A 78-years old male was admitted to the Hematology of the University Hospital Sant’Andrea-Sapienza, because of worsening fatigue and abdominal pain. Written informed consent was obtained from the patient and the study was approved by our institutional review board. The peripheral blood count showed hyperleucocytosis (WBC 118 × 109/L), anemia (hemoglobin 8.6 g/dl) and mild thrombocytopenia (98 × 109/L), with no associated splenomegaly. Peripheral blood smear showed hypercellularity with 90% blast cells. The morphological examination of bone marrow (BM) aspirate showed 90% agranular blast cells of medium and large size and the immunophenotypic analysis performed on a FACScalibur flow cytometer using standard protocol revealed that blast cells were CD34+, CD117+, CD33+, CD13+, HLA-DR+, CD2+ MPO+/−, CD7+/− []. A diagnosis of AML (M2) was established and the patient started cytoreduction with hydroxyurea obtaining after seven days of treatment a WBC count of 39 × 109/L. Conventional karyotyping was performed on the BM diagnostic aspirate after short-term culture and analyzed after G-banding. The description of the karyotype was made according to the International System for Human Cytogenetic Nomenclature. The cytogenetic analysis on G-banded metaphases disclosed a 46,XY,t(9;22)(q34;q11) karyotype. Then, interphase FISH experiments were carried out using BCR-ABL1 probes (Vysis) and demonstrated the presence of BCR-ABL1 fusion gene. At the resolution of a pulmonary aspergillus infection treated with voriconazole, while the cytogenetic and molecular analyses were ongoing, the patient started treatment with 5-aza-2′-deoxycytidine (otherwise called decitabine, 20 mg/m2 for 5 days) for a total of two cycles. Subsequently, nested RT-PCR revealed the simultaneous presence of the common p190 e1a2 and the rare e6a2 isoforms. PCR products, corresponding to BCR-ABL1 p190 amplification, were purified from agarose gel (QIAquick PCR Purification Kit - Qiagen) and directly sequenced on ABI/Prism 3130 Sequencer (Thermo Fisher Scientific) using BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). RQ-PCR for e6a2 BCR-ABL1 transcript analysis was performed using the forward primer Q-BCR_ex6_F (GATCCAACGACCAAGAACTCTCT), the reverse primer ENR561 and the ENP541 probe reported elsewhere []. The p190 e6a2 values were normalized on the number of ABL1 transcripts and expressed as the number of p190 e6a2 copies every 104 copies of ABL1. To assess molecular response after treatment, a real-time quantitative RT-PCR assay (RQ-PCR) for p190 e6a2 was designed by which we observed significant different kinetics through the e1a2 and e6a2 transcripts with consistent persistence of e6a2 []. After the first, BM aspirated showed 70% blast cells and two transcripts e1a2 and e6a2 were respectively 3.09 and 5805.47/104 ABL1, while after second cycles blast cells were 20% and e1a2 and e6a2 5.71 and 5747.52. Because of persistent pancytopenia and presence of blasts after two cycles of decitabine and in light of molecular data, the patient was then switched to TKI treatment. The initial therapy consisted of imatinib 600 mg/day for two weeks that was subsequently reduced to 400 mg/day due to febrile neutropenia. After one month of imatinib, bone marrow showed 60% blast cells with small improvement of thrombocytopenia. Therefore, treatment was switched to dasatinib 100 mg/day, but it was discontinued five days later because of pulmonary embolism. At 10 days of TKI discontinuation, e1a2 and e6a2 were 0.17 and 9477.16/104 ABL1, respectively. After two months of continuous therapy with TKIs, bone marrow infiltration was present and the two transcripts were e1a2 1.6 and e6a2 23727.06/104 ABL1. The patient, still refractory to second-line treatment, died of pulmonary infection.