Journal article Open Access

MERS-CoV PCR/Sequencing Primers

sprotocols


MARC21 XML Export

<?xml version='1.0' encoding='UTF-8'?>
<record xmlns="http://www.loc.gov/MARC21/slim">
  <leader>00000nam##2200000uu#4500</leader>
  <datafield tag="540" ind1=" " ind2=" ">
    <subfield code="u">https://creativecommons.org/publicdomain/zero/1.0/legalcode</subfield>
    <subfield code="a">Creative Commons Zero v1.0 Universal</subfield>
  </datafield>
  <datafield tag="260" ind1=" " ind2=" ">
    <subfield code="c">2014-12-31</subfield>
  </datafield>
  <controlfield tag="005">20200120165705.0</controlfield>
  <controlfield tag="001">13652</controlfield>
  <datafield tag="909" ind1="C" ind2="O">
    <subfield code="p">openaire</subfield>
    <subfield code="o">oai:zenodo.org:13652</subfield>
  </datafield>
  <datafield tag="520" ind1=" " ind2=" ">
    <subfield code="a">Authors: Rachel Graham

### Abstract

This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes.

### Introduction

This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed.

### Materials

1. Invitrogen SuperScript III kit
- dNTPS (10 mM)
- Random Hexamers
- RNasin (if desired)
- Thermo Phusion PCR enzyme
- Primers (2 mM stock – see Tables 1 and 2)
- Agarose
- 1X TAE Buffer
- Ethidium Bromide

### Equipment

1. 70ºC water bath
- 55ºC water bath
- Thermal cycler

### Procedure

Reverse Transcription:

1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers.
- Incubate at 70ºC for 5 min.
- Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run):
  - 4 µL 5X First-Strand Buffer
  - 2 µL DTT
  - 1 µL SuperScript III reverse transcriptase
  - 1 µL dNTPs
  - 1 µL RNasin (if desired)
  - x µL H2O to 20 µL
- Incubate at 55ºC for 45 min to 1 h.
- Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation.
- Proceed with PCR setup.

PCR (with Phusion PCR kit):

1. Assemble PCR reactions to generate amplicons according to those detailed in Table 2 (for whole-genome sequencing) or with any combination of forward and reverse primers from Table 1.
- PCR reaction setup:
  - 2 µL First-strand template
  - 1 µL Forward Primer
  - 1 µL Reverse Primer
  - 5 µL 10X HF Buffer
  - 1 µL dNTPs
  - 0.5 µL Phusion polymerase
  - x µL H2O to 50 µL
- PCR reactions are run under standard PCR conditions:
  - 98ºC 5 min
  - 35 cycles of:
  - 98ºC 15 sec
  - xºC for 30 sec*
  - 72ºC for ~45 sec/kb
  - 72ºC 10 min
  - 8ºC Hold

Annealing temperature is primer-dependent, but for most SARS-CoV primers in Table 1, annealing temperatures 52-55ºC will work.

Confirmation of PCR products and sequencing:

1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success.
- Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well).
- PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions.
- Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 2.

### Timing

- Reverse transcription: 1-1.5 h
- PCR: 2-4 h
- Sequencing: facility-dependent

### Anticipated Results

Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus.

### Figures

**Table 1: MERS-CoV Sequencing Primers** 

HCoV-EMC Primers

1F 3-22
GGCCGCATTAATACGACTCA

2F 103-122
AAAGCCCTGTTGTTTAGCGT

3F 305-324
CATGTCTTTCGTGGCTGGTG

4F 785-804
TGAGCGAGACAACACCTCTT

5F 1291-1310
ACATTTACCACTCCGCATTC

6F 1787-1806
TGTTGTCCTCGCAATTCTCT

7F 2381-2400
GGTGGTCAATGGCAAAGTTT

8F 2885-2904
CTTTGGCGGTGATCAAGTAC

9F 3377-3396
TGTGCAAGAAGAAGCACAAC

10F 3837-3856
GCTAAAGGGCCGTTACAAGT

11F 4285-4304
CAGTTGACGGTGTGCAATAT

12F 4917-4936
GCAGACAATTTGACTGCTGA

13F 5307-5326
TGGAGAGAGTGGTGCAATGT

14F 5895-5914
GGCGGTGATGCTATTAGTTT

15F 6427-6446
TGCTTAGATTGCACACCGTT

16F 6923-6942
GTTTGAAGATGCCCAAGGTT

17F 7531-7550
GCGGTATTTCATTCTGTCGT

18F 8035-8054
TCACACGCGATAAGTTGGAA

19F 8393-8412
GGATGCACTTAAACGACAGA

20F 8867-8886
TACTACATTGGCTTGGGTGA

21F 9407-9426
TATAGGTTTGTGTGCGTTCC

22F 10073-10092
CAGTGGAGATGTTGAGGCTT

23F 10691-10710
ACTTAATGGTTGCGCTTGGT

24F 11123-11142
GGCCTTCGTTATGTTGTTGG

25F 11551-11570
TTGCTTACTCACCACAGCTT

26F 12121-12140
CCTTTGCTGAGTTGGAAGCT

27F 12667-12686
CTTCTGCCGTTAAGTTGCAA

28F 13219-13238
ATGGTGGAGCTTCAGTGTGT

29F 13885-13904
TGGTTGCTGTGATGTTACCT

30F 14433-14452
AGATCTTTGTTGATGGCGTG

31F 14965-14984
TGGCAAAGCTCGTGTCTATT

32F 15415-15434
TGCTCAGGTGCTAAGCGAAT

33F 15999-16018
TCATGGTAGAGCGGTTTGTG

34F 16305-16324
TTCTCTGCTGTAAATGCTGC

35F 16749-16768
CCAAACCACCACTCAATCGT

36F 17337-17356
CCGATATTCTGGTGGTTGAT

37F 17877-17896
AAACAGCAGATACGGCACAT

38F 18287-18306
ATAGGCTTCGATGTTGAGGG

39F 18887-18906
ATAGAACGTGTGGATTGGGA

40F 19255-19274
TTGTGATGGCGGTAGTTTGT

41F 19839-19858
GCTACAAGTTCGTCCTTTGG

42F 20357-20376
AAGAAGCAACAGGAAGGTCA

43F 20813-20832
CCTGCCAATATGCGTGTTAT

44F 21117-21136
TTGGTGGGTCTGTTGCTATT

45F 21629-21648
TGTTTCTAAGGCTGACGGTA

46F 22001-22020
CGATGGATGTGGCACTTTAC

47F 22327-22346
CCACCTTGCCTGTTTATGAT

48F 22863-22882
GCTGGTCCAATATCCCAGTT

49F 23363-23382
GCAGCGCTTTGTTTATGATG

50F 23995-24014
CCAATTTACGCCAGGATGAT

51F 24615-24634
GGTGCTATTTCCGCCTCTAT

52F 25065-25084
GAGCCCATTACCTCCCTTAA

53F 25521-25540
CCGCATAAGGTTCATGTTCA

54F 25951-25970
ATCCCTAAACCCACAGCTAA

55F 26609-26628
AAGGATTGGCTTCTCGTTCA

56F 27045-27064
CTTGTCGTCGCAGCATTATC

57F 27487-27506
AACGCGCGATTCAGTTCCTC

58F 27941-27960
TTGCATGGTCCCTGATCTTT

59F 28427-28446
GGCAAAGCTACGGAACTAAT

60F 29003-29022
GCGGAACCCTAACAATGATT

61F 29603-29622
TGACCCAAAGAATCCCAACT

62F 29843-29862
AAAGTAACAAGATCGCGGCA

1R 138-157
TTAATGCCACAATCCCACCA

2R 640-659
GCCAACCAGACTGCCATTTG

3R 1062-1080
CTTTACGCTCAACATGCCA

4R 1570-1589
GCCACCAAAGATAAGTGTGA

5R 2108-2127
ACACACCAGAATCCATGTCA

6R 2382-2401
GAAACTTTGCCATTGACCAC

7R 2886-2905
TGTACTTGATCACCGCCAAA

8R 3458-3477
CAGTATCAGGCACAACAGGA

9R 3994-4013
TGCTGAAACAAGAGGAGTGA

10R 4566-4585
CCCTCGACTAAATGCCAAGA

11R 5162-5181
AATCACCGCCCTTATGTTTC

12R 5550-5569
GTTTCAATGCCCTGAAAGAC

13R 6048-6067
TTGCCTTTATACATGGCACC

14R 6582-6601
TGCCGCACTACACTCTTTAT

15R 7180-7199
GTATGCCAAACCAGTCTCAA

16R 7612-7631
GAGGTCATTTGCGACTTCTT

17R 8036-8055
TTTCCAACTTATCGCGTGTG

18R 8542-8561
CGTAAAGTCACGCAACGCAT

19R 9042-9061
GGATCATGGCAGTATGGTGT

20R 9496-9515
AACAGCAGCAACAACAGCAA

21R 10076-10095
TACAAGCCTCAACATCTCCA

22R 10566-10585
AATGCTGAACCGGTATGTGT

23R 109866-11005
AACCAATGCGCAGTACCATA

24R 11226-11245
GCTGACGAAATGGGAGTAGT

25R 11926-11945
GCATTTAACACAGAAAGCCC

26R 12474-12493
TCAGGAATTACAACGCGAAG

27R 12994-13013
CAATCTAACAGTCGCAGCAA

28R 13616-13635
TGATGCCCTTGGTCATCTAA

29R 14184-14203
TGTCTCAGCGGCCAGACAAT

30R 14630-14649
CCAGTTGTAAGTGCAGCGAC

31R 15140-15159
TTCTGATGGTACTGGCGATT

32R 15532-15551
TGACATTAGCAGTTGTCGCC

33R 16010-16029
ATAGCCAAAGACACAAACCG

34R 16596-16615
TGTTGTAGTATTGGCAAGGG

35R 17170-17189
CACACAAAGCATCAACAGCT

36R 17658-17677
CGTCACATTGCCCTTATAGA

37R 18198-18217
ATCGAGTTTAAAGCCCATCC

38R 18742-18761
GAACATCGACAAAGAAAGGG

39R 19238-19257
CAACCTGGCAAATTGAACTC

40R 19838-19857
CAAAGGACGAACTTGTAGCA

41R 20358-20377
ATGACCTTCCTGTTGCTTCT

42R 20812-20831
TAACACGCATATTGGCAGGC

43R 21118-21137
TAATAGCAACAGACCCACCA

44R 21628-21647
ACCGTCAGCCTTAGAAACAT

45R 22092-22111
GGAGTGTGATAAGTGGCAAA

46R 22636-22655
GCCAGACAGAAGAGGTGAAA

47R 23084-23103
AATAATCACCGTCTTCCCAC

48R 23570-23589
TAGAATCTCGCCGTTTAAGC

49R 23994-24013
TCATCCTGGCGTAAATTGGC

50R 24616-24635
AATAGAGGCGGAAATAGCAC

51R 25066-25085
ATTAAGGGAGGTAATGGGCT

52R 25522-25541
GTGAACATGAACCTTATGCG

53R 25946-25965
TGTGGGTTTAGGGATGTACA

54R 26326-26345
GTAAATGATGACCCGAACGT

55R 26870-26889
AATAAAGACGCCGAGAAAGC

56R 27450-27469
GGAAACATTGCCGTTTAAGG

57R 27940-27959
AAGATCAGGGACCATGCAAA

58R 28506-28525
ATGCAAGTTCAATATCCGCC

59R 29004-29023
GAATCATTGTTAGGGTTCCG

60R 29590-29609
TGGGTCAAGTTTAATGGCTC

61R 30034-30053
GGCACTGTTCACTTGCAATC

**Table 2: MERS-CoV Amplicon Primer Sets** 

![Table 2](http://i.imgur.com/CvlCatG.png &amp;quot;Table 2&amp;quot;)

*Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/3273). Originally published online 10 July 2014*.</subfield>
  </datafield>
  <datafield tag="856" ind1="4" ind2=" ">
    <subfield code="s">7859</subfield>
    <subfield code="z">md5:7db915dfb78967b254ef06632cf8ba2d</subfield>
    <subfield code="u">https://zenodo.org/record/13652/files/protocol.md</subfield>
  </datafield>
  <datafield tag="542" ind1=" " ind2=" ">
    <subfield code="l">open</subfield>
  </datafield>
  <datafield tag="980" ind1=" " ind2=" ">
    <subfield code="a">publication</subfield>
    <subfield code="b">article</subfield>
  </datafield>
  <datafield tag="100" ind1=" " ind2=" ">
    <subfield code="u">ScientificProtocols.org</subfield>
    <subfield code="a">sprotocols</subfield>
  </datafield>
  <datafield tag="024" ind1=" " ind2=" ">
    <subfield code="a">10.5281/zenodo.13652</subfield>
    <subfield code="2">doi</subfield>
  </datafield>
  <datafield tag="245" ind1=" " ind2=" ">
    <subfield code="a">MERS-CoV PCR/Sequencing Primers</subfield>
  </datafield>
  <datafield tag="650" ind1="1" ind2="7">
    <subfield code="a">cc-by</subfield>
    <subfield code="2">opendefinition.org</subfield>
  </datafield>
</record>
50
4
views
downloads
All versions This version
Views 5050
Downloads 44
Data volume 31.4 kB31.4 kB
Unique views 4949
Unique downloads 44

Share

Cite as