A 14-year-old girl was referred for evaluation of primary amenorrhoea and absent pubertal development. She is the oldest of four children born to consanguineous parents (first cousins) of Palestinian background. There were no perinatal issues and there was no past medical history of significance. A maternal sibling had transitioned from female to male as a teen; no further medical information regarding this family member was available. On examination, our patient presented as a phenotypic female. She measured 154.5 cm in height (10 – 25th centile), weighed 51 kg (50th centile) and was normotensive. There were no dysmorphic features. Cardiovascular, respiratory and abdominal examinations were unremarkable. She had Tanner Stage 1 breast development; pubic hair was Tanner Stage 2. Genital examination demonstrated well-formed labia, a normal vaginal opening and no palpable gonads. There was a prominent clitoro-phallic structure. Evaluation demonstrated low oestradiol with elevated gonadotrophins (oestradiol 84 pmol/L, follicle stimulating hormone 76 IU/L, luteinizing hormone 37 IU/L); this was confirmed on repeat testing one month later. Testosterone was 0.6 nmol/L. Urea and electrolytes, calcium and fasting glucose were normal. Karyotype revealed 46, XY. On pelvic ultrasound there were no Müllerian structures or gonads identified and there were no concerning mass lesions. On human chorionic gonadotrophin (HCG) stimulation test, baseline testosterone was 1.0 nmol/L and dihydrotestosterone (DHT) 0.2 nmol/L; post HCG testosterone was 0.9 nmol/L and DHT 0.2 nmol/L. Baseline cortisol was 200 nmol/L with cortisol 670 and then 730 nmol/L, 30 and 60 min post 250 mcg of Synacthen. The diagnosis of a male genotype was difficult for the family. This was further complicated by the diagnosis not initially being disclosed to our patient by her parents. The patient’s mother was concerned about gender identity and assignment especially in view of her sibling’s history. Ultimately our patient was informed of the karyotype result following multidisciplinary review and parental counselling. Examination under anaesthesia, laparoscopy, cystovaginoscopy and gonadal biopsies were performed. A blind ending vagina, approximately 6 cm in length from the introitus, was noted. There was no cervix, uterus, fallopian tubes or vasa. There were bilateral abnormal small gonads with a blind ending epididymal structure flanking each. Histopathology from the gonadal biopsies demonstrated bilateral dysgenetic testes with left para-gonadal biopsy showing Müllerian tissue resembling oviduct and the right para-gonadal biopsy showing vaso-epididymal tissue; there were no foci of gonadoblastoma or intratubular germ cell neoplasia. Our patient proceeded to gonadectomy five months later. Histopathology confirmed bilateral dysgenetic testes with no evidence of gonadoblastoma or germ cell neoplasia. When reviewing investigation findings, our patient expressed confusion regarding her gender identity stating she always felt that she was a boy. She was referred for psychiatric evaluation. At the time of psychiatric review (four months later), it was noted that our patient had not demonstrated pervasive gender discontent although she periodically expressed thoughts of the cultural advantages of being male. Our patient acknowledged feeling overwhelmed and confused when informed of investigation results. The reviewing psychiatrist concluded that our patient identified as female. Approximately fourteen months following presentation, the patient expressed her wish to proceed with oestrogen replacement therapy. Our patient had DNA collected under a research protocol examining the molecular genetics of sex determination and gonad development using a MPS targeted DSD gene panel as described by Eggers et al. []; consent was obtained from the patient and her mother for this gene analysis. Of the 64 diagnostic and 927 research candidate DSD genes covered in this panel, our patient had a single, rare, non-synonymous variant. This was a novel, homozygous, missense mutation in exon 2 of DHH (DHH:NM_021044:exon2:c.G491C:p.R164P). This was confirmed on Sanger sequencing using the primers gccggaataacaaagaatcaac and ggcaacagtactactgcagactc. Our patient’s mother was a heterozygote carrier; other family members have not been tested. This mutation was predicted to be probably damaging by PolyPhen (score 1.0) [], deleterious by SIFT (score 0.0) [], and damaging by FATHMM (score − 6.31) []. Furthermore, this variant is not present in the ExAC [], 1000 Genomes Project [], and NHLBI GO Exome Sequencing Project databases [], supporting the putative damaging effect of the mutation. We generated a three dimensional protein model of DHH using SWISS-MODEL (template ID 3n1g.1.A) [] and we used HOPE [] to analyse the structural and functional effects of the mutation. HOPE revealed that the mutated residue is located on a highly conserved position and overlapped three function domains: Hedgehog Protein (InterPro IPR001657), Hedgehog, N-Terminal Signalling Domain (InterPro IPR000320), and Hedgehog Signalling/Dd-Peptidase Zinc-Binding Domain (InterPro IPR009045). The difference in charge and amino acid size between the wild-type and mutant amino acid likely results in loss of interactions with other molecules. After her psychiatric evaluation, our patient commenced transdermal estrogen in gradually increasing doses. On follow-up out to twelve months post estrogen initiation, breasts had increased in size and were Tanner stage 3. She was pleased with progress of pubertal induction and accepted further escalation in estrogen dose. She no longer expressed gender confusion. Following the finding of a homozygous DHH mutation our patient was specifically evaluated considering the possibility of a peripheral neuropathy. There was no history suggestive of neurological impairment and clinical neurological examination (cranial nerves, gait, co-ordination, tone, power, deep tendon reflexes, touch, vibration and joint position sensation) was normal. Limited nerve conduction studies including left median nerve motor, sensory and F wave response as well as right upper limb somatosensory evoked potential study with stimulation of the median nerve at the wrist were all normal. Our patient’s family was offered referral for genetic counselling but this has been declined to this point.