Journal article Open Access

MERS-CoV PCR/Sequencing Primers

sprotocols

Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ### Materials 1. Invitrogen SuperScript III kit - dNTPS (10 mM) - Random Hexamers - RNasin (if desired) - Thermo Phusion PCR enzyme - Primers (2 mM stock – see Tables 1 and 2) - Agarose - 1X TAE Buffer - Ethidium Bromide ### Equipment 1. 70ºC water bath - 55ºC water bath - Thermal cycler ### Procedure Reverse Transcription: 1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers. - Incubate at 70ºC for 5 min. - Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run): - 4 µL 5X First-Strand Buffer - 2 µL DTT - 1 µL SuperScript III reverse transcriptase - 1 µL dNTPs - 1 µL RNasin (if desired) - x µL H2O to 20 µL - Incubate at 55ºC for 45 min to 1 h. - Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation. - Proceed with PCR setup. PCR (with Phusion PCR kit): 1. Assemble PCR reactions to generate amplicons according to those detailed in Table 2 (for whole-genome sequencing) or with any combination of forward and reverse primers from Table 1. - PCR reaction setup: - 2 µL First-strand template - 1 µL Forward Primer - 1 µL Reverse Primer - 5 µL 10X HF Buffer - 1 µL dNTPs - 0.5 µL Phusion polymerase - x µL H2O to 50 µL - PCR reactions are run under standard PCR conditions: - 98ºC 5 min - 35 cycles of: - 98ºC 15 sec - xºC for 30 sec* - 72ºC for ~45 sec/kb - 72ºC 10 min - 8ºC Hold Annealing temperature is primer-dependent, but for most SARS-CoV primers in Table 1, annealing temperatures 52-55ºC will work. Confirmation of PCR products and sequencing: 1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success. - Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well). - PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions. - Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 2. ### Timing - Reverse transcription: 1-1.5 h - PCR: 2-4 h - Sequencing: facility-dependent ### Anticipated Results Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus. ### Figures **Table 1: MERS-CoV Sequencing Primers** HCoV-EMC Primers 1F 3-22 GGCCGCATTAATACGACTCA 2F 103-122 AAAGCCCTGTTGTTTAGCGT 3F 305-324 CATGTCTTTCGTGGCTGGTG 4F 785-804 TGAGCGAGACAACACCTCTT 5F 1291-1310 ACATTTACCACTCCGCATTC 6F 1787-1806 TGTTGTCCTCGCAATTCTCT 7F 2381-2400 GGTGGTCAATGGCAAAGTTT 8F 2885-2904 CTTTGGCGGTGATCAAGTAC 9F 3377-3396 TGTGCAAGAAGAAGCACAAC 10F 3837-3856 GCTAAAGGGCCGTTACAAGT 11F 4285-4304 CAGTTGACGGTGTGCAATAT 12F 4917-4936 GCAGACAATTTGACTGCTGA 13F 5307-5326 TGGAGAGAGTGGTGCAATGT 14F 5895-5914 GGCGGTGATGCTATTAGTTT 15F 6427-6446 TGCTTAGATTGCACACCGTT 16F 6923-6942 GTTTGAAGATGCCCAAGGTT 17F 7531-7550 GCGGTATTTCATTCTGTCGT 18F 8035-8054 TCACACGCGATAAGTTGGAA 19F 8393-8412 GGATGCACTTAAACGACAGA 20F 8867-8886 TACTACATTGGCTTGGGTGA 21F 9407-9426 TATAGGTTTGTGTGCGTTCC 22F 10073-10092 CAGTGGAGATGTTGAGGCTT 23F 10691-10710 ACTTAATGGTTGCGCTTGGT 24F 11123-11142 GGCCTTCGTTATGTTGTTGG 25F 11551-11570 TTGCTTACTCACCACAGCTT 26F 12121-12140 CCTTTGCTGAGTTGGAAGCT 27F 12667-12686 CTTCTGCCGTTAAGTTGCAA 28F 13219-13238 ATGGTGGAGCTTCAGTGTGT 29F 13885-13904 TGGTTGCTGTGATGTTACCT 30F 14433-14452 AGATCTTTGTTGATGGCGTG 31F 14965-14984 TGGCAAAGCTCGTGTCTATT 32F 15415-15434 TGCTCAGGTGCTAAGCGAAT 33F 15999-16018 TCATGGTAGAGCGGTTTGTG 34F 16305-16324 TTCTCTGCTGTAAATGCTGC 35F 16749-16768 CCAAACCACCACTCAATCGT 36F 17337-17356 CCGATATTCTGGTGGTTGAT 37F 17877-17896 AAACAGCAGATACGGCACAT 38F 18287-18306 ATAGGCTTCGATGTTGAGGG 39F 18887-18906 ATAGAACGTGTGGATTGGGA 40F 19255-19274 TTGTGATGGCGGTAGTTTGT 41F 19839-19858 GCTACAAGTTCGTCCTTTGG 42F 20357-20376 AAGAAGCAACAGGAAGGTCA 43F 20813-20832 CCTGCCAATATGCGTGTTAT 44F 21117-21136 TTGGTGGGTCTGTTGCTATT 45F 21629-21648 TGTTTCTAAGGCTGACGGTA 46F 22001-22020 CGATGGATGTGGCACTTTAC 47F 22327-22346 CCACCTTGCCTGTTTATGAT 48F 22863-22882 GCTGGTCCAATATCCCAGTT 49F 23363-23382 GCAGCGCTTTGTTTATGATG 50F 23995-24014 CCAATTTACGCCAGGATGAT 51F 24615-24634 GGTGCTATTTCCGCCTCTAT 52F 25065-25084 GAGCCCATTACCTCCCTTAA 53F 25521-25540 CCGCATAAGGTTCATGTTCA 54F 25951-25970 ATCCCTAAACCCACAGCTAA 55F 26609-26628 AAGGATTGGCTTCTCGTTCA 56F 27045-27064 CTTGTCGTCGCAGCATTATC 57F 27487-27506 AACGCGCGATTCAGTTCCTC 58F 27941-27960 TTGCATGGTCCCTGATCTTT 59F 28427-28446 GGCAAAGCTACGGAACTAAT 60F 29003-29022 GCGGAACCCTAACAATGATT 61F 29603-29622 TGACCCAAAGAATCCCAACT 62F 29843-29862 AAAGTAACAAGATCGCGGCA 1R 138-157 TTAATGCCACAATCCCACCA 2R 640-659 GCCAACCAGACTGCCATTTG 3R 1062-1080 CTTTACGCTCAACATGCCA 4R 1570-1589 GCCACCAAAGATAAGTGTGA 5R 2108-2127 ACACACCAGAATCCATGTCA 6R 2382-2401 GAAACTTTGCCATTGACCAC 7R 2886-2905 TGTACTTGATCACCGCCAAA 8R 3458-3477 CAGTATCAGGCACAACAGGA 9R 3994-4013 TGCTGAAACAAGAGGAGTGA 10R 4566-4585 CCCTCGACTAAATGCCAAGA 11R 5162-5181 AATCACCGCCCTTATGTTTC 12R 5550-5569 GTTTCAATGCCCTGAAAGAC 13R 6048-6067 TTGCCTTTATACATGGCACC 14R 6582-6601 TGCCGCACTACACTCTTTAT 15R 7180-7199 GTATGCCAAACCAGTCTCAA 16R 7612-7631 GAGGTCATTTGCGACTTCTT 17R 8036-8055 TTTCCAACTTATCGCGTGTG 18R 8542-8561 CGTAAAGTCACGCAACGCAT 19R 9042-9061 GGATCATGGCAGTATGGTGT 20R 9496-9515 AACAGCAGCAACAACAGCAA 21R 10076-10095 TACAAGCCTCAACATCTCCA 22R 10566-10585 AATGCTGAACCGGTATGTGT 23R 109866-11005 AACCAATGCGCAGTACCATA 24R 11226-11245 GCTGACGAAATGGGAGTAGT 25R 11926-11945 GCATTTAACACAGAAAGCCC 26R 12474-12493 TCAGGAATTACAACGCGAAG 27R 12994-13013 CAATCTAACAGTCGCAGCAA 28R 13616-13635 TGATGCCCTTGGTCATCTAA 29R 14184-14203 TGTCTCAGCGGCCAGACAAT 30R 14630-14649 CCAGTTGTAAGTGCAGCGAC 31R 15140-15159 TTCTGATGGTACTGGCGATT 32R 15532-15551 TGACATTAGCAGTTGTCGCC 33R 16010-16029 ATAGCCAAAGACACAAACCG 34R 16596-16615 TGTTGTAGTATTGGCAAGGG 35R 17170-17189 CACACAAAGCATCAACAGCT 36R 17658-17677 CGTCACATTGCCCTTATAGA 37R 18198-18217 ATCGAGTTTAAAGCCCATCC 38R 18742-18761 GAACATCGACAAAGAAAGGG 39R 19238-19257 CAACCTGGCAAATTGAACTC 40R 19838-19857 CAAAGGACGAACTTGTAGCA 41R 20358-20377 ATGACCTTCCTGTTGCTTCT 42R 20812-20831 TAACACGCATATTGGCAGGC 43R 21118-21137 TAATAGCAACAGACCCACCA 44R 21628-21647 ACCGTCAGCCTTAGAAACAT 45R 22092-22111 GGAGTGTGATAAGTGGCAAA 46R 22636-22655 GCCAGACAGAAGAGGTGAAA 47R 23084-23103 AATAATCACCGTCTTCCCAC 48R 23570-23589 TAGAATCTCGCCGTTTAAGC 49R 23994-24013 TCATCCTGGCGTAAATTGGC 50R 24616-24635 AATAGAGGCGGAAATAGCAC 51R 25066-25085 ATTAAGGGAGGTAATGGGCT 52R 25522-25541 GTGAACATGAACCTTATGCG 53R 25946-25965 TGTGGGTTTAGGGATGTACA 54R 26326-26345 GTAAATGATGACCCGAACGT 55R 26870-26889 AATAAAGACGCCGAGAAAGC 56R 27450-27469 GGAAACATTGCCGTTTAAGG 57R 27940-27959 AAGATCAGGGACCATGCAAA 58R 28506-28525 ATGCAAGTTCAATATCCGCC 59R 29004-29023 GAATCATTGTTAGGGTTCCG 60R 29590-29609 TGGGTCAAGTTTAATGGCTC 61R 30034-30053 GGCACTGTTCACTTGCAATC **Table 2: MERS-CoV Amplicon Primer Sets** ![Table 2](http://i.imgur.com/CvlCatG.png "Table 2") *Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/3273). Originally published online 10 July 2014*.

Files (7.9 kB)
Name Size
protocol.md
md5:7db915dfb78967b254ef06632cf8ba2d
7.9 kB Download
50
4
views
downloads
All versions This version
Views 5050
Downloads 44
Data volume 31.4 kB31.4 kB
Unique views 4949
Unique downloads 44

Share

Cite as