Journal article Open Access

Bt-CoV HKU5 PCR/Sequencing Primers

sprotocols

Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ### Materials 1. Invitrogen SuperScript III kit - dNTPS (10 mM) - Random Hexamers - RNasin (if desired) - Thermo Phusion PCR enzyme - Primers (2 mM stock – see Tables 1 and 2) - Agarose - 1X TAE Buffer - Ethidium Bromide ### Equipment 1. 70ºC water bath - 55ºC water bath - Thermal cycler ### Procedure Reverse Transcription: 1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers. - Incubate at 70ºC for 5 min. - Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run): - 4 µL 5X First-Strand Buffer - 2 µL DTT - 1 µL SuperScript III reverse transcriptase - 1 µL dNTPs - 1 µL RNasin (if desired) - x µL H2O to 20 µL - Incubate at 55ºC for 45 min to 1 h. - Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation. - Proceed with PCR setup. PCR (with Phusion PCR kit): 1. Assemble PCR reactions to generate amplicons according to those detailed in Table 3 (for whole-genome sequencing) or with any combination of forward and reverse primers from Tables 1 and 2. - PCR reaction setup: - 2 µL First-strand template - 1 µL Forward Primer - 1 µL Reverse Primer - 5 µL 10X HF Buffer - 1 µL dNTPs - 0.5 µL Phusion polymerase - x µL H2O to 50 µL - PCR reactions are run under standard PCR conditions: - 98ºC 5 min - 35 cycles of: - 98ºC 15 sec - xºC for 30 sec* - 72ºC for ~45 sec/kb - 72ºC 10 min - 8ºC Hold Annealing temperature is primer-dependent, but for most SARS-CoV primers in Tables 1 and 2, annealing temperatures 52-55ºC will work. Confirmation of PCR products and sequencing: 1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success. - Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well). - PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions. - Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 3.. ### Timing - Reverse transcription: 1-1.5 h - PCR: 2-4 h - Sequencing: facility-dependent ### Anticipated Results Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus. ### Figures **Table 1: Bt-CoV HKU5 Sequencing Primers** HKU5.5 Primers HKU55 1F 25_F CCCTCTCTCTCGTTCTCTTG HKU55 2F 587_F TACCAAAATGCAGCAGGAGA HKU55 3F 1015_F GATTGTGTGGAATGTGCAAC HKU55 4F 1576_F GCACTTTATTCCTCGTGCAA HKU55 5F 2060_F ATCCCGTGTGATGTTACTGA HKU55 6F 2530_F TGATCTCGTAATTCCTGGTG HKU55 7F 2978_F GTGGATGTTGTGAAGGATGA HKU55 8F 3598_F AATAAGTGACGATGTTCCCG HKU55 9F 4010_F GTCAACTTTTATGGGCCACT HKU55 10F 4497_F CTAAAGACTCATTGGCGGAC HKU55 11F 4957_F CGATGGGGTTAATTTCAGGA HKU55 12F 5460_F AGCTTACCACTCAAGCCAAA HKU55 13F 5924_F GGGAATACTTGGGCTGATGT HKU55 14F 6413_F CCAAAGGAGGATGTTAAACC HKU55 15F 7046_F TCCACTTTACGCCTGCTTTT HKU55 16F 7551_F TTACACACATCCCCTTGTTG HKU55 17F 8087_F GATCGTGGCCAGGAAAATTT HKU55 18F 8529_F ACCTTAACGCTGCTTCTGTT HKU55 19F 9039_F TTACCGTGGCTGTTATTGCT HKU55 20F 9482_F AATGGCTCTTGGGCTATCTA HKU55 21F 10003_F TTGTAGTTTCCAGGATGCAG HKU55 22F 10545_F TGGCTGTGGAATCTGCTAAC HKU55 23F 10943_F CCAAATAAGACTGGAATCGC HKU55 24F 11389_F TACGCTGTTTCTTTTGCCCA HKU55 25F 11945_F TTTCGCTATCTCACGGGTAA HKU55 26F 12544_F CGAGGATAAGAAGGCCAAGA HKU55 27F 13010_F GTTGAGGGTCGTAAAATGCT HKU55 28F 13543_F ACATGTTCGTGATCCTGTTG HKU55 29F 14050_F GCTTTGAGGCACTTTGATCA HKU55 30F 14536_F CAGCAGTATCACCCAAATTG HKU55 31F 14959_F TCCTCAGTCACATTAAGGCA HKU55 32F 15338_F GTGTTTCGATCCTTAGCACA HKU55 33F 15866_F GCCAACCTGACCCTAAATTT HKU55 34F 16461_F TGTCGGATCTTGTGTCGTGT HKU55 35F 16936_F GAGCGTGAATTGTTGCTTGT HKU55 36F 17450_F CACGCATTATACCTGCGAAA HKU55 37F 17914_F TCTGCCATTAACAGACCTCA HKU55 38F 18446_F CGATACCCAACTACCCAAAA HKU55 39F 18906_F TTCGCCGTTACACTCTTATG HKU55 40F 19466_F TCAATTTGCCTGGTTGCGAT HKU55 41F 20070_F GTTTGTGCTCTGGGATTACG HKU55 42F 20530_F GAGCATGTGGTTTATGGTGA HKU55 43F 20946_F CATGCTGCCTAATTACAAGC HKU55 44F 21434_F CATGGTGGACTGTGTTTTGC HKU55 45F 22095_F TTGTTCGTATTGGAGCAGCT HKU55 46F 22501_F TGCTGAGTGGTTTGGCATTA HKU55 47F 23132_F GCTGGAGAAATTGTGCAGTT HKU55 48F 23557_F TCATGGCATAACAGGAAGAG HKU55 49F 24026_F CCTTTAACACTCGCACCAAT HKU55 50F 24533_F CCACCCTTATATGACCCCTA HKU55 51F 24943_F TGGCCGTCTTACATCTCTTA HKU55 52F 25536_F AGTTGATGGTGCTGAGTGAA HKU55 53F 25968_F GCTGGCATGTACACTAATCG HKU55 54F 26510_F CTAAGCGCCGTTTTACTCCT HKU55 55F 27000_F ACATTCTCACACCACCGAAT HKU55 56F 27566_F TTGCAGGCGGGGTTGTTATA HKU55 57F 28012_F CGGCTATTCGATTATGTGTG HKU55 58F 28470_F TTCGGCTGTTTATGCGCACT HKU55 59F 28928_F CAATGAAACCCCTACCAACA HKU55 60F 29436_F AGAAACGGAAGAAGCAACAG HKU55 61F 29990_F AAGTGGTGATGATGCTGCTA HKU55 62F 30150_F CCCGATTCAGAGGCATAAAT HKU55 1R 420_R CTTTCGCCGTCCATAAACCA HKU55 2R 1024_R CCACACAATCCGGTACAATT HKU55 3R 1593_R GCACGAGGAATAAAGTGCAT HKU55 4R 2079_R TCAGTAACATCACACGGGAT HKU55 5R 2549_R CACCAGGAATTACGAGATCA HKU55 6R 2996_R CATCCTTCACAACATCCACA HKU55 7R 3475_R CTTGGCAACTTCAGCATCAT HKU55 8R 4028_R GTGGCCCATAAAAGTTGACA HKU55 9R 4594_R TGCTAAGTCAAGCCCATGAG HKU55 10R 4975_R CCTGAAATTAACCCCATCGA HKU55 11R 5479_R TTTGGCTTGAGTGGTAAGCT HKU55 12R 5942_R CATCAGCCCAAGTATTCCCA HKU55 13R 6432_R GGTTTAACATCCTCCTTTGG HKU55 14R 6935_R CAACTTTAACGGTGCTTTGG HKU55 15R 7570_R CAACAAGGGGATGTGTGTAA HKU55 16R 8109_R GCTAAATTTTCCTGGCCACG HKU55 17R 8548_R AACAGAAGCAGCGTTAAGGT HKU55 18R 9058_R AGCAATAACAGCCACGGTAA HKU55 19R 9543_R TCACCACAATAGACACCAGG HKU55 20R 10022_R CTGCATCCTGGAAACTACAA HKU55 21R 10564_R GTTAGCAGATTCCACAGCCA HKU55 22R 10962_R GCGATTCCAGTCTTATTTGG HKU55 23R 11408_R TGGGCAAAAGAAACAGCGTA HKU55 24R 11964_R TTACCCGTGAGATAGCGAAA HKU55 25R 12563_R TCTTGGCCTTCTTATCCTCG HKU55 26R 13028_R GCATTTTACGACCCTCAACA HKU55 27R 13501_R TGTGACATCTGGGTGCTCTA HKU55 28R 14070_R CTGATCAAAGTGCCTCAAAG HKU55 29R 14552_R TTTGGGTGATACTGCTGATC HKU55 30R 15050_R ATCGTTGGCAGGTTGTAAGC HKU55 31R 15539_R ATAGCGCGATCACACTTAGG HKU55 32R 15890_R TCCACAAATTTAGGGTCAGG HKU55 33R 16473_R ACAAGATCCGACAGCCTGAA HKU55 34R 16990_R GATTAAGTGGTGGTTTGGCT HKU55 35R 17557_R ACGTTTCTGGCAGTGCATTA HKU55 36R 17926_R TGTTAATGGCAGAGCTAGCA HKU55 37R 18502_R TGACTTGCCTTATAGCCTCA HKU55 38R 18930_R GCAGGCATAAGAGTGTAACG HKU55 39R 19485_R ATCGCAACCAGGCAAATTGA HKU55 40R 20090_R TCGTAATCCCAGAGCACAAA HKU55 41R 20548_R CACCATAAACCACATGCTCA HKU55 42R 20965_R GCTTGTAATTAGGCAGCATG HKU55 43R 21450_R AAACACAGTCCACCATGCAA HKU55 44R 21837_R TGAGACCGTAGACATGAACC HKU55 45R 22468_R GAACGTGCAATTGATCAGGT HKU55 46R 22896_R TCTTGAGTTGTTGCCTGTTC HKU55 47R 23496_R TGCATGGGACAGACACTATT HKU55 48R 24044_R TTGGTGCGAGTGTTAAAGGA HKU55 49R 24445_R CATATAGCCAGGATCAGCAA HKU55 50R 24958_R AGATGTAAGACGGCCATTGA HKU55 51R 25455_R AATTCCTCCAGCTCATCCTT HKU55 52R 25978_R TACATGCCAGCCGTATCAAA HKU55 53R 26433_R GCTCGAAGGCTGTGCTATAA HKU55 54R 27016_R CGGTGGTGTGAGAATGTTTA HKU55 55R 27585_R TATAACAACCCCGCCTGCAA HKU55 56R 28047_R AACCAGAAACACACTGCACA HKU55 57R 28489_R AGTGCGCATAAACAGCCGAA HKU55 58R 28982_R TCTGGGCTTAGTTCTTGGAC HKU55 59R 29455_R CTGTTGCTTCTTCCGTTTCT HKU55 60R 29913_R TGTAGTTGGGATTCTTTGGG HKU55 61R 30391_R GCACTGTTCACTTGCAATCT **Table 2: SARS-CoV Sequencing Primers** ![Table 2](http://i.imgur.com/Xg8llGp.png "Table 2") **Table 3: Bt-CoV HKU5 Amplicon Primer Sets** ![Table 3](http://i.imgur.com/1K7nYT4.png "Table 3") ### Associated Publications **A Mouse Model for Betacoronavirus Subgroup 2c Using a Bat Coronavirus Strain HKU5 Variant** S. Agnihothram, B. L. Yount, E. F. Donaldson, J. Huynh, V. D. Menachery, L. E. Gralinski, R. L. Graham, M. M. Becker, S. Tomar, T. D. Scobey, H. L. Osswald, A. Whitmore, R. Gopal, A. K. Ghosh, A. Mesecar, M. Zambon, M. Heise, M. R. Denison, and R. S. Baric, *mBio* 5 (2) e00047-14 - e00047-14 25/03/2014 *Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/3275#/figures). Originally published online 10 July 2014*.
Files (9.0 kB)
Name Size
protocol.md
md5:48e87bcc77eeafd797a5147da85fb8f7
9.0 kB Download
38
2
views
downloads
All versions This version
Views 3838
Downloads 22
Data volume 17.9 kB17.9 kB
Unique views 3838
Unique downloads 22

Share

Cite as