Neoempheria sp. D

(Fig. 72A–D)

https://singapore.biodiversity.online/species/A-Arth-Hexa- Diptera-000780

Neoempheria _spD_ZRCBDP0049022_hapZRCB- DP0049022_SMH_unnamed_type [1: A, 16: C, 49: C, 55: A, 56: C, 109: C, 137: C, 139: A, 173: C] AttatcttcaactatCg ctcacacaggggcttctgttgatttagcaatCttttcACttcatttagcaggtatttc ctcaattttaggagctgtaaattttattactacCattattaatatacgagccccagga attCaAtttgatcgaatacctttatttgtttgatcagttCtaattacagctgttttacta ttactttctttaccagttttagctggggctattacaatattattaacagatcgtaatttaa atactagtttttttgaccctgcaggaggaggagatcctatcctttaccaacatttattt

Description

Female (Fig. 72A). Wing length, 3.61; width, 1.31. Head. Light brown, ochre-yellow posteriorly to vertex, cream-yellow on ventral half of occiput. Antennal scape and pedicel ochre, with a light brown longitudinal band, flagellum dark brown. Face and clypeus light brown. Max- illary palpus brown, distal palpomere lighter, labella whitish. Post-ocellar setae present, no setae on frons beyond line of ocelli. Scape 1.5× pedicel length, flagellomere 1 1.3× flagellomere 2 length, flagellomere 4 1.0× longer than wide. Palpomere 4 1.2× palpomere 3 length, palpomere 5 1.9× palpomere 4 length. Thorax. Scutum with ochre-yellow background, five brown longitudinal stripes, an ad- ditional slender brown mark laterally above anepisternum. Pleural sclerites whitish with orangish tinge except for a brown mark on antepronotum anteriorly, brown cervical sclerite, a slender ochre-brown mark dorsoposteriorly on laterotergite, and a brown mark across dorsal half of mediotergite. Scutum with a prescutellar bristle medially on dorsocentral line and two prescutellar bristles on lateroposterior corner; scutellum with one pair of bristles, no additional small setae. Antepronotum with two bristles and some additional smaller setae, proepisternum bare. Halter light brown. Legs. Coxae whitish with an orang- ish tinge, femora ochre-yellow with some elongate light brown marks, tibiae light greyish-brown with brown tips, tarsi brown [fore tibiae and tarsi missing]. Hind tibia inner spur 3.5× longer than tibia width at apex. Wing (Fig. 72B, C). Membrane with a slender dark brown band across wing at level of sc-r, a brown mark over R 4 and a brown band across distal third of wing beginning at level of base of medial fork. C extending beyond tip of R 5 for a fifth of distance to M 1; Sc reaching C almost at level of mid of cell r1; sc-r well sclerotized, at level of origin of Rs; R 4 present, anterior end slightly inclined towards base of wing, cell r1 long, anterior margin of cell r1 3.4× longer than length of R 4; first sector of Rs 1.1× r-m length. False medial vein present, weakly sclerotized. M 1+2 4.1× r-m length; bM 7.6× length of first sector of Rs. First sector of CuA 1.1× longer than second sector. M 4 not depressed on distal half. Cubi- tal pseudovein sclerotized almost to posterior margin; CuP sclerotized to level of basal third of second sector of CuA. Anal fold faint. Wing margin gently emarginated at tip of CuA. No ventral macrotrichia on veins, dorsal macrotrich- ia on entire length of bR, R 1 and second sector of Rs, distal 2/3 of M 1, distal third of M 2, distal half of M 4, distal third of first sector of CuA, and entire second sector of CuA; Sc, sc-r, first sector of Rs, R 4, r-m, bM, and CuP entirely de- void of macrotrichia. Abdomen. Tergites 1–6 ochre-yellow with dark brown medial marks, brown mark of tergite 5 extending laterally, tergites 3–5 with a light brown mark along lateral margin; tergite 7 ochre-yellow anteriorly with a diffuse light brown mark along posterior half; no lateral projections on tergite 7. Sternites 1–2 whitish, sternites 3–6 cream-yellow, sternite 7 ochre-yellow. Terminalia (Fig. 72D). Dark ochre-yellow, tip of sternite 8 lobes light brown, cerci dark brown. Sternite 8 anterior plate weakly sclerotized, wide, lateroanterior corners extending anteriorly to articulate with tergite 8, medio-posteriorly a wide medial subquadrate plate with a medial incision separating a pair of short elongate lateroposterior projections. Sternite 9 with a pair of slender lateral arms. Tergite 8 large, wide, with microtrichia and no setae, lateroanterior corners extending ventrally to meet sternite 8. Tergite 9+10 slender, with a sequence of short protuberance along posterior margin bearing an elongate seta at tip. Sternite 10 extending to level of tip of cercomere 1, with a medial transparent elongate window. Cercomere 1 1.6× longer than cercomere 2, both laterally compressed, densely covered with microtrichia and short setae.

Male. Unknown.

Material examined

Two females: ZRCBDP0049022, Nee Soon (NS2), 07.jan.15, MIP leg. (website photo specimen, slide-mounted); ZRCB- DP0049255, Nee Soon (NS1), 10.dec.14, MIP leg.