot. Dissected SN-VTA from adult (N =6 wt, N =8 tgNM) and Str tissue from old (N =6 wt, N =8 tgNM) mice were homogenized in RIPA buffer supplemented with protease inhibitors (Roche) and cell extracts clarified by centrifugation at 13000g for 30 min at 4ºC. Protein concentrations were quantified using the BCA method and subjected to SDS-PAGE. Proteins were resolved in 10 or 15 % polyacrylamide gels and transferred onto 0.45 µm nitrocellulose membranes (Amersham). Blocking with 5% milk powder in PBS was followed by overnight incubation at 4ºC with the primary antibodies diluted as indicated in Table S2. Incubation with the secondary antibodies goat anti-rat (#NA935; RRID:AB_772207), donkey anti-rabbit (#NA934; RRID:AB_772206) and sheep anti-mouse (#NXA931; RRID:AB_772209) (all 1:1000, from Amersham), was performed for 1h at RT. Band densitometry, normalized to β-actin expression, was measured using ImageJ image analysis software (RRID:SCR_003070; https://imagej.net/). 
In vivo microdialysis. To assess local effects of nomifensine (DAT and NET inhibitor) on striatal DA release, extracellular DA concentration was measured by in vivo microdialysis experiments as previously described93,94. Briefly, the drug was dissolved in artificial cerebrospinal fluid (aCSF in mM: NaCl, 125; KCl, 2.5; CaCl2, 1.26 and MgCl2 1.18) and administered by reverse dialysis at 10 and 50µM (uncorrected for membrane recovery). Concentrated solutions (1 mM; pH adjusted to 6.5–7 with NaHCO3 when necessary) were stored at -80ºC and working solutions were prepared daily by dilution in aCSF. One concentric dialysis probe (Cuprophan membrane; 6000 Da molecular weight cut-off; 1.5 mm-long) was implanted in the striatum (AP, 0.5; ML, -1.7; DV, -4.5 in mm) of isoflurane-anesthetized mice (wt and tgNM, n=7 mice per group). Microdialysis experiments were performed in freely-moving mice 24h after surgery. Probes were perfused with aCSF at 1.5 μL/min. Following an initial 100-min stabilization period, 5 or 7 baseline samples were collected (20 min each) before local drug application by reverse dialysis and then successive dialysate samples were collected. The concentration of DA in dialysate samples was determined by HPLC coupled to electrochemical detection (+0.7 V, Waters 2465), with 3-fmol detection limit. The mobile phase containing 0.15 M NaH2PO4.H2O, 0.9 mM PICB8, 0.5 mM EDTA (pH 2.8 adjusted with orthophosphoric acid), and 10 % methanol was pumped at 1 ml/min (Waters 515 HPLC pump). DA was separated on a 2.6 mm particle size C18 column (7.5 x 0.46 cm, Kinetex, Phenomenex) at 28°C. Microdialysis data are expressed as femtomoles per fraction (uncorrected for recovery) and are shown in figures as percentages of basal values (individual means of 5-7 pre-drug fractions).
UPLC-MS/MS. Chromatographic determination of catecholaminergic, serotonergic and cholinergic metabolites in brain and peripheral samples was performed by UPLC-MS/MS using our previously validated method67 with modifications as follows: (1) Brain and peripheral samples collection. Heart, intestines and several brain regions including vMB, LC, Str, PFC, DR-PPN and DVC were dissected, frozen on dry ice, and stored at -80ºC until use; (2) Sample preparation. The day of analysis, samples were homogenized with 300 µl of 250 mM formic acid (FA) and split in two: (i) 55 µl for acetylcholine (Ach) determination, which were diluted 1:4 with 0.1% formic acid in acetonitrile containing 100 nM of Acetylcholine-d4 Chloride as internal standard (IS); (ii) 240 µl for catecholaminergic and serotonergic determination to which a mixture (500 nM each) of dopamine-d4 hydrochloride (DA-d4) and serotonin-d4 Hydrochloride (5-HT-d4) were added as IS. After centrifugation, supernatants were filtered using an Ostro™ protein precipitation and phospholipid removal plate (Waters, USA) prior the injection in the UPLC-MS/MS system. On the other hand, the pellet of the 240 µl sample was further processed to determine the “protein-bound” (PB) fraction of 5-S-cysteinyldopa (5SCD) and 5-S-cysteinyldopamine (5SCDA). 5SCD and 5SCDA standards were kindly provided by Profs. Kazumasa Wakamatsu and Shosuke Ito at the Fujita Health University, Aichi, Japan. Aminochrome standard (0.5 mM) was freshly prepared as previously described 67,95; (3) Reductive hydrolysis and alumina extraction of catecholic compounds. Preparation of the PB fraction samples was performed using the reductive hydrolysis and alumina extraction method of Murakami et al.96 with some modifications. The pellet was washed with 1 ml of a 1:1 mixture of methanol and chloroform, vortex-mixed and centrifuged at 20.000 g for 10 min at 4ºC. Three hundred µl of a mixture containing 6 M HCl, 5% thioglicolic acid and 1% phenol were added to the resulting pellet into a sealed-capped tube. Tubes were then purged with a stream of nitrogen and incubated for 16 h at 110 ºC. After cooling, 100 µl of the hydrolysate were added to a tube containing 50 mg of acid-washed alumina prior the addition of 200 µl of 1% Na2S2O5 – 1% EDTA.2Na and 500 µl 2.7 M Tris. HCl – 2% EDTA.2Na (pH 9.0). Tubes were vigorously mixed on a microtube mixer for 5 min and then centrifuged at 20.000 g for 10 min at 4ºC. After removal of the supernatant, the alumina was washed with 1 ml of MilliQ water and centrifuged at 20.000 g for 10 min at 4ºC three times. 5SCD and 5SCDA were finally eluted from alumina with 100 µl of 0.4 M HClO4 by shaking for 2 min on a microtube mixer. Seven µl were injected into the UPLC-MS/MS system under MIX3 conditions; (4) UPLC-MS/MS analysis. The chromatographic separation of samples for ACh determination was performed on a Cortecs UPLC HILIC (1.6 µm; 2,1x75 mm) column coupled to a Cortecs UPLC HILIC VanGuard pre-column (Waters). Column temperature was set at 50 ºC and samples were maintained at 6 ºC in the thermostatic autosampler. The mobile phase consisted of solvent A (Acetonitrile + 0.1% FA) and solvent B (10 mM ammonium acetate in MilliQ water) at a flow of 0.5 mL/min with isocratic 70% A- 30% B conditions during 2.2 min. Samples for catecholaminergic and serotonergic determination were injected five times into the UPLC-MS/MS system to analyze different sets of compounds, i.e. MIX1, MIX2, MIX3, MIX3-PB and MIX4. MIX1 includes dopamine (DA), noradrenaline (NA), 3-methoxytyramine (3MT), 3,4-dihydroxyphenylalanine (L-DOPA) and aminochrome (AC); MIX2 includes 3,4-Dihydroxyphenylacetic acid (DOPAC), 3,4-dihydroxymandelic acid (DOMA) and vanillylmandelic acid (VMA); MIX3 and MIX3-PB include 5SCD and 5SCDA; MIX4 includes serotonin (5-HT), tryptophan (Trp) and 5-hydroxyindole-3-acetic acid (5-HIAA). An Acquity HSS T3 (1.8 μm, 2.1 mm × 100 mm) column coupled to an Acquity HSS T3 VanGuard (100 Å, 1.8 μm, 2.1 mm × 5 mm) pre-column was used to detect MIX1-3 analytes while an Acquity UPLC BEH C18 (1.7μm 2.1x100mm) column coupled to a Acquity BEH C18 1.7μM VanGuard pre-column was used to detect MIX4. Column temperature was set at 45 ºC for MIX1-3 and at 55º for MIX4. The mobile phase consisted of solvent A (methanol 100%) and solvent B (25 mM FA in MilliQ water) at a flow of 0.4 ml/min (0.5 ml/min for MIX4) with the following gradient profiles: (i) MIX1 and MIX2: 0.5 % B maintained for 0.5 min, 5 % B at 0.9 min maintained for 2.1 min, 50 % B at 2.8 min maintained for 1.2 min, 0.5 % B at 4.1 min maintained 0.2 min for equilibration; (ii) MIX3 and MIX3-PB: 0.5 % B maintained for 0.5 min, 8 % B at 2.6 min, 50 % B at 2.9 min and maintained for 0.6 min, 0.5 % B at 3.7 min maintained 0.2 min for equilibration and (iii) MIX4: 1% B maintained for 0.5 min, 25 % B at 3 min, 50 % B at 3.1 min and maintained for 0.5 min, 1 % B at 3.6 min maintained 0.4 min for equilibration. The mass spectrometer detector operated under the following parameters: source temperature 150ºC, temperature 450ºC, cone gas flow 50 L/hr, desolvation gas flow 1100 L/hr and collision gas flow 0.15 ml/min. Argon was used as the collision gas. The capillary voltage was set at: 0.5 kV (MIX1, MIX3 and MIX3-PB), 2 kV (MIX2) or 3 kV (MIX4, ACh). The electrospray ionization source was operated in both positive and negative modes, depending on the analyte. Multiple Reaction Monitoring (MRM) acquisition settings for the targeted metabolites are summarized in Table S3. Samples with a concentration between the limit of detection (LOD) and limit of quantification (LOQ) or bigger than LOQ were considered acceptable; samples with a concentration lower than LOD were considered as the LOD value. Catechol oxidation was measured using the formula AC+5SCDA+5SCDA-PB/DA + 5SCD+5SCD-PB/L-DOPA. DA synthesis was measured using the formula DA+NE+DOMA+VMA+ 3MT+DOPAC /L- DOPA. DA degradation was measured using the formula DOPAC+3MT/DA. NA synthesis was measured using the formula NA/DA. NA degradation was measured using the formula DOMA+ VMA / NA. Data was normalized by the protein concentration (determined by BCA) and presented as the percentage of the wt concentration or ratio. SN-VTA Young (n=6 wt, n=13 tgNM), SN-VTA Old (n=6 wt, n=8 tgNM), Str Young (n=9 wt, n=13 tgNM), Str Old (n=6 wt, n=11 tgNM), LC Young (n=9 wt, n=13 tgNM), LC Old (n=6 wt, n=8 tgNM), PFC Young (n=8 wt, n=13 tgNM), PFC Old (n=6 wt, n=11 tgNM), DVC Young (n=8 wt, n=13 tgNM), DVC Old (n=6 wt, n=12 tgNM), heart Young (n=9 wt, n=13 tgNM), heart Old (n=11 wt, n=12 tgNM), intestines Young (n=9 wt, n=13 tgNM), intestines Old (n=17 wt, n=17 tgNM), PPN-DR Young (n=8 wt, n=12 tgNM), PPN-DR Old (n=4 wt, n=10 tgNM).
Behavioral analyses. All behavioral analyses were performed at the same time of the day (9am-1pm): (1) Beam test. Mice were placed at the beginning of an elevated horizontal beam bar (40cm). The time it took the mice to cross the beam was measured for a maximum of 120 seconds. When an animal fell, the maximum time of 120s was assigned. Animals that failed at doing the task (i.e not crossing or going backwards) were removed from the analysis. Young (n=15 wt, n=13 tgNM), Adult (n=14 wt, n=17 tgNM), Old (n=13 wt, n=10 tgNM); (2) Habituation and dishabituation (olfaction test). Three different cotton swabs were presented to mice (5 min each), the first one was presented for object habituation, the second one was impregnated with water and the third one was impregnated with lemon essence (Essenciales). The number of times the animal went towards the second and third cotton swabs and the time the animal spent sniffing them were measured. The discrimination index (DI) was calculated according to the formula: (Time exploring lemon essence–Time exploring water) / (Time exploring lemon essence+Time exploring water). Young (n=15 wt, n=15 tgNM), Adult (n=18 wt, n=17 tgNM), Old (n=13 wt, n=10 tgNM); (3) Grip strength test. Mice were held by the middle/base of the tail and allowed to grasp a series of increasing weights consisting of tangled fine gauge stainless steel wire attached to steel chain (13.2, 19.7, 25.9, 32.1, 38.4, 44.6 g). Mice were then lifted carrying the corresponding weight with their forepaws. Time holding each weight (for a total of 5s each) was assessed, being 30 seconds the maximum time when succeeding in holding all weights. Grip latency (s) was calculated as a sum of the time holding the increasing weights. Young (n=17 wt, n=24 tgNM), Adult (n=19 wt, n=19 tgNM), Old (n=18 wt, n=12 tgNM); (4) Novel Object Recognition Test. This protocol is used to evaluate cognition in mice, particularly recognition memory. It assesses inherent behaviour in mice to explore a novel object. This test consisted in exposing the animals to objects that with habituation become familiar and after 24h one of the object was changed with a new one and the discrimintation index ([time exploring the new object]-[time exploring the familiar object]/total time) was measured. Recorded data was analyzed by the Applied Research in Laboratory Animals Platform staff at Parc Científic de Barcelona (Spain). Adult (n=18 wt, n=17 tgNM), Old (n=14 wt, n=10 tgNM); (5) Step down test. The passive avoidance or step-down test [Passive Avoidance - Step Down for Mice (vibrating platform), #40570, Ugo Basile] consists of a platform located in a controllable electrified net. During training, mice were placed in the platform and received an electric shock of 0.3 mA when stepping down the platform. After 24 hours, mice were placed again in the same platform and the latency of stepping down was measured, though this second time the net was not electrified. The time on the platform was calculated by subtracting the latency time from the first day to that of the second day to normalize for the inter-individual variability in curiosity/activity of each mouse. Adult (n=17 wt, n=15 tgNM), Old (n=13 wt, n=10 tgNM); (6) Open field. Mice were placed in a square open field arena of 80 x 80 cm of white methacrylate, brightly lit (300 lux), where the center and the periphery can be distinguished using a tracking software (SMART 3.0 Panlab-Harvard Apparatus). Recorded data was analysed by the Applied Research in Laboratory Animals Platform staff at Parc Científic de Barcelona (Spain). Adult (n=18 wt, n=17 tgNM), Old (n=14 wt, n=9 tgNM); (7) Polysomnography. Eight months aged male tgNM mice and their wt littermates were conventionally prepared under anesthesia (ketamine and xylazine, 100/10 mg/kg. i.p.) for polysomnography. Briefly, 3 electrodes were screwed to skull above parietal and frontal cortex and cerebellum as the reference for electroencephalogram (EEG) whereas 2 wire electrodes were slipped between neck muscles for electromyogram (EMG). Leads were then brazed to a miniature plug (Plastics One, Bilaney, Germany), cemented to skull using acrylic cement (Superbond, C&B Sun Medical) and coated using dental cement (Paladur, Heraeus Kulzer). A subcutaneous injection of carprofen (5 mg/kg) was administered for pain caring. Once recovered, mice were housed in individual barrels under 12h light/dark cycle (light-on 7 a.m.) and constant temperature, tethered to the acquisition system and recorded 1 week out of 3 over 12 consecutive months until natural death. Based on amplified/digitized unipolar EEG and bipolar EMG signals, vigilance states were visually scored using a 5s sliding window frame and assigned as Waking (W), Slow Wave Sleep (SWS) and Paradoxical Sleep (PS) to produce hypnograms and state quantifications (Sleepscore, Viewpoint). Adult (n=7 wt, n=8 tgNM), Old (n=6 wt, n=5 tgNM); (8) Tail suspension test. This test was performed as previously described98. Briefly, animals were suspended by their tails with tape into a suspension bar. To avoid the tail climbing behavior, a 2cm methacrylate tube was passed through the tail before suspending the animal. The escape-oriented behaviors (i.e. fore and hind limbs movement) were quantified during six minutes. Data is presented as total immobilization time (s). Young (n=16 wt, n=16 tgNM), Adult (n=15 wt, n=13 tgNM), Old (n=11 wt, n=11 tgNM); (9) Vocalizations test. Animals that vocalized during the 6 min of the tail suspension test were registered with a yes/no score. Young (n=16 wt, n=16 tgNM), Adult (n=21 wt, n=19 tgNM), Old (n=18 wt, n=12 tgNM). Behavioural equipment was cleaned with 70% ethanol after each test session to avoid olfactory cues. All behavioral tests were performed by an investigator blinded to the experimental groups.
Assessment of peripheral functions. (1) Heart Rate. The PhysioSuite apparatus (Kent Scientific) was used to measure the heart rate under mild anesthesia. The isoflurane rate used was 1.5% and 1l/min O2. The clip sensor was located in the right hind paw for 30 seconds before starting the recording and the first 10 recordings were taken and represented as average beats/minute. Young (n=12 wt, n=13 tgNM), Adult (n=12 wt, n=11 tgNM), Old (n=12 wt, n=22 tgNM). (2) Blood pressure. Blood pressure was measured in a non-invasive way using the tail-cuff method (LE-5002 Non-Invasive Blood Pressure Meter, Panlab). The systolic and diastolic blood pressure (in mmHg) were assessed in two independent sessions for each mouse and the results were calculated as the mean from the valid values of 10 measurements in each session. n=19 wt, n=15 tgNM; (3) Respiratory rate. Respiration frequency was determined using microCT measurements acquired with Quantum FX imaging system (Perkin Elmer. 940 Winter St. Waltham, Massachusetts. EEUU), specifically designed for small lab animals. For the scanning procedure, animals were anesthetized with isoflurane (5% induction phase, 1% maintenance). The air flow was set to 0.8l/minute. Defined parameters for image acquisitions were: field of view 73 mm, acquisition time 2 minutes, current voltage 70 mV and amperage 200 uA. Image reconstruction was based on Feldkamp´s method. Imaging data was analysed by the Preclinical Imaging Platform staff at Vall d´Hebron Research Institute (Spain). n=12 wt, n=13 tgNM. (4) Intestinal transit time. Mice were administered a red dye (Carmine red dye, Sigma #C1022) in 0,5% methylcellulose (Sigma #M7027) by oral gavage. Animals were individualized in new cages without bedding and monitored for a total time of 4 hours. The time period until the animal defecated the first dyed feces was registered. Adult (n=19 wt, n=18 tgNM), Old (n=18 wt, n=12 tgNM). All tests were performed by an investigator blinded to the experimental groups.
Statistics. Statistical analyses were performed using GraphPad Prism v6 software (RRID:SCR_002798; http://www.graphpad.com/) using the appropriate statistical tests, as indicated for each figure legend in the Source Data file. We used the sample size calculator GRanmo (https://www.datarus.eu/aplicaciones/granmo/) to calculate sample size and sample sizes are equivalent to those reported in previous similar publications19. Outlier values in qPCR experiments were identified by ROUT (Q = 1.0%) test and excluded from the analyses when applicable. Outlier values in UPLC experiments were identified by the Grubbs' test (i.e. Extreme Studentized Deviate, ESD, method) and excluded from the analyses when applicable. All data is represented as box-and-whisker plots (median, minimum, maximum and interquartile range). Since all experiments had a relatively small number of mice (n=4-24 mice/group), nonparametric tests were used because a Gaussian distribution could not be assumed considering sample size. In all analyses, the null hypothesis was rejected at the 0.05 level.


-----------------------
DATA ACCESS AND SHARING
-----------------------
Publications based on this dataset: Modelling human neuronal catecholaminergic pigmentation in rodents recapitulates age-related multisystem neurodegenerative deficits. Laguna, Peñuelas et al. 
Recommended citation for this dataset: Laguna Tuset, A., Peñuelas, N., & Vila Bover, M. (2024). Modelling human neuronal catecholaminergic pigmentation in rodents recapitulates age-related multisystem neurodegenerative deficits [Data set]. Zenodo. https://doi.org/10.5281/zenodo.11355659
License information: Creative Commons Attribution 4.0 International