Quickstart¶
Bamnostic is meant to be a reduced drop-in replacement for
pysam. As such it has
much the same API as pysam with regard to BAM-related operations.
Note
the pileup() method is not supported at this time.
Importing bamnostic¶
import bamnostic as bs
Loading your BAM file¶
Bamnostic comes with an example BAM (and respective BAI) file just to
play around with the output. Note, however, that the example BAM file
does not contain many reference contigs. Therefore, random access is
limited. This example file is made availble through
bamnostic.example_bam, which is a just a string path to the BAM file
within the package.
>>> bam = bs.AlignmentFile(bs.example_path, 'rb')
Get the header¶
Note: this will print out the SAM header. If the SAM header is not in the BAM file, it will print out the dictionary representation of the BAM header. It is a dictionary of refID keys with contig names and length tuple values.
>>> bam.header
{0: ('chr1', 1575), 1: ('chr2', 1584)}
Data validation through head()¶
>>>bam.head(n=2)
[EAS56_57:6:190:289:82 69 chr1 100 0 * = 100 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192,
EAS56_57:6:190:289:82 137 chr1 100 73 35M = 100 0 AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0 NM:C:0 UQ:C:0 H0:C:1 H1:C:0]
Getting the next read¶
>>> print(next(bam))
EAS56_57:6:190:289:82 69 chr1 100 0 * = 100 0 CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192
Exploring a read¶
# Using a more complex read
>>> for complex_read in bam:
... if complex_read.read_name == 'EAS218_4:1:48:9:409':
... print(complex_read)
... break
EAS218_4:1:48:9:409 99 chr1 271 75 18M5I12M = 464 228 GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA <<<<<<<<<<<<<:<<<<<<<<<<<<<<<<<<<<< MF:C:130 Aq:C:75 NM:C:0 UQ:C:0 H0:C:0 H1:C:0
There are, essentially, 3 contexts of a given read:
- (raw) The raw read
- (aligned) The sequence that aligns (including insertions but not clipping)
- (reference) The sequence that aligns to the reference only (excluding clipping and insertions)
Let’s explore an example of those different contexts.
Read Name¶
>>> print(complex_read.read_name)
EAS218_4:1:48:9:409
0-based Start Position (raw, aligned, reference)¶
If you look at the next code example, you will see that the start position is listed
as 270, while when we printed out the read earlier, it showed as 271. This is because
special care was taken to ensure all printed versions of the read followed traditional
SAM format, which is 1-based. This means that the print() output of a read is always
guaranteed to be a valid SAM entry.
However, all direct access attributes will be treated as 0-based, so as to fit in line with common Python conventions.
>>> print(complex_read.pos, complex_read.query_alignment_start, complex_read.reference_start)
270 270 270
CIGAR & QUAL Strings¶
>>> print(complex_read.cigarstring)
18M5I12M
# ASCII-encoded and offset quality scores
>>> print(complex_read.qual)
<<<<<<<<<<<<<:<<<<<<<<<<<<<<<<<<<<<
# Decoded and raw
>>> print(complex_read.query_qualities)
array('B', [27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 25, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27, 27])
Sequence Length (raw, aligned, reference)¶
Since the CIGAR string contains an insertion of 5 bases, the read’s reference length should be 5 bases shorter than the query.
>>> print(complex_read.query_length, complex_read.query_alignment_length, complex_read.reference_length)
35 35 30
Nucleotide Sequence¶
# nucleotide sequence (raw)
>>> print(complex_read.query_sequence)
GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA
# nucleotide sequence (aligned)
>>> print(first_read.query_alignment_sequence)
GTTTAGTGCCTTTGTTCACATAGACCCCCTTGCAA
# the reference sequence cannot be generated because the read does not have
# an MD tag associated with the CIGAR string
Read Flag and Decoded Flag¶
>>> print(first_read.flag)
69
# decoded FLAG
>>> bs.utils.flag_decode(first_read.flag)
[(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
Serial Access¶
>>> bam = bs.AlignmentFile(bs.example_path, 'rb')
>>> for i, read in enumerate(bam):
... if i >= 3:
... break
... print(read)
EAS56_57:6:190:289:82 137 chr1 100 73 35M = 100 0 AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS51_64:3:190:727:308 99 chr1 103 99 35M = 263 195 GGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGG <<<<<<<<<<<<<<<<<<<<<<<<<<<::<<<844 MF:C:18 Aq:C:73 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS112_34:7:141:80:875 99 chr1 110 99 35M = 265 190 AGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAA <<<<<<<<<<<<<<<<<<<<<<:<<8;<<8+7;-7 MF:C:18 Aq:C:69 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
Random Access¶
>>> bam = bs.AlignmentFile(bs.example_path, 'rb')
>>> for i, read in enumerate(bam.fetch('chr2', 1, 100)):
... if i >= 3:
... break
... print(read)
B7_591:8:4:841:340 73 chr2 1 99 36M * 0 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA <<<<<<<<;<<<<<<<<;<<<<<;<;:<<<<<<<;; MF:C:18 Aq:C:77 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:4:142:943:582 73 chr2 1 99 35M * 0 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA <<<<<<;<<<<<<:<<;<<<<;<<<;<<<:;<<<5 MF:C:18 Aq:C:41 NM:C:0 UQ:C:0 H0:C:1 H1:C:0
EAS54_67:6:43:859:229 153 chr2 1 66 35M * 0 0 TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA +37<=<.;<<7.;77<5<<0<<<;<<<27<<<<<< MF:C:32 Aq:C:0 NM:C:0 UQ:C:0 H0:C:1 H1:C:0