=======
Atropos
=======

Atropos version: 1.1.14+0.gb71f62e.dirty
Python version: 3.5.3
Command line parameters: trim -se Hm2_GTGAAA_L005/bwa_bam_to_fastq/Hm2_GTGAAA_L005_R1_.unmapped.fastq.gz -T 4 --process-timeout 600 --report-formats json txt --report-file Hm2_GTGAAA_L005/logs/cutadapt/cutadapt -b file:/home/cokelaer/Work/github/sequana/sequana/resources/data/adapters/adapters_Nextera_fwd.fa -m 20 -q 30 -O 6 --trim-n -o Hm2_GTGAAA_L005/cutadapt/Hm2_GTGAAA_L005_R1_.cutadapt.fastq.gz

Sample ID: Hm2_GTGAAA_L005_R1_.unmapped
Input format: FASTQ, Read 1, w/ Qualities
Input files:
  /home/cokelaer/Temp/test/analysis3/Hm2_GTGAAA_L005/bwa_bam_to_fastq/Hm2_GTGAAA_L005_R1_.unmapped.fastq.gz

Start time: 2017-09-24T16:26:42.217355
Wallclock time: 0.33 s (3 us/read; 18.16 M reads/minute)
CPU time (main process): 0.33 s

--------
Trimming
--------

Reads                                  records   fraction
----------------------------------- ---------- ----------
Total reads processed:                  99,869
Reads with adapter:                      8,770       8.8%
Reads that were too short:                 923       0.9%
Reads written (passing filters):        98,946      99.1%

Base pairs                                  bp   fraction
----------------------------------- ---------- ----------
Total bp processed:                 10,086,769
End Ns trimmed                              16       0.0%
Quality-trimmed                        740,226       7.3%
Total bp written (filtered):         9,060,273      89.8%

----------------------------------------
Adapter Universal_Adapter|name:universal
----------------------------------------

Sequence                                                   Type           Length Trimmed (x)
---------------------------------------------------------- -------------- ------ -----------
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT variable 5'/3'     58          68

18 times, it overlapped the 5' end of a read
50 times, it overlapped the 3' end or was within the read

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5

Overview of removed sequences (5'):
length count expect max.err error counts
                            0 1
------ ----- ------ ------- ------------
     6     7  146.3       0 7
     7     3   36.6       0 3
    10     1    4.6       1 0 1
    11     1    2.3       1 0 1
    12     1    1.1       1 1
    13     1    0.3       1 1
    17     1    0.0       1 1
    18     1    0.0       1 1
    19     2    0.0       1 2


Overview of removed sequences (3' or within):
length count expect max.err error counts
                            0  1
------ ----- ------ ------- ------------
     6    40  146.3       0 40
     7     4   36.6       0 4
     8     1   18.3       0 1
    10     5    4.6       1 0  5

--------------------------------------------------------
Adapter Nextera_transposase_seq_1|name:transposase_seq_1
--------------------------------------------------------

Sequence                          Type           Length Trimmed (x)
--------------------------------- -------------- ------ -----------
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG variable 5'/3'     33          37

29 times, it overlapped the 5' end of a read
8 times, it overlapped the 3' end or was within the read

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Overview of removed sequences (5'):
length count  expect max.err error counts
                             0  1
------ ----- ------- ------- ------------
     6    17 1,170.3       0 17
     7    11   585.2       0 11
    10     1    36.6       1 0  1


Overview of removed sequences (3' or within):
length count  expect max.err error counts
                             0 1
------ ----- ------- ------- ------------
     6     5 1,170.3       0 5
     7     2   585.2       0 2
    10     1    36.6       1 0 1

--------------------------------------------------------
Adapter Nextera_transposase_seq_2|name:transposase_seq_2
--------------------------------------------------------

Sequence                           Type           Length Trimmed (x)
---------------------------------- -------------- ------ -----------
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG variable 5'/3'     34          18

0 times, it overlapped the 5' end of a read
18 times, it overlapped the 3' end or was within the read

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3

Overview of removed sequences (5'):
    length      count     expect    max.err error c...

---------- ---------- ---------- ---------- ----------


Overview of removed sequences (3' or within):
length count  expect max.err error counts
                             0
------ ----- ------- ------- ------------
     6    13 1,170.3       0 13
     7     5   292.6       0 5

-------------------------------------------------
Adapter Nextera_index_N501|name:N501|seq:TAGATCGC
-------------------------------------------------

Sequence                                            Type           Length Trimmed (x)
--------------------------------------------------- -------------- ------ -----------
AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTC variable 5'/3'     51          36

36 times, it overlapped the 5' end of a read
0 times, it overlapped the 3' end or was within the read

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-51 bp: 5

Overview of removed sequences (5'):
length count expect max.err error counts
                            0  1
------ ----- ------ ------- ------------
     6    26  146.3       0 26
     7     8   36.6       0 8
    11     2    2.3       1 0  2


Overview of removed sequences (3' or within):
    length      count     expect    max.err error c...

---------- ---------- ---------- ---------- ----------

-------------------------------------------------
Adapter Nextera_index_N502|name:N502|seq:CTCTCTAT
-------------------------------------------------

Sequence                                            Type           Length Trimmed (x)
--------------------------------------------------- -------------- ------ -----------
AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTC variable 5'/3'     51           0
