Journal article Open Access

Bt-CoV HKU3 PCR/Sequencing Primers

sprotocols

Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ### Materials 1. Invitrogen SuperScript III kit - dNTPS (10 mM) - Random Hexamers - RNasin (if desired) - Thermo Phusion PCR enzyme - Primers (2 mM stock – see Tables 1 and 2) - Agarose - 1X TAE Buffer - Ethidium Bromide ### Equipment 1. 70ºC water bath - 55ºC water bath - Thermal cycler ### Procedure **Reverse Transcription:** 1. In a 1.5-µL Eppendorf tube, add 1-4 µL RNA and 1 µL Random Hexamers. - Incubate at 70ºC for 5 min. - Place reaction briefly on ice and assemble the reverse transcription reaction using the kit-supplied reagents (a master mix can be made if multiple reactions are being run): - 4 µL 5X First-Strand Buffer - 2 µL DTT - 1 µL SuperScript III reverse transcriptase - 1 µL dNTPs - 1 µL RNasin (if desired) - x µL H2O to 20 µL - Incubate at 55ºC for 45 min to 1 h. - Inactivate the reverse transcriptase at 70ºC for 15 min. Place reaction on ice after inactivation. 5. Proceed with PCR setup. **PCR (with Phusion PCR kit)**: 1. Assemble PCR reactions to generate amplicons according to those detailed in Table 3 (for whole-genome sequencing) or with any combination of forward and reverse primers from Tables 1 and 2. - PCR reaction setup: - 2 µL First-strand template - 1 µL Forward Primer - 1 µL Reverse Primer - 5 µL 10X HF Buffer - 1 µL dNTPs - 0.5 µL Phusion polymerase - x µL H2O to 50 µL - PCR reactions are run under standard PCR conditions: - 98ºC 5 min - 35 cycles of: - 98ºC 15 sec - xºC for 30 sec* - 72ºC for ~45 sec/kb - 72ºC 10 min - 8ºC Hold Annealing temperature is primer-dependent, but for most SARS-CoV primers in Tables 1 and 2, annealing temperatures 52-55ºC will work. **Confirmation of PCR products and sequencing**: 1. Run PCR products (5 µL/reaction) on a 0.8% agarose/1X TAE gel to verify PCR success. - Purify PCR products with PCR purification kit of choice (the Qiagen PCR Purification Kit works well). - PCR products can be diluted to 150-200 µL/reaction to ensure that enough product is present for assembling sequencing reactions. - Assemble sequencing reactions according to the primer/amplicon combinations outlined in Table 3. ### Timing - Reverse transcription: 1-1.5 h - PCR: 2-4 h - Sequencing: facility-dependent ### Anticipated Results Primers have been designed to give clean, single-band PCR products. If multiple bands are detected, alternate annealing temperatures may be required. It may also be possible that alternate bands indicate multiple genome patterns at that locus. **Table 1: Bt-CoV HKU3 Sequencing Primers**. Bt-CoV HKU3 Sequencing Primers 1 BSStartF CCTACCCAGGAAAAGCCAAC 2 BS76F TAAAATCTGTGTGGCTGTCG 3 BS379F TTATCGGAGGCACGTGAACA 4 BS654F AGCCGGTGGTCATAGTTTTG 5 BS950F ACTGCTGCCGTGAACATGAA 6 BS1484F GCGGCTGTGTATTTTCCTAT 7 BS1904F TTTTCTCTCGCACACTGGAT 8 BS2464F AAGGCACCAAAAGAAGTCAC 9 BS3030F TTGCTCTTTCTACCCTCCTG 10 BS3475F ACAGTTGGAGGCTCATGTTT 11 BS4083F TAAGAAGTCGGGTGGGACTA 12 BS4429F GGTGTCCGGTTCTTCTTCTA 13 BS4909F AACCTCCACACGCATATTGT 14 BS5464F AAGGGTGTAGAGGCTGTGAT 15 BS6041F TAACCGTCACATTCTTCCCA 16 BS6557F CCGCTGCAATAAATAGTGTC 17 BS7023F TCAGGGTTATTTTCCCTGCA 18 BS7455F TGTCAATGGCGTGAAGAGAT 19 BS8058F TGGTGTCCTTTCTACATTCG 20 BS8509F CTTTTGTGTGTTCTTGCTGC 21 BS8916F CGTTTTGGCTGCTGAATGTA 22 BS9401F ACCATGTTGTTGCCGCTAAT 23 BS10049F ATGGTTTGTGGTTGGATGAC 24 BS10432F TGCGTGTCTTTCTGCTACAT 25 BS10842F GCCCTTTGACGTTGTTAGAC 26 BS11282F ATGATGCTGCTAGACGTGTG 27 BS11709F GTTGGGCATTGGAGGTAAAC 28 BS12142F TCTGAGTTTGACCATGATGC 29 BS12500F TTGTCCAGCTCAGTGAAATC 30 BS12975F GCTTTCTTTCTGTGCTTTCG 31 BS13469F CGAGAAAGTTGCTGGTTTTG 32 BS13924F AATTCTGCGATGCTATGCGT 33 BS14442F TCACGCCTCAGTTTTAAGGA 34 BS14948F GCGTAATGTCATCCCTACAA 35 BS15500F TGATAAGTACGTCCGCAATC 36 BS15941F AATTGACGCCTACCCACTTA 37 BS16475F AGCGACATGTGATTGGACTA 38 BS17016F CACTTTGCTATTGGACTTGC 39 BS17354F AGCTCAATTACCTGCACCAC 40 BS17897F CAAGCTGCAATTTACGAGTC 41 BS18453F CAAATGCTCAGTGATACGCT 42 BS18991F ACTGGAAATTCTACGACGCT 43 BS19461F GCTGGATTTAGCCTTTGGAT 44 BS19887F CTCATTGTCTTGTTTGACGG 45 BS20558F CCCAAAATTACAGGCAAGTC 46 BS20900F ATTGATTGGAGACTGTGCCA 47 BS21261F TGGAGGAACACAAACCCTAT 48 BS21550F CGCAACCTAAAATGGCACAA 49 BS21931F ATGCCTGGGTTTATCAGAGT 50 BS22485F TTCCCTTCTGTCTATGCATG 51 BS22889F CCCACCTGCTCTTAATTGTT 52 BS23404F AGCATGTCAACGCCTCTTAT 53 BS23816F GGACTTTGGCGGTTTCAATT 54 BS24103F GTGCAGCTCTTCAAATACCA 55 BS24664F CTCCAGCTATTTGTCACGAA 56 BS25073F GTATGTTTGGCTCGGCTTTA 57 BS25402F TTGTTGGCGTTGCACTTCTT 58 BS25992F CAAATACACACAATCGACGG 59 BS26434F ACTCCTGGAACAATGGAATC 60 BS26925F ACAAATTAGGAGCGTCGCAG 61 BS27500F GTGCAAGATCAGTTTCACCA 62 BS27920F TGGATCTAGAAAATCGGCTC 63 BS28445F GACGGCAAAATGAAAGAGCT 64 BS28861F TAAAGGCCAACAACAACCAG 65 BS29235F AAACATTCCCACCAACAGAG 66 BS29601F AAGAGCCACCACATTTTCAC 1 BS474R GAACACATAGGGCTGTTCAA 2 BS969R TTCATGTTCACGGCAGCAGT 3 BS1497R AAATACACAGCCGCCAAAAC 4 BS1923R ATCCAGTGTGCGAGAGAAAA 5 BS2438R TCTTTGCCACGAATACACTG 6 BS2820R CTTATCCACTCGCACATCAA 7 BS3471R AGGTCCATTTTGCCTGATGT 8 BS3636R AGCTGACAATAGAGGTGCAA 9 BS4113R TAGCATTTCCGTAGTCCCAC 10 BS4394R TTATACTTGCGCTGGATGGT 11 BS4927R CAATATGCGTGTGGAGGTTA 12 BS5480R ACAGCCTCTACACCCTTCAA 13 BS6060R TGGGAAGAATGTGACGGTTA 14 BS6577R GGACACTATTTATTGCAGCG 15 BS7040R CAGGGAAAATAACCCTGACA 16 BS7474R ATCTCTTCACGCCATTGACA 17 BS8077R CGAATGTAGAAAGGACACCA 18 BS8528R GCAGCAAGAACACACAAAAG 19 BS8935R TACATTCAGCAGCCAAAACG 20 BS9420R ATTAGCGGCAACAACATGGT 21 BS9975R AAAACCACTCTGCAAAACCG 22 BS10451R ATGTAGCAGAAAGACACGCA 23 BS10861R GTCTAACAACGTCAAAGGGC 24 BS11227R TAACACAGTCCTTAAGCCGA 25 BS11728R GTTTACCTCCAATGCCCAAC 26 BS12222R CTGCTTGTACATTTGGGTCA 27 BS12519R GATTTCACTGAGCTGGACAA 28 BS12994R CGAAAGCACAGAAAGAAAGC 29 BS13485R AACCAGCAACTTTCTCGTTG 30 BS13943R ACGCATAGCATCGCAGAATT 31 BS14461R TCCTTAAAACTGAGGCGTGA 32 BS14967R TTGTAGGGATGACATTACGC 33 BS15519R GATTGCGGACGTACTTATCA 34 BS15960R TAAGTGGGTAGGCGTCAATT 35 BS16494R TAGTCCAATCACATGTCGCT 36 BS17035R GCAAGTCCAATAGCAAAGTG 37 BS17180R ATCAAAACACTCTACACGCG 38 BS17630R ACCTATTTGTGGCCTGTTGA 39 BS17916R GACTCGTAAATTGCAGCTTG 40 BS18476R TTTCAGCGTATCACTGAGCA 41 BS18892R TGCTGTACTTTTCTGCATGC 42 BS19479R TCCAAAGGCTAAATCCAGCA 43 BS19906R CCGTCAAACAAGACAATGAG 44 BS20577R GACTTGCCTGTAATTTTGGG 45 BS20919R TGGCACAGTCTCCAATCAAT 46 BS21280R ATAGGGTTTGTGTTCCTCCA 47 BS21665R TGAGTCAAATGGCAGGAAGT 48 BS21950R ACTCTGATAAACCCAGGCAT 49 BS22417R TGAGTGGGTGAAACTCTGAA 50 BS22908R AACAATTAAGAGCAGGTGGG 51 BS23232R CACTAACACCACCAAAGGAA 52 BS23627R AGCCATTGAAACAGGCATCA 53 BS23835R AATTGAAACCGCCAAAGTCC 54 BS24122R TGGTATTTGAAGAGCTGCAC 55 BS24579R TAAGGTGGTAGCCTTTTCCA 56 BS25092R TAAAGCCGAGCCAAACATAC 57 BS25421R AAGAAGTGCAACGCCAACAA 58 BS25949R TGTAGCATTTTCAGCACCAG 59 BS26454R AGATTCCATTGTTCCAGGAG 60 BS26699R CAAACAGCCTGAAAGAAGCA 61 BS27301R GCGCTATCAATGTCAAGAAG 62 BS27939R GAGCCGATTTTCTAGATCCA 63 BS28465R GAGCTCTTTCATTTTGCCGT 64 BS28880R CTGGTTGTTGTTGGCCTTTA 65 BS29254R CTCTGTTGGTGGGAATGTTT 66 BS29620R GTGAAAATGTGGTGGCTCTT 67 BS29657R ATTCACTGTACCCTCGATCG **Table 2: Bt-CoV HKU3 Amplicon Primer Sets**. ![Table 2](http://i.imgur.com/UvvQtFz.png "Table 2") *Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/3277). Originally published online 10 July 2014*.
Files (8.0 kB)
Name Size
protocol.md
md5:87f99b4f5d2bbe34026733172d1063a9
8.0 kB Download
32
4
views
downloads
All versions This version
Views 3232
Downloads 44
Data volume 31.9 kB31.9 kB
Unique views 3232
Unique downloads 44

Share

Cite as